Printer Friendly

Expression and purification of functionally active recombinant human alpha 1-antitrypsin in methylotrophic yeast Pichia pastoris.

Abstract

Human alpha 1-antitrypsin (AAT) cDNA was obtained from HepG2 cell lines. After PCR and construction of expression vector pPICZa-AAT, human AAT was expressed in the yeast Pichia pastoris (P.pastoris) in a secretary manner and under the control of inducible alcohol oxidase 1 (AOXi) promoter. The amount of AAT protein in medium was measured as 60 mg/I 72 hr after induction with methanol. Results indicated the presence of protease inhibitory function of the protein against elastase. Purification was done using His-tag affinity chromatography. Due to the different patterns of glycosylation in yeast and human, the recombinant AAT showed different SDS-PAGE patterns compared to that of serum-derived AAT while p1 shifted from 4.9 in native AAT compared to 5.2 in recombinant AAT constructed in this study.

Avicenna / Med Biotech 2011; 3(3): 127-134

Keywords: Alpha 1-antitrypsin, Plchia pastoris, Protease inhibitors, Recombinant proteins

Introduction

Human alpha 1-antitrypsin (AAT) is the major member of serin protease inhibitor (serpin) super family in plasma which is mainly produced in liver (1) It is now recognized that AAT is a potent inhibitor of multiple serine proteases, and protects tissues against their harmful effects. The average concentration of AAT in plasma is 1.3 mg/ml, with a half-life of 3 to 5 days. Individuals with plasma AAT values below 0.7 mg/ml are considered to be AAT deficient (2), (3). Intravenous administration of a pasteurized pooled human plasma AAT product (Prolastin; Bayer Corporation) is used to increase AAT levels in deficient individuals (4) This approach of therapy is practical and feasible (5), (6). However, there are two major obstacles; namely source limitation and risk for emerging viruses (7). Alternatively, the recombinant versions of AAT have been under intensive investigation.

Since the early 1980s, the human AAT gene has been expressed in various hosts, including Escherichia coli (E.coli), yeasts, insect cells, CHO cells, as well as in transgenic plants and animals. Protein size, glycosylation pattern, metastable inhibitory nature of AAT and production cost represent the challenges in the production of recombinant AAT (8-12).

We considered the metylotrophic yeast P.pastoris as an attractive host for production of human AAT. It is a single-cell eukaryote with the advantages of both prokaryotic and eukaryotic hosts. One of its main advantages is the ability for introducing many of posttranslational modifications such as glycosylation and proteolytic processing which is obtained through moving in the secretory pathway (13). For glycoproteins such as AAT, these modifications are very important for appropriate function and/or structure (14), (15)

In the present study the AAT was expressed in P.pastoris as a fusion protein to a histidine tag (His-tag) which facilitates purification step. Signal sequence from Saccharomvces cerevisiae a-mating factor (a-MF) was included to direct secretion of the protein to extracellular medium. This powerful expression system made use of the highly inducible alcohol oxidase 1 (AOXI) promoter to express large quantities of glycosylated protein. The P.pastoris produced AAT activity and its features were evaluated for the first time using elastase inhibitory assay and Isoelcctric Focusing (IEE), respectively. Mobility shift caused by addition of tunicamyc in-a N-linked glycosylation inhibitor-to culture indicated the effect of glycosylation on the protein weight and SDS-PAGE protein band pattern. These data will be used in future studies for generating a new recombinant AAT protein with pharmaceutical objectives.

Materials and Methods

Bacteria and P. pastoris strains and media

The E.coli strain DH5[alpha] was used for propagation of recombinant plasmids. The P.pastons strain X-33 (Invitrogen) was used as a host for the protein expression. Recombinant bacteria were cultured in low salt LB broth medium (0.5% (w/v) yeast extract, 1% (w/v) tryptone, 0.5% (w/v) NaCl) supplemented with 25 [micro]g [ml.sup.-1] of zeocin (Invitrogen). P.pastons was cultured on the following media: YPDS plates (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose, 1 M sorbitol, and 1.5% (w/v) bacteriological agar) supplemented with 100 [micro]g [ml.sup.-1] of zeocin; Buffered Glycerol-complex Medium (BMGY) medium (1% (w/v) yeast extract, 2% (w/v) peptone, 100 mM potassium phosphate, 1.34% (w/v) Yeast Nitrogen Base (YNB), 4x[10.sup.-5]% (w/v) biotin, 1% (v/v) glycerol, pH=6.0); Buffered Methanol-complex Medium (BMMY) medium (1% (w/v) yeast extract, 2% (w/v) peptone, 100 mM potassium phosphate, 1 .34% (w/v) YNB, 4x[10.sup.5]% (w/v) biotin. 0.5% (v/v) methanol, p1-1=6.0) supplemented with 2% Phenyl Methyl Suiphonyl Fluoride (PMSF); Minimal Dextrose (MD) agar (1.34% (w/v) YNB, 4x[10.sup.5]% (w/v) biotin., 2% (w/v) dextrose, 2% (w/v) agar); and Minimal Methanol (MM) agar (1.34% (w/v) YNB, 4x[10.sup.5]% (w/v) biotin, 0.5% (v/v) methanol, 2% (w/v) agar).

Cloning of AAT in pPICZaB plasmid

Since the hepatic cells are the main source for AAT expression, total RNA was extracted from human hepatocellular carcinoma (Hep G2) cell line (obtained from the Pasteur Institute of Iran, Tehran). Briefly, about [10.sup.7] cells were harvested and total RNA was isolated using RNeasy Mini Kit (Qiagen) according to manufacturer's instruction. Primers 1 (5'CTC TCGAGAAAAGAGAGGCTGAAGCTGAAGATCCCCAGGGAGATG 3') and 2 (5'GCTACTCTAGATAATTTTTGGGTGGGATTCAC 3') were employed to amplify AAT cDNA excluding its signal peptide (amino acid residues 1-24) from the 100 ng RNA in 20 [micro]l reaction using the One-Step RT-PCR Kit (Qiagen). In designing the primers, restriction sites of Xhol and XbaI were incorporated at the 5' ends of the PCR products. The cDNA product was cloned into the pPICZuB plasmid (Invitrogen) in a way to introduce the His-tag epitope at the carboxyl terminal of the recombinant AAT.

P.pastoris transformation and selection

P.pastoris cells were grown overnight in YPD broth (at 30 [degree]/250 rpm) and prepared for transformation according to the manufacturer's recommendations (Invitrogen). The recombinant plasmid was linearized with Sad and electrotransformed into the 80 [micro]l of competent P.pastoris using a Bio-Rad genepulser apparatus (at 1.5 kV, 25 F, 400 [OMEGA] and 8 ms). Hundreds of transformed cells were selected by growing on YPD agar plate in presence ot 100[mu]g [ml.sup.-1] of zeocin.

Determination of methanol utilizing (Mut) phenotype

Transformation of P.pastoris X-33 cells with linearized DNA results in two phenol-types of host cells in respect with methanol utilization (Mut). Since single crossover recombination at the AOXI promoter region is favored, most of the transformants have [Mut.sup.+] phenotype in which the AOXI gene is intact. However, due to the presence of the AOXI terminator sequences in the plasmid, there is a chance for second recombination at this region which result in replacing of AOXI gene with desired one hence creating [Mut.sup.S] phenotype. The latter is weak in metabolizing methanol. The Mut phenotype for the transformed X-33 cells was determined by growing one hundred clones on minimal media with methanol (MM) or dextrose (MD) plates. Chromosornal integration of the plasmid DNA and right orientation of the expression cassette containing the AAT cDNA were characterized by PCR analysis and DNA sequencing. 5' and 3' AOXJ primers (5' GACTGGTTCCAATTGACAAGC 3' and 5' GCAAATGGCATTCTGACATCC 3'), directed to the AOXI promoter and the transcription terminator were used for this purpose.

Shake flask protein expression

Ten verified transformants were grown at 30[degree] in 10 ml BMGY medium for 24 hr until reaching an [OD.sub.600] of 10. The cells were harvested and resuspended in 50 ml BMMY medium containing O.5% (v/v) methanol. After incubating the cells at 30[degree]/200 rpm for 72 hr methanol was added at 1% (v/v) once a day to maintain induction.

SDS-PAGE and silver staining

The cells were removed and the supernatant was precipitated by using 100% Tnchioroacetic Acid (TCA) solution. After drying, the pellet was resuspended in loading buffer containing [beta]-mercaptoethanol, heated for 10 min, in boiling water and electrophoresed at 12% SDS-PAGE/100V along with molecular weiaht marker (Fermentas).Gel was stained with silver nitrate according to Celis and coworkers (16).

Western blot analysis

Protein samples resolved on SDS-PAGE, were electro-blotted to Polyvinylidene Di-fluoride (PVDF) membrane (Mill ipore) in transferring buffer (0.025 M Tris, 0.19 M glycine, and 20% (v/v) methanol) overnight at 20% V/4[degree]. The membrane was treated with PBS-T-BSA (PBS, 0.1% (v/v) Tween 20, 1% (w/v) BSA) for 2 hr to block binding sites. After washing step, membrane was reacted with 1000-fold diluted goat anti-human alpha-1 antitrypsin polyclonal antibody, conjugated with HRP (Abcam) for 3 hr. To eliminate non specific reactions, a supernatant of non-recombinant X-33 culture treated side by side accordingly as negative control. Subsequently, protein bands reacted positively, were visualized at the presence of 4-chloro1-naphtol substrate in PBS.

Quantification of AAT

The Enzyme-linked immunosorbent Assay (ELISA) was used for quantitative determination of secreted AAT levels in the medium using human alpha 1-antitrypsin ELISA Quantitation Kit (GenWay Biotech, Inc) according to the manufacturer's recommendations. For all experiments the samples were diluted 200 folds in sample/conjugate diluents (50 mM Tris, 0.14 M NaCl, 1%, (w/v) BSA, 0.05% (v/v) Tween 20, pH=8.0). Different concentrations of commercial human AAT (Sigma) were used to construct standard curve, while supernatant of non-recombinant P.pastoris (X-33 strain) culture was used as a negative control.

Affinity chromatography purification

For the purification of His-tag fused AAT, the supernatant was applied to a nickel-immobilized chelating sepharose fast flow column (Amersharn, Biosciences). For this purpose supernatant first was diluted with equal volume of 2X binding buffer (50 mm Na[H.sub.2][PO.sub.4], 500 mM NaCL, 10 mM imidazole, pH=7.4) and loaded on to the column. After passing the wash buffer (50 mM Na.H.sub.2][PO.sub.4]. 500 mM NaCl, a gradient of imidazole from 20 40 mM and 0.05% (v/v) Tween 20, pH=7.4) through the column. (lie resin-bounded recombinant AAT was eluted with elution buffer (50 mM Na[H.sub.2][PO.sub.4]. 500 mM NaCl, 250 mM imidazole, and 0.05% (v/v) Tween 20, ph=7.4

Inhibitory activity assay

Elastase activity was measured by EnzChek[sup.R] Elastase Assay Kit (Molecular Probes, Inc.) according to the manufacturer's recommendations. The EnzChek kit contains DQ[TM] clastin soluble bovine neck ligament elastin that has been labeled with BODIPY[R] FL dye such that the conjugaie's fluorescence is quenched. The non-fluorescent substrate can he digested by elastase or other proteases to yield highly fluorescent fragments. The presence of an inhibitor such as AAT blocks the substrate digest ion hence subsequent fluorescent emission. The resulting change in fluorescence level was monitored using a standard fluorometer (Hitachi F-3010) with a maximum absorption at 505 nm and a maximum fluorescence emission at 515 nm. Commercial human AAT as used as a positive control and the elution huller and the supernatant from non-recombinant P.pastoris (X-33 strain) culture as negative controls.

Isoelectrofocusing (IEF)

IEF was accomplished on a pharmacia flatbed electrophoresis apparatus at 4[degree] using high voltage and carrier pharmalytes (Sigma) over the pH range of 4.5-5.4. The experiment was performed on the 7% polyacrylamide gradient gel. Subsequently, the IEF gel was stained with Coomassie Brilliant bule R-250.

Inhibiting protein glycosylation using tunicamycin

Tunicamycin was used to block in vivo glycosylation of the recombinant protein, tunicamycin (Sigma, T7765) was used at final concentration of 2.5 [micro]g/ml in BMMY culture medium. Cell density was checked every day and after 96 hr of induction with methanol, the supernatant was precipitated using 100% TCA solution. The results of SDS-PAGE and western blotting were compared to those of P.pastoris at the same conditions except no tunicamycin.

Results

AAT cloning in P.pastoris

The cDNA of AAT from HepG2 cell line was cloned in frame with the [alpha]-MF secretion signal into the expression vector pPICz[alpha]-B. The resulting plasmid was named pPICZ[alpha]-AAT. Transformants were selected on YPDS agar containing zeocin, and the Mut phenoltype was determined by growing them on selective MD and MM media. According to correspond data, more than 90% of transformants had equal growth features on both media that is a proof for [Mut.sup.+] phenotype. PCR results with AOXI primers for grnomis DNA were consistent with those of screening in selective media and confirmed that the AAT gene had been integrated into the AOXI locus. The correct orientation and nucleotide sequcne of AAT cDNA within the P.pactoris genome verihed by sequencing. [Mut.sup.+] clones showed two different bands in agarose gel electrophoresis, the 1.8 kb fragment which was amplified from AAT expression cassette flanked by AOXI sequences and another 2.2 kh fragment which was amplified from AOXI gene of P.pasforis. In [Mut.sup.S] clones only 1.8 kb hand was observed, which demonstrates the disruption of AOXI gene (Figure 1).

[FIGURE 1 OMITTED]

SDS-PAGE and AAT purification

Supernatant samples from cultures of lew positive clones and one negative clone (non-recombinant X-33) were subjected to SDS-PAGE analysis after precipitation with TCA. The results provided an additional band near 60 kDa only in positive clones (Figure 2 Lanes 1-6). The secreted protein was purifled from the supernatant by passing through a nickel column and fractions were screened by SDS-PAGE. The purified protein samples were seen as two or three smeared bands alter Coomassie brilliant blue R-250 staining (Figure 3A).

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

Immunoblot assays

To confirm the identity of recombinant protein, the purified Protein was reacted with AAT antibody in a western blot analysis. The recombinant AAT was identified as two distinct bands (Figure 3B, Lane 2) with a molecular weight slightly larger than that of the commercial protein (Figure 3B. Lane 1).

AAT levels in supernatant were determined by quantitative ELISA. using two specific monoclonal antibodies against AAT. Level of protein expression was determined in ten [Mut.sup.+], three [Mut.sup.S], and one non-recombinant X-33 clones. According to our data, methanol induction at concentration of 0.5% (v/v) for the first day and 1% (v/v) for the next two days could result in highest level of protein secretion in [Mut.sup.+] phenotype. Average quantities of protein expression were 60 mg/l and 44 mg/l after 72 hr for [Mut.sup.+] and [Mut.sup.S] clones, respectively (Figure 4).

[FIGURE 4 OMITTED]

Functional assay and IEF

Data from the activity assays provided an increase in detected fluorescence levels when the elution buffer and/or the supernatant of non-recombinant X-33 culture were screened. However, no changes were seen for commercial AAT and the recombinant AAT (Figure 5).

[FIGURE 5 OMITTED]

After staining with Coomassie brilliant dye, recombinant AAT protein was visualized as three bands in IEF acrylamide gel migrating at5.1 to 5.2 kDa, while plasma derived AAT was detected as five bands from 4.7 to 4.9 kDa (data was not shown).

Effect of tunicamycin

To investigate whether the protein bands with higher molecular weight were due to different glycosylation, we expressed the AAT in media containing tunicamycin which blocks glycosylation in vivo, and analysed the supernatant by SDS-PAGE and western blotting. In the presence of tunicamycin the AAT hand shifted to a position lowers than that of natural and recombinant proteins (Figure 6).

[FIGURE 6 OMITTED]

Discussion

The methylotrophic yeast P.pastoris, has emerged as an important and efficient host in modern biotechnology. It has been used as a successful expression system for recombinant protein in academic research and industrial production (17), (18).A large variety of proteins that cannot be expressed in E.coli at the correct level of post-translational maturation have been subsecquent1y produced in the eukaryotic cells (19), (20). The glycosylation pattern in P.pastoris is different from that of mammalians and this may or may not be a problem depending on the target protein arid its application.

AAT is a glycoprotein and addition of carbohydrate moieties to appropriate positions is an important post-translational modification that is essential for the stability of AAT protein (21), (22). Therefore, to obtain proper glycosylation is one of the major concerns in the production of recombinant AAT. The most suitable candidates for production of AAT in correct form with closest modification to authentic human AAT are mammalian cells (7). But using these cells for production of recombinant protein is a time consuming process and its industrial! pharmaceutical application is not cost efficient. Using yeasts like P.pastoris for production of AAT glycoprotein seems to be an effective alternative and has resulted higher yields. P.pastoris in comparison with two other yeasts (Saccharomyces cerevisiae and Hansenula, polymorpha) produces recombinant AAT with the glycosylation pattern closer to that of the authentic human AAT (23). Furthermore, P.pastoris core oligosaccharides were reported to have no immunogenic terminal [alpha]-1,3 glycan linkages (24) We selected metylotrophic yeast P.pas loris for production of AAT and according to our data this system could potentially be used as an effective host for this purpose.

The AAT was produced in quantities of up to 60 mg/l in shake flask. In SDS-PAGE, our recombinant protein showed a different migration pattern in comparison to that of plasma AAT. This could be the result of different patterns of glycosylation. Tunicamycin treatment which inhibits the glycosylation of secretary proteins, confirmed this idea. These differences in glycosylation pattern affected the mobility of recombinant protein on IEF and increased its pI in comparison to plasma derived AAT from 4.2-4.9 (25), (26) to 5.1-5.2.

Conclusion

Activity assay demonstrated the protease inhibitory power for this recombinant protein. The high mannose glycosylation apparently did not alter the main function of the protein. Besides, no change on AAT secretion was observed. The immunogenic properties of this protein will be studied for its medicinal potential. Further studies are needed to screen protein expression while increasing the production scale.

Acknowledgement

This work was supported by International Center for Genetic Engineering and Biotechnology (ICGEB) Trieste grant. We are also thankful to Dr. Mirfakhraee for his comment.

References

(1.) Crowther DC, Belorgey D, Miranda E, Kinghorn KJ, Sharp LK, Lornas DA. Practical genetics: alpha 1-antitrypsin deficiency and the serpinopathics. Eur J Hum Genet 2004; 12(3): 167-1 72.

(2.) Crystal RG. The alpha 1-antitrypsin gene and its deficiency states. Trends Genet 1989;5(12):411-417.

(3.) Nita I, Hollander C, Westin U, Janciauskiene SM. Prolastin, a pharmaceutical preparation of purified human aiphal-antitrypsin, blocks endotoxin mediated cytokine release. Respir Res 2005;3(1): 12-18.

(4.) Wewers MD, Casolaro MA, Sellers SE, Swayze SC, McPhaul KM, Wittes iT, et al. Replacement therapy for alpha 1-antitrypsin deficiency associated with emphysema. N Eng1 J Med 1987;316(17):1055-1062.

(5.) Tirado-Conde G, Lara B, Miravitlles M. Augmentation therapy for emphysema due to alpha-1-antitrypsin deficiency. Ther Adv Respir Dis 2008;2(1):13-21.

(6.) Stocks JM, Brantly ML, Wang-Smith L, Campos MA, Chapman KR, Kueppers F, et al. Pharniacokinetic comparability of Prolastin(R)-C to Prolastin (R) in Mpha-antitiypsin deficiency: a randomized study. BMC Clin Pharmacol 2010;10:13-24.

(7.) Dodd RY, Leiby DA. Emerging infectious threats to the blood supply. Annu Rev Med 2004;55:191-207.

(8.) Karnaukhova E, Ophir Y, Golding B. Recombinant human alpha-1 proteinase inhibitor: towards therapeutic use. Amino Acids 2006;30(4):317-332.

(9.) Kwon KS, Song M, Yu MH. Purification and characterization of alpha 1-antitrypsin secreted by recombinant yeast Saccharornyces diastaticus. J Biotechnol 1995;42(3):191-195.

(10.) Massoud M, Bisehoff R, Dalemans W, Pointu H, Attal J, Schultz H, et al. Expression of active recombinant human alpha 1-antitrypsin in transgenic rabbits. J Biotechnol 1991;18(3):193-203.

(11.) Macauley-Patrick S. Fazenda ML, McNeil B, Harvey LM. Heterologous protein production using the Pichia pastoris expression system. Yeast 2005;22(4):249-270.

(12.) Ghaedi M, Lotfi AS, Soleimani M, Shamsara M, Arimand S, Adibi B. Expression of recombinant alpha-1 antitrypsin in CHO and COS-7 cell line using antiviral vector. Iranian J Biotechnol 2009;7(3):148-156.

(13.) Cregg JM. Introduction: distinctions between Pichia pastoris and other expression systems. Methods Mol Biol 2007;389:1-10.

(14.) Bretthauer RK, Castellino FJ. Glycosylation of Pichia pastoris-derived proteins. Biotechnol App) Biocherri 1999;30(Pt 3)193-200.

(15.) Mattanovich D, Graf A, Stadlmann J, Dragosits M, RedI A, Maurer M, et al. Genome, secretorne and glucose transport highlight unique features of the protein production host Pichia pastoris. Microb Cell Fact 2009;8:29-42.

(16.) Celis JE, Carter N, Hunter T, Simons K, Small JV, Shotton D, (eds). Cell biology: A Laboratory Handbook. San Diego: Elsevier, Academic Press; 2006, 219-224.

(17.) Cos O, Ramon R, Montesinos JL, Valero F. Operational strategies, monitoring and control of heterologous protein production in the methylotrophic yeast Pichia pastoris under different promoters: a review. Microb Cell Fact 2006;5:17-37.

(18.) Senerovic L, Stankovic N, Spizzo P, Basso A, Gardossi L, Vasiljevic B, et al. High-level production and covalent immobilization of Providencia rettgeripenicillin G acylase (PAC) from recombinant Pichia pastoris for the development of a novel and stable biocatalyst of industrial applicability. Biotechnol Bioeng 2006;93(2):344-354.

(19.) Cregg JM. vedvick TS, Raschke WC. Recent advances in the expression of foreign genes in Pichia pastoris. Biotechnology 1993;11(8):905-910.

(20.) Morton CL, Potter PM. Comparison of Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, Spodoptera frugiperda, and COS7 cells for recombinant gene expression. Application to a rabbit liver carboxylesterase. Mol Biotechnol 2000;16(3):193-202.

(21.) Powell LM, Pain RH. Effeets of glycosylation on the folding and stability of human, recombinant and eleaved alpha 1-antitrypsin. J Mol Biol 1992;224(1):241-52.

(22.) Kwon KS, Yu MH. Effect of glycosylation on the stability of alphal-antitrypsin toward urea denaturation and thermal deactivation. Biochim Biophys Acta 1997;1335(3):265-272.

(23.) Kang HA, Sohn JH, Choi ES, Chung BH, Yu MH, Rhee SK. Glycosylation of human alpha 1-antitrypsin in Saccharomyces cerevisiae and methylotrophic yeasts. Yeast 1998;14(4):371-381.

(24.) Trimble RB, Atkinson PH, Tschopp JF, Townsend RR, Maley F. Structure of oligosaccharides on Saccharomyces SUC2 invertase secreted by the methylotrophic yeast Pichia pastoris. J Biol Chem 1991;266(34):22807-22817

(25.) Renversez JC, Lebrun-Fourcy C, Rondot J, Revol C. Determination of alpha 1 antitrypsin phenotypes in plasma using isoelectric focusing on this agarose gel. Pathol Biol 1998;46(1):15-20.

(26.) Zerimech F, Hennache G, Bellon F, Barouh G, Jacques Lafitte J, Porchet N, et al. Evaluation of a new Sebia isoelectrofocusing kit for alpha 1-antitrypsin phenotyping with the Hydrasys system. Clin Chem Lab Med 2008;46(2):260-263.

* Corresponding author: Abbas Scxhebghadan Lotfi, Ph.D., National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran-Karaj Highway, Tehran, Iran

Tel: +98 21 44580309

Fax: +9827 44580399

E-mail: lotfi-ab@nigeb.ac.ir

Received: 12 Apr 2011

Accepted: 10 Jul 2011

Sareh Arjmand (1), (2), (3), Elham Bidram (4), Abbas Sahebghadam Lotfi (2), (4), Mehdi Shamsara (2), and Seyed Javad Mowla (1)

(1.) Department of Molecular Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran

(2.) National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran

(3.) School of Pharmacy, Zanjan University of Medical Science, Zanjan, Iran

(4.) Department of Clinical Biochemistry, Tarbiat Modares University, Tehran, Iran
COPYRIGHT 2011 Avicenna Research Institute
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Arjmand, Sareh; Bidram, Elham; Lotfi, Abbas Sahebghadam; Shamsara, Mehdi; Mowla, Seyed Javad
Publication:Avicenna Journal of Medical Biotechnology (AJMB)
Date:Jul 1, 2011
Words:3861
Previous Article:Comparative expression profile of orphan receptor tyrosine kinase ROR1 in Iranian patients with lymphoid and myeloid leukemias.
Next Article:Construction and in vitro expression analyses of a DNA plasmid encoding dense granule GRA5 antigen of Toxoplasma gondii.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters