Printer Friendly

Expression and localization of carbonic anhydrase genes in the serpulid polychaete Hydroides elegans.

Abstract. The metalloenzyme, carbonic anhydrase (CA), catalyzes the reversible hydration of carbon dioxide into bicarbonate, and is responsible for biomineralization processes in animals. In the Annelida, the marine worms in the family Serpulidae are typified by the construction of calcium carbonate tubes. Hydroides elegans, a common member of warmwater biofouling communities around the world, provides an outstanding model for studies of calcification. To better understand the molecular process of biomineralization in H. elegans, we searched transcriptomes for CA genes at several life-history stages. Twelve CA genes were recovered in the transcriptomes. Whole mount in situ hybridization was performed for two of those genes on larvae and calcifying juveniles. A cytosolic CA isoform, HeCAl, and a secreted CA isoform, HeCA2, were expressed within the collar segment corresponding to the location of glands involved in formation of the calcified tube. Expression of these genes within collar segment tissues supports the role of CAs in generating bicarbonate for biomineralization processes. A phylogenetic tree of the [alpha]-CA gene family was constructed to increase understanding of CA-gene evolution within the family and its relationship to CA genes among the Metazoa.

Introduction

Biomineralization is an evolutionary adaptation by which organisms generate inorganic products in the form of ordered minerals for housing, structure, or defense. The process is important in all forms of life ranging from single-celled bacteria that produce simple calcified structures to multicellular organisms that construct complex crystalline structures like bones and shells. For marine calcifiers such as corals, bivalves, and sea urchins, both the physical and molecular processes of calcification are generally well understood. However, the Annelida, a phylum that is less well known for calcified structures, remain under-studied, especially regarding the molecular-genetic basis of biomineralization.

Numbering over 15,000 described species, annelids are diverse and ecologically important members of marine and terrestrial communities worldwide (Struck et al., 2011). The serpulids are a family of polychaete worms in which all species produce calcareous tubes that adhere tightly to submerged surfaces. Biomineralization in the serpulids occurs at the first thoracic segment, where two tubular glands are located along lateral sides on the ventral shield of the peristomium (Fig. 1) (Swan, 1950). The glands have been called "calcium-secreting glands" in published literature because they produce calcium carbonate (CaC[O.sub.3]) (Hedley, 1956). Surrounding the calcium-secreting glands and lining the ventral shield are epithelial, mucus-secreting cells. While the calcium-secreting glands supply the calcareous components of the tube, as observed by Swan (1950), Hedley (1956) hypothesized that the mucus-secreting cells produce the organic matrix molecules that provide the framework in which minerals are embedded. As the products are secreted, the animal uses its collar, which folds posteriorly from the anterior edge of the first thoracic segment, to mold the components onto the anterior end of the tube until they solidify.

Although it has been shown that the metalloenzyme carbonic anhydrase (CA) is involved in molluscan and cnidarian biomineralization processes, no study has examined the expression of biomineralization genes in serpulids (Miyamoto et al., 1996; Moya et al., 2008). Carbonic anhydrase is essential for calcifying organisms because it catalyzes the reversible hydration of carbon dioxide into bicarbonate and protons, and provides the bicarbonate necessary for calcium precipitation. Currently, there are five recognized families of CAs spanning an assemblage of taxonomic groupings: [alpha]-CA, [beta]-CA, [gamma]-CA, [delta]-CA, and [xi]-CA; metazoan genes are closely associated with the [alpha]-CA family (Chegwidden et al., 2000). The ancestral function of [alpha]-CAs involves physiological processes including respiration, acid-base balance, and electrolyte transport; however, numerous duplication events have occurred in the [alpha]-CA family, likely a result of the enzyme being co-opted for biomineralization processes (Maren, 1967; Jackson et al., 2007).

[FIGURE 1 OMITTED]

The tube-building serpulid polychaete Hydroides elegans (Haswell, 1883) serves as a useful model to study the molecular underpinnings of annelid biomineralization. During development, H. elegans undergoes rapid change as it transitions from a planktonic larva to a sedentary juvenile in response to bacterial biofilms (Unabia and Hadfield, 1999). The beginning of metamorphosis marks a transitional period when larvae secrete a proteinaceous primary tube that adheres to the substratum, followed shortly thereafter by the formation of a calcified secondary tube embedded within an organic matrix (Carpizo-Ituarte and Hadfield, 1998). Even though the small worm is less than 200 microns long at this stage, secondary tube accretion rates can exceed 1.5 mm [d.sup.-1], and aggregations of H. elegans can quickly overwhelm the hulls of naval vessels in as little as two months in tropical harbor embayments like Pearl Harbor, Hawaii (Nedved and Hadfield, 2009).

Studying the presence and localization of CA genes during juvenile calcification stages will provide important insight into biomineralization processes in the serpulids. Their transparent tissues, ease in culturing, and ability to calcify make juvenile H. elegans ideal for studying annelid calcification processes through molecular techniques such as in situ hybridization. The goals of the research described here were twofold: 1) to determine the gene sequences for CA from transcriptomes developed for H. elegans, and 2) to identify where expression of CA genes occurs within tissues of competent larvae and calcifying juveniles of H. elegans.

Materials and Methods

Animal collection and larval-juvenile culture

Vexar screens (Conwed, Minneapolis, MN) bearing adult specimens of Hydroides elegans were collected from Pearl Harbor, HI, and maintained in outdoor aquaria with running seawater at the Kewalo Marine Laboratory, Honolulu, HI. Adults were removed from their tubes to induce spawning. Embryos and developing larvae were reared at a density of 5-10 larvae [ml.sup.-1] in 0.22-[micro]m-filtered seawater (FSW). Daily water changes and feeding with the unicellular alga Isochrysis galbana Tahitian strain (6.0X[10.sup.4] cells [ml.sup.-1]) were performed until larvae reached competency 5 days post-fertilization (Nedved and Hadfield, 2009). Competent larvae were induced to settle on glass slides that had been submerged in flowing seawater for 3 weeks to allow time to develop a suitably inductive biofilm. Post-metamorphic juveniles were allowed to form calcified tubes for periods of 6 h or 10 days, with daily FSW changes and feeding (3.0X[10.sup.5] cells [ml.sup.-1] for animals <3-days-old; 1.0X[10.sup.6] cells [ml.sup.-1] for animals >3-days-old). Individuals were removed from their tubes by inserting an eyelash brush at the anterior aperture and gently pushing the animal out through the posterior end. The eyelash brush was made with a single human eyelash attached to the end of a 13-cm (3-mm diameter) wooden stick, using fingernail polish as adhesive.

Generation, assembly, and annotation of transcriptomes

Total RNA was extracted from both precompetent and competent larvae and adults, using an RNeasy kit (Qiagen, Valencia, CA). Each developmental stage was kept separate from the others; concentration and quality of the RNA were analyzed with an Agilent RNA 2100 Bionalyzer (Agilent Technologies, Santa Clara, CA). Samples were sent to the University of Utah's Microarray and Genomic Analysis Core Facility, where mRNA was separated from total RNA and then reverse transcribed into cDNA using a TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, CA). Libraries were paired-end sequenced on an Illumina HiSeq 2000 platform. Three replicates for each stage generated 101,539,704 paired-end reads. De novo assembly using the Trinity platform (Broad Institute, Cambridge, MA) on the paired-end reads generated 158,314 transcripts (Grabherr et al., 2011). Annotation was carried out by BLAST (Basic Local Alignment Search Tool) searches of transcripts against SWISS-PROT, TrEMBL, and nr (non-redundant) databases; and GO (gene-ontology) terms were assigned based on matches.

Carbonic anhydrase (CA) gene identification and cloning

In addition to searching the annotations with CA-specific identifiers, we used CA homologs identified from the literature to search the assembled transcriptomes of H. elegans by TBLASTN (translated nucleotide BLAST databases). Hydroides elegans carbonic anhydrases 1 and 2 (HeCAl and HeCA2, respectively) were 2 of 12 HeCA genes identified from recovered contigs in the transcriptomes. We generated cDNA libraries using the Advantage RT-for-PCR Kit (Clontech Laboratories, Mountain View. CA) from mixed life-history stages (competent larvae, juveniles, and adults), and successfully amplified a 738- and a 900-base-pair (bp) fragment for HeCAl and HeCA2, respectively, using oligonucleotide primers (Table 1). Isolated fragments were cloned into the pGEM-T (Promega, Madison, WI) vector. Plasmids were sent to the University of Hawai'i at Manoa ASGPB (Advanced Studies in Genomics, Proteomics and Bioinformatics) facility for Sanger sequencing, and screened to ensure that the correct inserts had been cloned.

Whole mount in situ hybridization

Competent larvae and 6-h and 10-day-old juveniles of H. elegans were relaxed in 7.5% magnesium chloride for 10 min, and fixed overnight at 4 [degrees]C in 3.7% formaldehyde in FSW. After fixation, specimens were washed with phosphate-buffered saline (PBS), dehydrated with methanol, and stored at -20 [degrees]C until further use. Sense and antisense, digoxigenin-labeled riboprobes were developed using the MEGAscript kit (Ambion, Austin, TX) from the cloned fragments for HeCAl and HeCA2. Whole mount in situ hybridization was performed according to a published protocol for H. elegans, with a riboprobe concentration of 1 ng [[micro]l.sup.-1] and a hybridization time of 48 h at 68 [degrees]C (Seaver and Kaneshige, 2006). Specimens were cleared, transferred to 80% glycerol solution, and mounted on glass slides. Samples were observed using differential interference contrast (DIC) microscopy on a Zeiss Axiophot microscope and photographed with a Zeiss AxioCam HRc camera (Carl Zeiss AG, Oberkochen, Germany).

Sequence and phylogenetic analyses

Le Roy et al. (2014) performed an [alpha]-CA phylogeny based on 137 complete or nearly complete genomic and transcriptomic amino acid sequences accumulated from the NCBI (National Center for Biotechnology Information), JGI (Joint Genome Institute), and SpBase (Cameron et al., 2009). Twelve CA genes, which we identified in the transcriptomes of H. elegans, were added to these 137 sequences. Analysis of the amino acid sequences from H. elegans was performed using SMART, SignalP ver. 4.1, and TMHMM ver. 2.0 sequence prediction software (Schultz et al., 1998; Krogh et al., 2001; Petersen et al., 2011). Sequences were also analyzed by running conserved domain searches on NCBI (Marchler-Bauer et al., 2014). Coding sequences used in the [alpha]-CA phylogeny were aligned with Geneious ver. 7.1.5 using ClustalW (gap opening: 10; gap extension: 0.2) and trimmed with TrimAl to remove non-conserved regions (Capella-Gutierrez et al., 2009; Kearse et al., 2012). ProtTest ver. 2.4 determined a model of protein evolution (LG + G model) under the Akaike Information Criteria (AIC) (Abascal et al., 2005). Maximum likelihood analysis was performed using RAxML (Stamatakis, 2006) with 1000 bootstrap replicates.

Results

Characteristics of HeCA sequences

Twelve carbonic anhydrase (CA) genes were identified from transcriptomes of Hydroides elegans, and named HeCAl, HeCA2, HeCA3, HeCA4, HeCA5, HeCA6, HeCA7, HeCA8, HeCA9, HeCAlO, HeCAl 1, and HeCA12 (Table 2). Based on BLASTX searches against GenBank and conserved-domain searches on NCBI (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi), the complete open reading frames (ORFs) were determined for 8 of the 12 sequences (Table 2). The remaining 4 sequences, without complete ORFs, included 2 with missing start codons (HeCA4 and HeCA9) and 2 with missing stop codons (HeCA3 and HeCA12) (Table 2). Because the 4 partial sequences contained all of the CA conserved domains and spanned nearly the entire ORF, they were included in the phylogeny. In silico analysis revealed 7 signal-peptide-containing genes and 3 with GPI-linked (glycophosphatidylinositol) domains (Table 2). There were no predicted transmembrane regions in any of the complete HeCA sequences, based on two different prediction-modeling programs (SMART and TMHMM). In addition, two gene fragments were successfully PCR-amplified using HeCAl and HeCA2 oligonucleotide primers. Closer examination of the HeCAl and HeCA2 sequences revealed that HeCA2 contained a signal peptide, but HeCAl contained no recognized signal-peptide domains (Fig. 2). Both HeCAl and HeCA2, when compared to homologous sequences from other metazoans, contained characteristic [alpha]-CA domains, QSPINI, GSEH, GLAVL, and GSLTTP, and included three histidine residues that are essential for regeneration of the zinc active-site (Fig. 2).

[FIGURE 2 OMITTED]

In situ hybridization expression patterns of HeCAl and HeCA2

Expression occurred in competent larvae and 6-h and 10-day-old juveniles using HeCAl and HeCA2 antisense probes (Fig. 3). Using HeCAl and HeCA2 sense probes, no expression occurred in any of the three stages. Competent larvae of H. elegans are free-swimming planktotrophic animals with a ciliated prototroch and metatroch and a collar (Fig. 3C). Expression of HeCAl and HeCA2 was restricted to two symmetrical points along lateral sides of the collar segment, during the competent larval stage (Fig. 3A, B). As larvae undergo metamorphosis, they lose their trochs and develop collar structures and branchial rudiments (Fig. 3F). Slight differences in gene expression patterns between HeCAl and HeCA2 became apparent by the 6-h juvenile stage, but remained localized to the anterior region of the animals for both genes (Fig. 3D, E). HeCAl was restricted to symmetrical points (Fig. 4A, B), while HeCA2 was expressed throughout the entire first thoracic segment and collar, and in parts of the branchial rudiments (Fig. 4C, D). Differences in expression patterns between the 2 genes became more pronounced in 10-day-old juveniles, which have fully developed branchial tentacles, collar, and abdominal segments (Fig. 31). Expression of HeCA2 was present in the branchial tentacles, first thoracic segment, and abdominal segments, while HeCAl was expressed in the first thoracic segment and lower abdominal segments (Fig. 3G, H). Closer examination of the collar segment revealed similar expression patterns between HeCAl and HeCA2; they were enhanced at two locations where the calcium-secreting glands are located (Fig. 5A, B).

Phylogenetic analysis

To assess the evolutionary relatedness of [alpha]-CA genes, a multi-taxon protein phylogeny was constructed using maximum-likelihood analysis on 149 genomic and transcriptomic sequences (Fig. 6). As shown in the phylogeny presented by Le Roy et al. (2014), the [alpha]-CA family divides into an early branching and monophyletic poriferan clade in addition to two [alpha]-CA secondary clades. The two secondary clades are categorized by their subcellular localizations into cytosolic-mitochondrial type [alpha]-CAs and secreted and membrane-bound type [alpha]-CAs. The cytosolic-mitochondrial clade contains 5 [alpha]-CA sequences (HeCAl, HeCA7, HeCA9, HeCAl 1, and HeCAl2) from H. elegans, which are polyphyletically arranged in 4 clades (Clade I-Clade IV) (Fig. 6). Clade I contains HeCAl, HeCA12, and CAs from 3 non-annelidan species, Lottia gigantea, Acropora millepora, and Branchiostoma floridae; Clade II contains HeCA12 and CAs from 2 other annelid species, Riftia pachyptila and Capitella teleta; Clade III contains HeCA7 and CAs from 2 other species, Lottia gigantea and Capitella teleta; and Clade IV contains HeCA9 and CAs from 3 non-annelidan species, Trichoplax adhaerens, Acropora millepora, and Branchiostoma floridae. The secreted and membrane-bound secondary clade contains the remaining 7 [alpha]-CA sequences (HeCA2, HeCA3, HeCA4, HeCA5, HeCA6, HeCA8, and HeCA10) from H. elegans. In addition, sequences from H. elegans are grouped monophyletically within a single clade (Clade V) and include Strongylocentrotus purpuratus, Lottia gigantea, Capitella teleta, Trichoplax adhaerens, and Acropora millepora.

Discussion

Recognizing that the enzymatic processes in biomineralization are broadly conserved within Metazoa (Le Roy et al., 2014), we hypothesized that carbonic anhydrase (CA) genes were expressed in tissues involved in biomineralization in tube-building serpulids. Carbonic anhydrase genes were seen as logical candidates for providing the molecular basis for biomineralization in annelids, because the enzyme readily hydrolyzes carbon dioxide to form bicarbonate--a precursor of calcium carbonate (CaC[O.sub.3]) precipitation. The hypothesis was supported by identification of 12 CA genes in the transcriptomes of Hydroides elegans and by localization of two of those genes in the first thoracic segment, where calcification occurs, by in situ hybridization.

During the larval stage, H. elegans carbonic anhydrases 1 and 2 (HeCAl and HeCA2) exhibited identical expression patterns within the collar segment, signifying gene activation during a non-biomineralization stage. Divergence in expression patterns occurred following metamorphosis, with branchial rudiment staining in the 6-h juveniles and expression of the transcripts in lower abdominal tissues by the 10-day-old juvenile stage. We hypothesize that protein products are involved in different functions depending on location found. For instance, staining that occurred within the collar segment corresponded to the location where Hedley (1956) first described the calcium-secreting glands in serpulids. But expression within branchial tentacles, where gas exchange occurs in serpulids (De Cian et al., 2003), indicates involvement in respiration processes. While both genes are localized to the collar segment in all three stages, they also had diffuse expression patterns within abdominal segments that are likely not consistent with functions involved in biomineralization. Through duplication events, CA genes may have been co-opted for biomineralization from their ancestral roles, accounting for the multiple sequences discovered within the transcriptomes, and tissue expression seen in different tissues within H. elegans.

Enhanced expression of HeCAl and HeCA2 in the first thoracic segment, where tube formation is known to occur, however, is consistent with biomineralization functions. In serpulids, biomineralization is thought to occur either by generation of CaC[O.sub.3] within the lumen of the calcium-secreting glands (Vinn et al., 2009) or from calcified intracellular granules (Neff, 1969). In our phylogeny, the genes HeCAl and HeCA2 were shown to be part of the cytosolic and secreted [alpha]-CA clades, respectively. Cytosolic CA enzymes are involved in coral biomineralization, where they function by hydrolyzing metabolic carbon dioxide and transporting bicarbonate to the sites of calcification (Bertucci et al, 2011). In Hydroides elegans, HeCAl, which is found in the tube-forming collar segment, may hydrolyze metabolic carbon dioxide in the cytosol of cells in the calcium-secreting glands, followed by transport of the bicarbonate ions to the lumen of the glands where CaC[O.sub.3] precipitation occurs. However, secreted enzymes play a prominent role in molluscan biomineralization processes, and are found in the extrapallial space formed between the mantle tissues and shell (Miyamoto et al, 1996; Hattan et al., 2001), indicating that enzymatic bicarbonate production is extracellular. In H. elegans, HeCA2, also located in the collar segment, may be secreted into the gland lumen where it provides the catalytic activity for CaC[O.sub.3] precipitation, similar to molluscan CAs. Future studies employing thin-section, in-situ hybridization on the first thoracic segment may reveal subcellular localization of these two CA genes. In addition, inhibition experiments using an effective CA inhibitor like acetazolamide would help assign specific functions to the genes presented in this study.

[FIGURE 4 OMITTED]

[FIGURE 5 OMITTED]

In the phylogenetic assessment presented here, and in most other phylogenies, sponges are the sister group to the Eumetazoa. The early branching position for the poriferan clade has previously identified the phylum as the ancestral progenitor for subsequent diversity in the [alpha]-CA family (Jackson, 2007). Interestingly, [alpha]-CA sequences in our tree did not group by traditional taxonomy, but by subcellular localization, in agreement with patterns reflected in similar published phylogenies (Moya et al., 2012; Le Roy et al., 2014). The sequences that were aligned in the present phylogeny were the same sequences used in the Le Roy et al. (2014) [alpha]-CA phylogeny, and our tree resulted in the same two secondary metazoan clade groupings, which were separated into a cytosolic-mitochondrial clade and a secreted and membrane-bound clade. The former contains CA isoforms that are present within the cytosol or in the mitochondria, while the latter represents enzymes either secreted into extracellular space or embedded within the cell membrane (Chegwidden et al., 2000). Interestingly, HeCA7, which contains a signal peptide, would presumably be grouped within the secreted and membrane-bound clade, but is grouped in the cytosolic-mitochondrial clade in the phylogeny. Endocytosis of the protein could account for a secreted protein being grouped within the cytosolic-mitochondrial clade, but sequencing or assembly error could also account for the discrepancy exhibited in the tree. Expression studies were performed for HeCA1 and HeCA2, because they were found grouped within the secreted and membrane-bound and cytosolic-mitochondrial clades, respectively. However, future studies might examine the other 10 HeCA genes to see if similar expression patterns are observed for those sequences also.

Determining the ancestral source of biomineralizing CA genes in H. elegans, and presumably all serpulids, was made difficult by low bootstrap values and lack of taxonomic distribution exhibited in the tree. The large number of phyla with few constituent genera represented likely contributed to the low bootstrap values. Nevertheless, it was apparent that CA genes in the annelid Capitella telata, a non-calcifying polychaete, shared little homology with CA genes from H. elegans. Of the 14 CA genes identified in the genome of Capitella teleta, only a single sequence (JGI: 225271) was orthologous to a sequence from H. elegans. This large discrepancy in gene homology between the two polychaete genera may indicate either that a novel function for biomineralization arose from duplicated annelid genes in serpulids, or the form of CAs in serpulids was uniquely inherited from the last common ancestor to possess a biomineralizing [alpha]-CA. The accumulation of more CA sequences from species in underrepresented taxa, especially from other annelid species, will not only help resolve the tree, but allow us to determine the evolutionary origin of genes responsible for CA biomineralization.

Acknowledgments

This research was supported by grants No. N00014-12-1-0360 and No. N00015-1-2658 from the U.S. Office of Naval Research; grant No. ORIO-13-013 from the Oak Foundation to MGH; and an award from the University of Hawaii, Undergraduate Research Opportunities Program, to GB. We wish to thank Shaun Hennings for assistance in larval culture and collecting; Dr. Audrey Asahina for assistance in RNA extractions; and Dr. Mahdi Belcaid for advice on bioinformatics and construction of the transcriptomes. This is contribution number 9820 from the School of Ocean Earth Science and Technology at the University of Hawaii at Manoa.

Literature Cited

Abascal, F., R. Zardoya, and D. Posada. 2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21: 2104-2105.

Bertucci, A., S. Tambutte, C. T. Supuran, D. Allemand, and D. Zoccola. 2011. A new coral carbonic anhydrase in Stylophora pistillata. Mar. Biotechnol. 13: 992-1002.

Cameron, R. A., M. Samanta, A. Yuan, D. He, and E. Davidson. 2009. SpBase: the sea urchin genome database and web site. Nucleic Acids Res. 37: D750-D754.

Capella-Gutierrez, S., J. M. Silla-Martinez, and T. Gabaldon. 2009. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25: 1972-1973.

Carpizo-Ituarte, E., and M. G. Hadfield. 1998. Stimulation of metamorphosis in the polychaete Hydroides elegans Haswell (Serpulidae). Biol. Bull. 194: 14-24.

Chegwidden, W. R., N. D. Carter, and Y. H. Edwards, eds. 2000. The Carbonic Anhydrases: New Horizons. Birkhauser, Basel.

De Cian, M. C., A. C. Andersen, X. Badly, and F. H. Lallier. 2003. Expression and localization of carbonic anhydrase and ATPases in the symbiotic tubeworm Riftia pachyptila. J. Exp. Biol. 206: 399-409.

Grabherr, M. G., B. J. Haas, M. Yassour, J. Z. Levin, D. A. Thompson, I. Amit, X. Adiconis, L. Fan, R. Ravchowdhury, Q. Zeng et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29: 644-652.

Hattan, S. J., T. M. Laue, and N. D. Chasteen. 2001. Purification and characterization of a novel calcium-binding protein from the extrapallial fluid of the mollusc, Mytilus edulis. J. Biol. Chem. 276: 4461-4468.

Hedley, R. H. 1956. Studies on serpulid tube formation. I. The secretion of the calcareous and organic components of the tube by Pomatoceros triqueter. Q. J. Microsc. Sci. 97: 411-419.

Jackson, D. J., L. Macis, J. Reitner, B. M. Degnan, and G. Worheide. 2007. Sponge paleogenomics reveals an ancient role for carbonic anhydrase in skeletogenesis. Science 316: 1893-1895.

Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran et al. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.

Krogh, A., B. Larsson, G. von Heijne, and E. L. Sonnhammer. 2001. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305: 567-580.

Le Roy, N., D. J. Jackson, B. Marie, P. Ramos-Silva, and F. Marin. 2014. The evolution of metazoan [alpha]-carbonic anhydrases and their roles in calcium carbonate biomineralization. Front. Zool. 11: 75.

Marchler-Bauer, A., M. K. Derbyshire, N. R. Gonzales, S. Lu, F. Chitsaz, L. Y. Geer, R. C. Greer, J. He, M. Gwadz, D. I. Hurwitz et al. 2014. CDD: NCBT s conserved domain database. Nucleic Acids Res. 43: D222-D226.

Maren, T. H. 1967. Carbonic anhydrase: chemistry, physiology, and inhibition. Physiol. Rev. 47: 595-781.

Miyamoto, H., T. Miyashita, M. Okushima, S. Nakano, T. Morita, and A. Matsushiro. 1996. A carbonic anhydrase from the nacreous layer in oyster pearls. Proc. Natl. Acad. Sci. USA 93: 9657-9660.

Moya, A., S. Tambutte, A. Bertucci, E. Tambutte, S. Lotto, D. Vullo, C. T. Supuran, D. Allemand, and D. Zoccola. 2008. Carbonic anhydrase in the scleractinian coral Stylophora pistillata: characterization, localization, and role in biomineralization. J. Biol. Chem. 283: 25475-25484.

Moya, A., L. Huisman, E. E. Ball, D. C. Hayward, L. C. Grasso, C. M. Chua, H. N. Woo, J.-P. Gattuso, S. Foret, and D. J. Miller. 2012. Whole transcriptome analysis of the coral Acropora millepora reveals complex responses to C[O.sub.2]-driven acidification during the initiation of calcification. Mol. Ecol. 21: 2440-2454.

Nedved, B. T., and M. G. Hadfield. 2009. Hydroides elegans (Annelida: Polychaeta): a model for biofouling research. Pp. 203-217 in Marine and Industrial Biofouling, H.-C. Flemming, P. S. Murthy, R. Venkatesan, and K. E. Cooksey, eds. Springer, Berlin.

Neff, J. M. 1971. Ultrastructural studies of the secretion of calcium carbonate by the serpulid polychaete worm, Pomatoceros caeruleus. Z. Zellforsch. Mikrosk. Anat. 120: 160-186.

Petersen, T. N., S. Brunak, G. von Heijne, and H. Nielsen. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8: 785-786.

Schultz, J., F. Milpetz, P. Bork, and C. P. Ponting. 1998. SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95: 5857-5864.

Seaver, E. C., and L. M. Kaneshige. 2006. Expression of 'segmentation' genes during larval and juvenile development in the polychaetes Capitella sp. and H. elegans. Dev. Biol. 289: 179-194.

Stamatakis, A. 2006. RaxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.

Struck, T. H., C. Paul, N. Hill, S. Hartmann, C. Hosel, M. Kube, B. Lieb, A. Meyer, R. Tiedemann, G. Purschke et al. 2011. Phylogenomic analyses unravel annelid evolution. Nature 471: 95-98.

Swan, E. F. 1950. The calcareous tube secreting glands of the serpulid polychaetes. J. Morphol. 86: 285-314.

Unabia, C. R. C., and M. G. Hadfield. 1999. Role of bacteria in larval settlement and metamorphosis of the polychaete Hydroides elegans. Mar. Biol. 133: 55-64.

Vinn, O., K. Kirsimae, and H. ten Hove. 2009. Tube ultrastructure of Pomatoceros americanus (Polychaeta, Serpulidae): implications for the tube formation of serpulids. Estonian J. Earth Sci. 58: 148-152.

GRANT BATZEL, BRIAN T. NEDVED, AND MICHAEL G. HADFIELD (*)

Kewalo Marine Laboratory, University of Hawaii, 41 Ahui Street, Honolulu, Hawaii 96813

Received 26 April 2016; accepted 9 September 2016.

(*) To whom correspondence should be addressed. E-mail: hadfield@hawaii.edu

Abbreviations: CA, carbonic anhydrase; GPI, glycophosphatidylinositol; HeCAl, cytosolic CA isoform of Hydroides elegans; HeCA2, secreted CA isoform of Hydroides elegans.
Table 1
Oligonucleotide primer sequences for HeCAl and HeCA2

Primer   Sequence (5'-3')

HeCAl-F  AGAACCTACAATCCGAACATGCCT
HeCAl-R  GCGTTCATCTGTGCCTCAGTGAC
HeCA2-F  TGT ATCAGTCCCTCCGTATT
HeCA2-R  CGAGTCGTATCCATGGAATT

HeCA, Hydroides elegans carbonic anhydrase; F, forward; R, reverse.

Table 2
Carbonic anhydrase (CA) gene characteristics in Hydroides elegans

                                                          Terminal
                    Amino Acid           Signal   GPI     Transmembrane
CA       Accession  Length      ORF      Peptide  Domain  Domain

HeCAl    KX129935   272         Full     No       No      No
HeCA2    KX129936   315         Full     Yes      No      No
HeCAl    KX 129937  304         Partial  Yes      No      No
HeCA4    KX 129938  266         Partial  N/A      No      No
HeCA5    KX 129939  285         Full     Yes      No      No
HeCA6    KX 129940  307         Full     Yes      Yes     No
HeCA7    KX 129941  314         Full     Yes      No      No
HeCA8    KX 129942  332         Full     Yes      Yes     No
HeCA9    KX 129943  321         Partial  N/A      No      No
HeCA 10  KX 129944  314         Full     Yes      Yes     No
HeCAl1   KX 129945  305         Full     No       No      No
HeCA12   KX 129946  329         Partial  No       No      No

GPI, glycophosphatidylinositol; HeCA, Hydroides elegans carbonic
anhydrase; ORF, open-reading frame.
COPYRIGHT 2016 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Batzel, Grant; Nedved, Brian T.; Hadfield, Michael G.
Publication:The Biological Bulletin
Article Type:Report
Date:Dec 1, 2016
Words:4668
Previous Article:The way forward.
Next Article:Impact of environment and ontogeny on relative fecundity and egg quality of female oysters (Crassostrea virginica) from four sites in northern...
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters