Printer Friendly

Expresion de la interleucina 10 (IL-10) y el factor de crecimiento transformante beta (TGF-[beta]) en mucosa intestinal de Crias de Alpaca (Vicugna pacos).

INTERLEUKIN 10 (IL-10) AND TRANSFORMING GROWTH FACTOR BETA (TGF-[beta]) EXPRESSION IN INTESTINAL MUCOSA OF ALPACA CRIAS (VICUGNA PACOS)

INTRODUCCION

Las celulas T de la mucosa intestinal logran mantener un balance entre la tolerancia y la respuesta inflamatoria, discriminando entre microorganismos patogenos, microorganismos saprofitos y antigenos inocuos propio de la dieta alimenticia (Harrison y Powrie, 2013).

Las celulas T reguladoras controlan las respuestas inmunes a nivel intestinal a traves de la produccion de IL-10 y TGF-[beta]. Estas citoquinas son producidas principalmente por los diferentes grupos de celulas T reg como Th3, Tr1 o nTreg (Curotto de Lafaille y Lafaille, 2009); no obstante, TGF-[beta] tambien es producido por enterocitos y celulas presentadoras de antigenos (Biancheri et al., 2014) e IL-10 por casi todos los leucocitos (Saraiva y O'Garra, 2010). Estas citoquinas regulan la respuesta inflamatoria a traves de muchas funciones como la inhibicion de la diferenciacion a otros linajes de celulas T (Th1, Th2 y Th17), generacion de mas celulas T reg, inhibicion en la produccion de citoquinas pro inflamatorias (IL1, IL-2, IL6, IL12, IFN-[gamma], IL-4 e IL-17), produccion de citoquinas antiinflamatorias (IL-10 y TGF-[beta]), estimulacion de la produccion de IgA por celulas B y la inhibicion, tanto de la expresion del MHC-II, como de las moleculas coestimuladoras en celulas presentadoras de antigenos (Spits y de Waal Malefyt, 1992; Konkel y Chen, 2011).

En la mucosa intestinal de las alpacas se ha determinado la expresion de los genes de las interleucinas TNF[alfa] e IL 1[alfa] (Bardalez et al., 2013), y en leucocitos circulantes de alpacas adultas se ha determinado el incremento de la expresion del gen de la IL10 cuando son estimulados in vitro con antigenos clostridiales (Watanabe et al., 2014).

Teniendo en cuenta la importancia de estas citoquinas en el equilibrio intestinal, el presente trabajo busca describir la cinetica de expresion del ARNm de IL-10 y TGF-[beta] en la mucosa yeyunal de alpacas, con la finalidad de identificar los roles del sistema inmune en la defensa del organismo y adaptacion de su entorno en los primeros 47 dias de vida, periodo de gran susceptibilidad a enfermedades con altas tasas de mortalidad (Ameghino y DeMartini, 1991).

MATERIAS Y METODOS

Animales y Lugar de Ejecucion

Se seleccionaron 21 alpacas clinicamente sanas, sin considerar sexo o raza, de la estacion experimental del Instituto Veterinario de Investigaciones Tropicales y de Altura (IVITA), localizada en el distrito de Marangani, provincia de Canchis, departamento de Cusco, Peru. El IVITA es parte de la Universidad Nacional Mayor de San Marcos (UNMSM). La fase de campo se desarrollo entre enero y marzo de 2014.

El rebano de alpacas de la institucion fue criado en condiciones semiextensivas, con alimentacion al pastoreo. El estudio fue realizado en epocas de paricion y empadre, condicionando una alta circulacion de animales por la monta y estres fisiologico de madres y crias. Ademas, el periodo de muestreo coincidio con la temporada alta de lluvias, favoreciendo el crecimiento de los pastos y la proliferacion de potenciales patogenos productores de enfermedades entericas (Rosadio et al., 2012), que podian ser ingeridos por las alpacas neonatas.

El estudio fue aprobado por el Comite de Etica y Bienestar Animal de la Facultad de Medicina Veterinaria (FMV) de la UNMSM.

Diseno Experimental

Se designaron tres grupos etarios de seis alpacas cada uno. Grupo 1 constituido por alpacas de 2 a 8 dias de edad, grupo 2 por alpacas de 10 a 21 dias de edad y grupo 3 por alpacas de 26 a 47 dias de edad. Cada grupo estuvo conformado por 6 animales. Se tuvo un grupo control (n=3), constituido por fetos de alpaca de 11 meses de gestacion, exentos de estimulos de la inmunidad pasiva maternal y factores del medio ambiente. Este grupo control fue usado como calibrador para el analisis de expresion de genes 2-[DELTA][DELTA]Ct (Livak y Schmittgen, 2001).

Muestras y Obtencion de Acidos Nucleicos

Los animales fueron manejados bajo el protocolo de Autorizacion No. 2009-001 del Comite de Etica y Bienestar Animal de la Facultad de Medicina Veterinaria de la UNMSM. Para el sacrificio de los animales se empleo 1.5 mg/kg de xilacina (Rompun[R]) y 7.5 mg/kg de ketamina (Vetalar[R]), via intramuscular, seguido por una sobredosis de 50 mg/kg, via endovenosa, de pentobarbital sodico (Halatal[R]).

Se tomo una porcion de 2 cm de longitud del yeyuno de cada animal y feto. Estos segmentos fueron lavados con suero fisiologico al 0.9% para retirar contenido intestinal y fueron almacenados en nitrogeno liquido (-196[grados]C).

Las muestras fueron procesadas en el Laboratorio de Microbiologia de la FMVUNMSM. Se utilizo TRIzol[R] Reagent (ThermoFisher Scientific, EEUU) y el kit PureLink[TM] Micro-to-Midi System (Invitrogen[TM], EEUU), siguiendo las indicaciones del fabricante, para la extraccion del ARN total. Posteriormente, se empleo el kit Quant-iT[TM] RNA HS (Invitrogen, EEUU) y el fluorometro Qubit[R] (ThermoFisher Scientific, EEUU), siguiendo las indicaciones del fabricante, para cuantificar el ARN y poder aislar 1 [micron]g de ARN total.

Para la obtencion del ADNc se empleo el kit SuperScript[TM] III First-Strand Synthesis SuperMix for qRT-PCR (Invitrogen, EEUU), siguiendo las indicaciones del fabricante.

Eleccion de Oligonucleotidos

Se disenaron los oligonucleotidos cebadores con base de secuencias de alpaca publicadas en el Genbank usando el programa Primer3 output (www.primer3 .com) y el programa BLAST del NCBI (www.ncbi. nlm.nih.gov/blast/) (Cuadro 1).

PCR Tiempo Real

Se empleo el kit SYBR[R] GreenER[TM] qPCR Super Mix Universal (Invitrogen, EEUU), siguiendo las indicaciones del fabricante. Asimismo, se empleo el termociclador Applied Biosystem[R] 7500 real-time PCR System con el siguiente protocolo: 1 ciclo de 50[grados]C por 2 min (incubacion de UDG), 1 ciclo de 95[grados]C por 10 min (inactivacion de UDG y activacion polimerasa), seguido de 40 ciclos de 95[grados]C por 15 s (denaturalizacion), 60[grados]C por 60 s (hibridacion y extension) y lectura de placa. La temperatura de melting o curva de disociacion de los productos amplificados se analizo a partir de 65 hasta 95[grados]C con lectura de placa cada 0.3[grados]C. Finalmente, los productos fueron conservados a 4[grados]C. El software 7500 v. 2.0.1 analizo la curva de amplificacion (Ct) y la temperatura de disociacion (Tm) de los productos amplificados.

Analisis de Expresion del ARNm

Se uso el metodo comparativo 2-[DELTA][DELTA]Ct (Livak y Schmittgen, 2001), empleando como calibrador el grupo de fetos de 11 meses de gestacion (n=3) y como control endogeno el gen de Gliceraldehido-3-fosfato deshidrogenasa (GAPDH).

Analisis Estadistico

Se utilizo el analisis de varianza de un factor y la prueba post hoc de Bonferroni para evaluar los resultados del metodo comparativo 2-[DELTA][DELTA]Ct para IL-10 y TGF-[beta] entre los tres grupos etarios, utilizando el programa STATA v. 11, con una significacion estadistica de 0.05.

RESULTADOS

Se analizo la expresion de ARNm del gen de GAPDH (usado como control endogeno), asi como de los genes IL-10 y TGF-[beta], encontrando niveles detectables de ARNm en todas las muestras.

Los valores de la curva de disociacion o temperatura de melting (Tm) de los productos amplificados mostraron un pico unico en cada una de las muestras, presentando un rango de temperaturas que oscilo entre 86 y 86.5[grados]C para GAPDH, 83.1 y 83.8[grados]C para IL-10 (Figura 1) y de 84.8 y 85.4[grados]C para TGF-[beta] (Figura 2), tal y como se predijo en el diseno de los cebadores, demostrando la amplificacion de productos unicos y especificos.

Los resultados de la cuantificacion relativa mostraron niveles de ARNm de IL-10 ascendentes con la edad, encontrando valores promedio de 7.21 [+ o -] 1.02 (grupo 1), 13.53 [+ o -] 1.26 (grupo 2) y 18.77 [+ o -] 1.48 (grupo 3) veces lo expresado con respecto al grupo calibrador, mostrando diferencia significativa (p<0.05) en todos los grupos (Figura 3).

Los resultados de la cuantificacion relativa mostraron niveles de ARNm de TGFP ascendentes con la edad, encontrando valores promedio de 2.18 [+ o -] 0.23 (grupo 1), 3.03 [+ o -] 0.18 (grupo 2) y 4.06 [+ o -] 0.15 (grupo 3) veces lo expresado con respecto al grupo calibrador, mostrando diferencia estadisticamente significativa (p<0.05) en todos los grupos (Figura 4).

DISCUSION

Los resultados muestran un incremento de la expresion de IL-10 y TGF-[beta] con la edad en la mucosa de yeyuno de las crias de alpaca. Ambas citoquinas regulan el proceso de colonizacion de la microbiota intestinal normal y el enfrentamiento a los patogenos presentes en su ambiente durante el periodo neonatal (Rojas et al., 2015). Ademas, se sabe que IL-10 reprime la expresion de muchas citoquinas pro-inflamatorias (Couper et al., 2008), regulando la respuesta inmune en procesos infecciosos, evitando que sean patologicas (Gazzinelli et al., 1996), y TGF-[beta] induce a las celulas del epitelio intestinal a reparar y restaurar los tejidos danados en este organos (Beck et al., 2003).

La expresion ascendente mostrada por IL-10 y TGF-[beta] se asocia a multiples factores. El calostro contiene diversos elementos como anticuerpos, leucocitos, citoquinas y nutrientes que influyen en el desarrollo del sistema inmune y proteccion del neonato (Brown, 2000). La colonizacion de microorganismos en el intestino es necesaria para el desarrollo del sistema inmune intestinal (Lei et al., 2015); sin embargo, este sistema es constantemente retado por los patogenos del entorno (Rosadio et al., 2012) modificando la estructura y funcion de la mucosa intestinal. Cabe resaltar que las alpacas inician la ingesta de forraje en las primeras semanas de vida, efectuandose un cambio en la microbiota intestinal y en la respuesta inmune (Bailey et al., 2001). Ademas, al transcurrir las semanas, el intestino crece en su totalidad, aumentando el numero de foliculos linfoides y el numero de leucocitos (Roca et al., 2014).

En otros estudios, las expresiones de TNF-[alfa], IL-1[alfa] (Bardalez et al., 2013), IL17 (Herrera, 2012), IgA (Dionisio et al., 2014) y peptidos anti-microbianos (More et al., 2011) en mucosa intestinal de crias de alpaca, muestran una fuerte respuesta inmune inicial en las primeras semanas de vida, alcanzando su maxima expresion en la 3ra y 4ta semana, lo cual se encuentra asociado a la colonizacion de la microbiota y a otros factores estimulantes previamente mencionados. Sin embargo, entre la 5ta y 6ta semana de vida se presenta un ligero descenso en la expresion de estas citoquinas y en los peptidos antimicrobianos, lo cual se asocia a una regulacion y adaptacion de las alpacas neonatas con su entorno (Bardalez et al., 2013; Siuce et al., 2015). En contraste, las citoquinas en estudio muestran una expresion ascendente con la edad, aun en los animales de 26 a 47 dias, sugiriendo que la actividad antiinflamatoria de IL-10 y TGF-[beta] regularia, tanto a la inmunidad innata como adquirida, en esta etapa de vida.

En este trabajo, las Tm de los productos amplificados variaron minimamente y se les considera especificas por el reducido rango observado. Es posible que estas diferencias sean el resultado de las variaciones de lectura propias del termociclador o pequenas fa llas de la polimerasa en el proceso de polimerizacion de la cadena nucleotidica y que en los PCR tiempo real podria tener una variacion de 6 a 37%, con una mayor precision con un mayor numero de copias (Morrison et al., 1998). Por otro lado, no se pudo establecer la existencia de polimorfismos o isoformas procedentes de mecanismos de recombinacion genetica propia de la generacion de los ARNm de las citoquinas estudiadas, aunque no se observaron productos que generen dos curvas de disociacion en los resultados de cada muestra. Se requiere realizar el secuenciamiento nucleotidico de los productos del RT-PCR tiempo-real para la identificacion de tales variaciones y emplear tecnicas avanzadas para develar las implicancias de tales cambios (Gould-Rothber, 2001).

CONCLUSIONES

* La expresion de ARNm de IL-10 y TGFP en la mucosa de yeyuno de las crias de alpaca asciende progresivamente con la edad.

* Se demostro la presencia de ARNm de IL-10 y TGF-[beta] en la mucosa del yeyuno desde el 2 dia de edad a traves de la tecnica RT-PCR tiempo real.

http://dx.doi.org/10.15381/rivep.v28i2.13082

Agradecimientos

Este trabajo fue financiado por el Programa de Innovacion para la Competitividad y Productividad (INNOVATE -Peru) a traves del Proyecto N.o 180 FINCyT-IB-2013.

LITERATURA CITADA

[1.] Ameghino E, De Martini J. 1991. Mortalidad en crias de alpacas. Bol Divulgacion IVITA, UNMSM. Lima. 71p.

[2.] Bailey M, Plunkett FJ, Rothkotter HJ, Vega-Lopez MA, Haverson K, Stokes CR. 2001. Regulation of mucosal immune responses in effector sites. Proc Nutr Soc 60: 427-435. doi: 10.1079/PNS2001118

[3.] Bardalez C, Manchego S, Chiok C, Lam K, Sandoval C, More B, Pezo D, Ramirez V 2013. Cinetica de expresion del factor de necrosis tumoral alfa (TNFa) e interleucina 1 alfa (IL-1a) en mucosa intestinal de crias de alpaca (Vicugna pacos) sanas y con enteropatia. Rev Inv Vet Peru 24: 381389. doi: 10.15381/rivep.v24i3.2588

[4.] Beck PL, Rosenberg IM, Xavier RJ, Koh T, Wong JF, Podolsky DK. 2003. Transforming growth factor-B mediates intestinal healing and susceptibility to injury in vitro and in vivo through epithelial cells. Am J Pathol 162: 597-608.

[5.] Biancheri P, Giuffrida P, Docena GH, MacDonald TT, Corazza GR, Di Sabatino A. 2014. The role of transforming growth factor (TGF)-[beta] in modulating the immune response and fibrogenesis in the gut. Cytokine Growth Factor Rev 25: 45-55. doi: 10.1016/j .cytogfr.2013.11.001

[6.] Brown BW. 2000. A review on reproduction in South American camelids. Anim Reprod Sci 58: 169-195. doi: 10.1016/S0378-4320(99)00081-0

[7.] Couper K, Blount D, Riley E. 2008. IL-10: the master regulator of immunity to infection. J Immunol 180: 5771-5777. doi: 10.4049/ jimmunol.180.9.5771

[8.] Curotto de Lafaille MA, Lafaille JJ. 2009. Natural and adaptive foxp3+ regulatory T cells: more of the same or a division of labor? Immunity 30: 626635. doi: 10.1016/j.immuni.2009.05.002

[9.] Dionisio J, Manchego A, Chiok KL, Sandoval N, More J, Pezo D, Rivera H. 2014. Cinetica de expresion de inmunoglobulina A en el epitelio intestinal de crias de alpaca (Vicugna pacos). Rev Inv Vet Peru 25: 151-161. doi: 10.15381/rivep.v25i2.8486

[10.] Gazzinelli RT, Wysocka M, Hieny S, Scharton-Kersten T, Cheever A, Kuhn R, Muller W, Sher, A. 1996. In the absence of endogenous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal immune response dependent on CD4+ T cells and accompanied by overproduction of IL-12, IFN-gamma and TNF-alpha. J Immunol 157: 798-805.

[11.] Gould-Rothberg B. 2001. Mapping a role for SNPs in drug development. Nat Biotechnol. 19: 209-211. doi: 10.1038/85631

[12.] Harrison OJ, Powrie FM. 2013. Regulatory T cells and immune tolerance in the intestine. Cold Spring Harb Perspect Biol 5: a018341. doi: 10.1101/cshperspect.a018341.

[13.] Herrera A. 2012. Deteccion de citoquinas inductora y efectora para la diferenciacion y funcion de linfocitos colaboradores 17 (Th 17) en mucosa intestinal de crias de alpaca (Vicugna pacos). Tesis de Magister. Lima: Univ Nacional Mayor de San Marcos. 90 p.

[14.] Konkel JE, Chen W. 2011. Balancing acts: the role of TGF-[beta] in the mucosal immune system. Trends Mol Med 17: 668-676. doi: 10.1016/j.molmed.2011.07.002

[15.] Lei YMK, Nair L, Alegre ML. 2015. The interplay between the intestinal microbiota and the immune system. Clin Res Hepatol Gastroenterol 39: 9-19. doi: 10.1016/j .clinre.2014.10.008

[16.] Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-[DELTA][DELTA]Ct method. Methods 25: 402-408. doi: 10.1006/meth.2001.1262

[17.] More J, Manchego A, Sandoval N, Ramirez M, Pezo D, Chiok KL, Rivera H. 2011. Deteccion genomica y expresion de peptidos antimicrobianos (ay P-defensinas) en mucosa intestinal de crias de alpaca (Vicugna pacos). Rev Inv Vet Peru 22: 324-335. doi: 10.15381/rivep.v22i4.332

[18.] Morrison TB, Weis JJ, Wittwer CT. 1998. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques 24: 954-958, 960, 962.

[19.] Roca V, Manchego A, Sandoval N, Chiok KL, Rivera H. 2014. Caracterizacion histologica y dinamica linfoide de las placas de Peyer en crias de alpaca durante los 45 primeros dias de vida. Rev Inv Vet Peru 25: 341-349. doi: 10.15381/rivep.v25i3.10112

[20.] Rojas M, Manchego A, Rocha C, Fornells L, Silva R, Mendes G, Dias G, et al. 2015. Outbreak of diarrhea among preweaning alpacas (Vicugna pacos) in the southern Peruvian highland. J Infect Dev Ctries 10: 269274. doi: 10.3855/jidc.7398

[21.] Rosadio R, Maturrano L, Perez D, Luna E. 2012. El complejo enterico neonatal en alpacas andinas. Rev Inv Vet Peru 23: 261-271. doi: 10.15381/rivep.v23i3.908

[22.] Saraiva M, O'Garra A. 2010. The regulation of IL-10 production by immune cells. Nat Rev Immunol 10: 170-181. doi: 10.1038/nri2711

[23.] Siuce J, Manchego A, Sandoval N, More J, Chiok K, Pezo D, Rivera H. 2015. Expresion de defensinas en yeyuno de crias de alpacas (Vicugna pacos) con enteropatias. Rev Inv Vet Peru 26: 317-327. doi: 10.15381/rivep.v26i2.11093

[24.] Spits H, de Waal Malefyt. R. 1992. Functional characterization of human IL10. Int Arch Allergy Immunol 99: 8-15.

[25.] Watanabe R, Manchego A, Rivera H. 2014. Expresion In vitro de las interleucinas 2 y 10 de linfocitos de alpacas (Vicugna pacos) en presencia de antigenos clostridiales. Rev Inv Vet Peru 25: 419-429. doi: 10.15381/rivep.v25i3.10121

Cesar Burga C. (1), Alberto Manchego S.u, Gina Castro S. (1), Giovanni Perez G. (2), Mercy Ramirez V. (1), Nieves Sandoval C. (2)

(1) Laboratorio de Microbiologia y Parasitologia Veterinaria,

(2) Laboratorio de Histologia, Embriologia y Patologia Veterinaria, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima, Peru

(3) E-mail: amanchegos@gmail.com

Recibido: 5 de octubre de 2016

Aceptado para publicacion: 2 de febrero de 2017

Leyenda: Figura 1. Curvas de disociacion (Tm) de los productos amplificados con el set de oligonucleotidos para el gen IL-10 en mucosa intestinal de crias de alpaca sanas. Los valores de Tm oscilaron entre 83.1 y 83.8[grados]C

Leyenda: Figura 2. Curvas de disociacion (Tm) de los productos amplificados con el set de oligonucleotidos para el gen TGF-[beta] en mucosa intestinal de crias de alpaca sanas. Los valores de Tm oscilaron entre 84.8 y 85.4[grados]C
Cuadro 1. Oligonucleotidos empleados en la RT-PCR
Tiempo-Real para los genes de GAPDH, IL-10 y
TGF-[beta] de alpacas

Gen          Producto        Secuencia de
             (pb) (1)      oligonucleotidos
                              (5'-3') (2)

GAPDH          201      F: ATCACTGCCACCCAGAAGAC
                        R: GCACGTCAGATCCACAACAG
IL-10          205      F: TTACCTGGAGGAGGTGATGC
                        R: GGCTTTGTAGACCCCCTTCT
TGF-[beta]     185      F: GAGGTGATCTYGCCACCATT
                        R: GTCCTTGCGGAAGTCAATGT

Gen          Acceso Genbank   Tm (3)

GAPDH        XM_006210852.1   60.12
                              60.32
IL-10        XM_006215461.1   60.07
                              59.58
TGF-[beta]   NM_001290071.1   59.93
                              60.12

(1) Pb: longitud del producto expresada en pares de bases

(2) Los iniciadores se expresan como F (cebador de avance) y R
(cebador de regreso)

(3) Tm: Temperatura de melting o hibridacion de los
oligonucleotidos cebadores

Figura 3. Niveles de expresion de IL-10 en mucosa intestinal
de crias de alpaca sanas. Cada barra representa la media [+ o -]
desviacion estandar de la expresion de los grupos etarios evaluados.
Diferentes letras sobre las columnas indican diferencia estadistica
(p<0.05)

Calibrador   1

Grupo 1      7.21
Grupo 2      13.53
Grupo 3      18.77

Nota: Tabla derivada de grafico de barra.

Figura 4. Niveles de expresion de TGF-[beta] en mucosa
intestinal de crias de alpaca sanas. Cada barra representa
la media [+ o -] desviacion estandar de la expresion de los
grupos etarios evaluados. Diferentes letras sobre las
columnas indican diferencia estadistica (p<0.05)

Grupo Calibrador   1

Grupo 1            2.18
Grupo 2            3.03
Grupo 3            4.06

Nota: Tabla derivada de grafico de barra.
COPYRIGHT 2017 Universidad Nacional Mayor de San Marcos
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Burga C., Cesar; Manchego S., Alberto; Castro S., Gina; Perez G., Giovanni; Ramirez V., Mercy; Sando
Publication:Revista de Investigaciones Veterinarias del Peru (RIVEP)
Date:Apr 1, 2017
Words:3554
Previous Article:Deteccion molecular de Flavivirus en suero sanguineo de roedores capturados en Yucatan, Mexico.
Next Article:Frecuencia de tumores en piel de caninos diagnosticados histopatologicamente en el laboratorio de patologia veterinaria de la Universidad Nacional...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters