Printer Friendly

Expresion de TGF-[beta] como indicio temprano de lesion del tejido hepatico en la enfermedad de higado graso no alcoholico.

Expression of TGF-[beta] as an early sign of liver tissue injury in nonalcoholic fatty liver disease

Introduccion

La enfermedad de higado graso no alcoholico (NAFLD del Ingles Non-Alcoholic Fatty Liver Disease), se define como la acumulacion excesiva de grasa en los hepatocitos en un porcentaje mayor de 10% del peso del higado en individuos con ausencia de consumo significativo de alcohol, incluye un amplio espectro patologico que puede ir desde la simple esteatosis a esteatohepatitis, fibrosis, cirrosis y cancer hepatico (1-3). Existe una correlacion entre NAFLD y factores de riesgo como obesidad, diabetes, dislipidemia, hipertension arterial (HTA), y otras condiciones relacionadas al estilo de vida (4).

El tratamiento de NAFLD se ha direccionado a perdida de peso mas terapia farmacologica para mejorar resistencia a insulina o dislipidemia, tambien cirugias bariatricas han resultado efectivas; en tratamiento farmacologico, actualmente emergen datos de un ensayo clinico con Oltipraz (sintetico de ditioltiona) como inhibidor de genes lipogenicos que mejora el higado graso e inhibe su progresion a fibrosis hepatica (5).

La lesion molecular en NAFLD se presenta por el acumulo de grasa en el tejido e inicia una cascada de senalizacion bioquimica que incluye estres oxidativo, respuesta inflamatoria, disfuncion mitocondrial, peroxidacion de lipidos y disfuncion del equilibrio de la matriz extracelular; estas senales con la estimulacion continua a traves del tiempo consolidan en un proceso de fibrogenesis en el tejido, eventos en los que el factor de crecimiento transformante P 1 (TGF-P1) juega un papel fundamental. Este ultimo, es identificado como una importante citoquina profibrotica que promueve la expresion de colageno I por parte de las celulas estrelladas y se halla posiblemente implicado en la inhibicion de metaloproteinasas de matriz (MMP) (6-8). Los estudios moleculares en etapas iniciales de lesion del tejido son de gran ayuda a la identificacion de nuevos biomarcadores moleculares que aporten mayor informacion acerca del grado de lesion del hepatocito, contribuyendo con los actuales metodos de diagnostico y pronostico. Se han realizado algunos estudios moleculares en otros paises con poblaciones diferentes a nuestras condiciones y adicionalmente mucha de la informacion existente es dada por modelos animales, por tanto la relevancia del trabajo (9, 10).

El objetivo del estudio fue analizar expresion de genes implicados en dano hepatico en los procesos iniciales de la lesion en pacientes con NAFLD o con factores de riesgo relacionados a la esteatosis hepatica, en busqueda de biomarcadores moleculares utiles a la practica clinica. Encontramos que los individuos con factores de riesgo a NAFLD y aun mas en la esteatosis hepatica se expresa la citoquina TGF P, lo cual activa cascadas de senalizacion claves para progresion a fibrosis y HCC (Hepatocarcinoma).

Material y metodos

Estudio analitico de corte transversal, en el que se estudiaron caracteristicas epidemiologicas, bioquimicas y se evaluo la expresion genica de TGF-P1, COL1A2 y MMP20 en tejido hepatico, y su posible asociacion con la presencia de NAFLD.

El estudio se realizo con los pacientes con factores de riesgo para NAFLD que acudieron al servicio de Higado y Vias Biliares del Hospital Universitario del Caribe (Cartagena-Colombia), durante 15 meses consecutivos.

Se excluyeron pacientes cuyo consumo de alcohol excediera los 20 g/dia para hombres y 10 g/dia para mujeres, antecedentes personales de hepatitis viral, medicamentos hepatotoxicos, hemocromatosis y enfermedad de Wilson. Se recopilaron datos sociodemograficos (edad, genero, procedencia), antropometricos y clinicos (peso, talla, indice de masa corporal, factores de riesgo para NAFLD) de cada participante despues de su consentimiento informado.

Determinaciones bioquimicas

Para la realizacion de las mediciones bioquimicas se recolectaron muestras de sangre periferica por puncion de una vena de la zona anterior del brazo o dorso de la mano en tubos con heparina sodica como anticoagulante (BD Vacutainer[R]) mediante sistema de tubos al vacio. Se determinaron concentraciones plasmaticas de los siguientes analitos teniendo en cuenta los valores de referencia: glucosa (70-110 mg/dL), colesterol total (hasta 200 mg/dL), trigliceridos (hasta 150 mg/dL), bilirrubinas (total hasta 1,1 mg/dL; directa hasta 0.25 mg/dL; indirecta hasta 0.76 mg/dL), albumina (3.4-4.8 g/dL) y creatinina (hombres 0.6-1.1 mg/dL; mujeres 0.5-1.0 mg/dL), por los metodos glucosa oxidasa, colesterol oxidasa, glicerol fosfato oxidasa, sulfanilico diazoado, verde de bromocresol y picrato alcalino respectivamente; se determino la actividad enzimatica de aspartato aminotransferasa--AST (hasta 40 U/L), alanino aminotransferasa--ALT (hasta 41 U/L), gamma glutamil transferasa--GGT (hombres <50 U/L; mujeres <30 U/L) y fosfatasa alcalina (hombres <270 U/L; mujeres <240 U/L) por los metodos de la IFCC (International Federation of Clinical Chemistry), empleando los Kit de Biosystems[R] correspondiente en cada caso. Todas las mediciones se realizaron siguiendo las recomendaciones del fabricante. Los valores correspondientes a recuento de plaquetas (150 000-450 000/mm3) y pruebas de coagulacion: tiempo de protrombina (9.7-14 segundos), tiempo parcial de tromboplastina (23.5-34.3 segundos) e INR, fueron consultados de sus historias clinicas.

Deteccion de higado graso en los individuos de estudio

A los participantes del estudio (pacientes con factores de riesgo para NAFLD) se les realizo una ultrasonografia abdominal total con ecografo SonoAce 8000 Live (Medison CO., Ltd.) para determinar diagnostico de NAFLD, adicional del examen clinico.

De los 83 participantes, 22 fueron programados previamente para biopsia hepatica pero solo 10 aceptaron el consentimiento informado para destinar una parte de la misma para el estudio molecular, las cuales fueron dadas por patologia y congeladas para posterior extraccion de ARN, este aspecto limito el numero de muestras recolectadas para el analisis molecular. Todos los procedimientos realizados en el estudio se llevaron a cabo de acuerdo con los principios expresados en la declaracion de Helsinki (11) y fueron aprobados por el comite de etica de la Universidad de Cartagena.

Preparacion ARN: extraccion de ARN, sintesis de cDNA y RT-PCR

El ARN total fue extraido de 0.02 gramos de tejido hepatico usando RNeasy MiniKit[R] (QIAGEN, Valencia, CA) y tratados por DNA-free[TM] (Ambion, Austin, Tx) siguiendo las consideraciones del fabricante. Abundancia y ratio entre 28S y 18S rARN fue monitoreado por electroforesis en gel de agarosa. Para la cuantificacion del acido nucleico se utilizo el espectrofotometro Nanodrop[TM] (Thermo Fisher Scientific, USA), midiendo a absorbancia 230, 260 y 280 nm.

Para obtencion de cDNA se utilizo el kit QuantiTect[R] Reverse Transcription (QIAGEN, Valencia, CA) siguiendo las indicaciones del fabricante. La amplificacion se realizo por RT-PCR utilizando los cebadores TGF-P1 (for GGCAGCTGTACATTGACTTCC, rev CCTTGCTGTACTGCGTGTCC), COL1A2 (for CTGGTAGTCGTGGTGCAAGT, rev AATGTTGCCAGGCTCTCCTC), MMP-20 (for TCGAGGTGGACAAAGCAGTG, rev TGGGCTTCCCCAGGAATACT), y GUSB (for ATCACCGTCACCACCAGCGT, rev GTCCCATTCGCCACGACTTTGT) (Operon-Eurofins, Huntsville, AL, USA) como gen control. Las condiciones de la PCR fueron las siguientes: 5 minutos a 95[grados]C, seguido de 35 ciclos de 94[grados]C por 0.5-1 minuto, 60-62[grados]C durante 30 segundos, 72[grados]C durante 0.5-1 minuto y elongacion final a 72[grados]C por 10 minutos. Los productos amplificados fueron separados mediante electroforesis con gel de agarosa al 1.0% tenidos con EZ Vision[R] (Amresco, OH, USA) para visualizacion en el equipo ChemiDoc[TM] XRS+ System (BIORAD, CA, USA). La expresion relativa de los genes se analizo por densitometria usando el software de analisis de imagen unidimensional QuantityOne[R] (BioRad, CA, USA). Cada experimento se realizo por triplicado independientemente.

Analisis estadistico

Se inicio mediante el diseno de una base de datos en Excel Microsoft[R] office 2010 en la que se tabularon los datos de los participantes, posteriormente esta fue transportada al programa STATA[R] (Stata Corp. LP, College Station, TX, USA). Para el analisis descriptivo fueron usadas las medidas de tendencia central, dispersion y proporciones. Inicialmente se evaluo el supuesto de normalidad de los datos a partir del test de Kolmogorov-Smirnov. Para analizar la asociacion entre las variables se utilizo la prueba Chi-cuadrado para las variables cualitativas y la prueba t-student para variables cuantitativas, para distribuciones no parametricas se utilizo la prueba de Wilcoxon-Mann-Whitney; ademas se calculo Odds ratio. Para todas las pruebas se asumio una probabilidad limite de decision de 0.05.

Resultados

Caracteristicas de la poblacion de estudio

De 98 individuos identificados con factores de riesgo para NAFLD, 83 aceptaron su participacion en el estudio. A todos los participantes se les realizo ultrasonografia abdominal total para el diagnostico de NAFLD, a partir de caracteristicas cualitativas que incluyeron ecogenicidad, ecotextura y visibilidad de los vasos, dividiendo la poblacion de estudio en los grupos: con NAFLD para aquellos en donde se confirmo diagnostico de NAFLD por ultrasonografia, y sin NAFLD en aquellos que resultaron negativo a higado graso en el momento del estudio. De los 83 participantes, se confirmo el padecimiento de NAFLD en 22 individuos (26.5%), mientras en los 61 individuos restantes con factores de riesgo para NAFLD (73.5%) no se evidencio higado graso en el momento del estudio.

En cuanto a las variables sociodemograficas en el total de los individuos estudiados, se encontro una distribucion mayoritariamente representada por el genero femenino (75.9%), el promedio de edad fue de 55.4 (DE=18.53) y una procedencia mayoritaria del area urbana (72.3%). Una vez clasificados los participantes por grupos (con NAFLD y sin NAFLD), persistio un mayor porcentaje del genero femenino en ambos grupos (63.64% en el grupo con NAFLD y 80.33% en el grupo sin NAFLD), e igualmente una procedencia con mayor representacion en el area urbana tanto en el grupo con NAFLD (72,73%) como en el grupo sin NAFLD (72.13%). En el total de los participantes se hallo un peso y talla promedio igual a 77.2 Kg y 1.62 metros respectivamente, para una media del IMC de 29.86 Kg/[m.sup.2], medidas antropometricas que al analizarse por grupos mostraron un indice de masa corporal (IMC) promedio igual a 31.54 Kg/m2 (DE=6.97) en individuos con NAFLD, y 29.29 Kg/[m.sup.2] (DE=6.36) en individuos sin NAFLD. La Tabla 1 muestra comparaciones de las caracteristicas sociodemograficas y antropometricas entre los grupos diagnosticados con NAFLD y el grupo con factores de riesgo de la enfermedad sin NAFLD.

Los factores de riesgo hallados en la poblacion de estudio estan relacionados con el sindrome metabolico, los cuales fueron hipertension arterial (HTA) (50.6%), obesidad (49.4%), y finalmente el padecimiento de diabetes mellitus (34.9%) y dislipidemia (21.7%). La Tabla 2 muestra las diferencias de los cuatro factores de riesgo asociados a NA FLD (obesidad, diabetes mellitus, dislipidemia, hipertension arterial) entre los grupos con/sin la condicion de NAFLD. La dislipidemia fue significativamente asociada con el riesgo de desarrollar NAFLD (OR=4; p=0.011). Los marcadores bioquimicos plasmaticos evaluados, mostraron de forma general en la totalidad de participantes, un comportamiento de la mediana dentro de los valores de referencia establecidos para estas mediciones, solo se observaron valores por encima del rango considerado normal para gamma glutamil transferasa (Me=201 U/L) y fosfatasa alcalina (Me=307 U/L).

Por su parte, al observar los datos hallados por grupos, se encontraron valores de transaminasas AST (Me=49.5) y ALT (Me=76) por encima de los valores normales en los individuos Con NAFLD, a diferencia de los individuos Sin NAFLD, cuyos valores para estas enzimas (AST Me=29; ALT Me=27) fueron menores y se comportaron dentro del rango de referencia. Igualmente, los niveles de fosfatasa alcalina en el grupo con NAFLD se hallaron por fuera del rango de referencia y fueron superiores al compararlos con los valores hallados en el grupo sin NAFLD, sin embargo en este estudio no se encontraron diferencias significativas entre ambos grupos para estas mediciones.

En cuanto a las mediciones de colesterol total y trigliceridos, se observaron valores mayores para estos dos analitos en individuos con NAFLD, colesterol total con una mediana de 193.2 mg/dL, valor que se ubica dentro del rango normal, y trigliceridos con mediana por encima de los valores normales e igual a 173.7 mg/dL, al comparar por grupos solo se hallaron diferencias significativas para colesterol total (p<0.05) (Tabla 3).

Expresion diferencial de genes

Fue evaluada la expresion de genes relacionada con el proceso fibrogenico, en los pacientes con NAFLD y el grupo con factores de riesgo (sin NAFLD). Se estudiaron diez muestras, porque fueron los individuos que aceptaron ceder las muestras por parte de la unidad de patologia. Los genes analizados fueron el factor de crecimiento transformante beta 1 (TGF-[beta]1), colageno 1 alfa 2 (Col1A2), metaloproteinasa 20 (MMP20), y en las condiciones del experimento el nivel de ARNm hepatico fue detectado.

El ARNm de TGF-[beta]1 (con NAFLD vs control: p<0.0001; sin NAFLD vs control: p<0.0001) y el ARNm de COL1A2 (con NAFLD vs control: p=0.002; sin NAFLD vs control: p=0.955) mostraron un patron de expresion creciente a mayor grado de lesion hepatica, en hepatocitos del control sano no se observo expresion del ARNm (excepcion para COL1A2), mientras que en los tejidos hepaticos de los individuos con factores de riesgo, como los pacientes diagnosticados con NAFLD se observo expresion de los genes, siendo mayor la de este ultimo. El ARNm de MMP20 se mantuvo sin modulacion (sin expresion del gen) en todas las condiciones del experimento (con NAFLD vs control: p=0.068; sin NAFLD vs Control: p=0.181). Se utilizo GUSB como gen normalizador para cada gen analizado, se realizaron tres experimentos de PCR independientemente (Figura 1).

Discusion

La enfermedad de higado graso tiene una creciente prevalencia a nivel global en los ultimos anos, con riesgo de incremento por factores de riesgo como la obesidad, diabetes, hipertension arterial, con lo cual es extensamente estudiada a nivel mundial por ser un problema de salud publica. Los estudios moleculares en NAFLD se han realizado en su mayoria en modelos animales, y han involucrado TGF-[beta] como una citoquina con un papel crucial en la fibrogenesis en la enfermedad hepatica cronica, se ha observado una senalizacion persistente que resulta en una desregulacion de mecanismos normales de sintesis--degradacion de matriz extracelular y por ende en su excesiva acumulacion (12, 13).

Este estudio analizo expresion de genes relacionados con el proceso fibrogenico en los procesos iniciales de la lesion en individuos con NAFLD y en individuos con factores de riesgo relacionados a NAFLD en busqueda de biomarcadores utiles en la practica clinica.

En las caracteristicas sociodemograficas, se observo en el total de los individuos mayor proporcion del genero femenino procedentes del area urbana, comportamiento que se mantuvo al clasificar a los individuos de estudio por grupos segun el diagnostico ecografico (con NAFLD o sin NAFLD); este comportamiento es muy similar a estudios previos (14, 15). Al igual que otros autores, la procedencia del area urbana, ha permitido confirmar que la urbanizacion ha incrementado la frecuencia de trastornos como la diabetes mellitus, obesidad, dislipidemia e HTA (16-19), posiblemente debido a habitos de vida poco saludables que conllevan tambien a IMC relevantes, tales como los valores hallados en este estudio. El indice de masa corporal de los individuos en estudio es una variable que muchos autores tambien han utilizado para estimar la obesidad aun con sus limitaciones, ademas algunos informes demuestran la asociacion entre un mayor indice de masa corporal (IMC), la diabetes y el riesgo de padecer higado graso no alcoholico (20, 21).

Confirmamos, la hipertension arterial como el factor de riesgo mas frecuente en los pacientes con NAFLD tal como se ha documentado (22), seguido de obesidad, diabetes mellitus y dislipidemia significativa, en concordancia con lo reportado en otros estudios (4, 23-28). Estos factores de riesgo, de alguna manera conllevan a resistencia a la insulina, cuyos mecanismos bioquimicos incluyen desregulacion en la secrecion de adipoquinas, disminuyendo asi la adiponectina e incrementando la secrecion de TNFa (citoquina que promueve la resistencia a la insulina local y sistemica), esto conlleva a inhibicion de la lipolisis del triacilglicerol y favorece el flujo de acidos grasos no esterificados al higado consecuente a la excesiva acumulacion hepatica de lipidos (3, 29, 30). La presencia de hiperinsulinemia o resistencia a la insulina y la asociacion con algunas de las caracteristicas del sindrome metabolico, confirma que NAFLD constituye el componente hepatico del mismo, pero en el estudio no se considero la contribucion relativa de cada componente del sindrome metabolico al riesgo de NAFLD (31). El colesterol total plasmatico fue significativo al comparar entre los grupos estudiados, contrario a los resultados reportados por Sepeliotes y col. en individuos seleccionados a partir del Framingham Heart Study, que no hallaron valores de colesterol que condujeran a relacionar los niveles altos de este metabolito con presentar NAFLD (32). Por su parte, Shen y col. y Kim y col., al comparar individuos con y sin diagnostico de NAFLD encuentran diferencias significativas tanto para colesterol total como para trigliceridos (33, 34). En referencia a las transaminasas, nuestro estudio no mostro diferencias significativas en los grupos estudiados pero, estos valores no garantizan la ausencia de lesion hepatica como se ha reportado en la literatura (35-37).

Esta investigacion, al igual que otros estudios tambien presenta limitaciones, la mas importante es la aceptacion para participar en el estudio molecular por tan solo 10 individuos. Asi mismo, el uso de ultrasonografia para el diagnostico de esteatosis. La ultrasonografia posee una sensibilidad en la deteccion de infiltracion grasa en el higado estimada entre 87 y 100% y una especificidad entre 84 y 89% (38), pero la biopsia hepatica representa mayor sensibilidad pero, esta practica no es factible ni es eticamente justificado en una condicion de bajo riesgo de progresion que no defina tratamiento, por tanto para estos estudios es valido el uso ultrasonografia para definir el grupo de individuos con NAFLD (39, 40).

Mostramos que los cambios de expresion de genes TGF-[beta]1, COL1A2 fueron mas prominentes en el grupo de individuos con NAFLD, sugiriendo desbalance entre acumulo de COL1A2 secretado por las celulas estrelladas del higado (HSC) conducente a fibrogenesis, y la regulacion a la baja de MMP20 que lo degrada. Un aspecto importante de nuestros resultados es que el grupo de factores de riesgo se comporto de forma similar al grupo con NAFLD, con lo que se podria pensar, que el aumento de la expresion de TGF-[beta] en higado podria ser importante en la progresion de las complicaciones hepaticas y a la progresion a hepatocarcinoma, con lo cual no debe ser desestimada.

Los niveles de expresion de TGF-[beta]1 en los individuos con factores de riesgo y aun mas en los individuos con NAFLD sugiere una constante senalizacion por parte de esta citoquina en el tiempo, lo que es de resaltar ya que la estimulacion autocrina de TGF-[beta] a los miofibroblastos desencadenan activacion de la via Smad, este hecho ha sido observado en enfermedades cronicas hepaticas en modelos animales y podria ser una razon del excesivo efecto del TGF-[beta] durante la progresion a fibrosis hepatica, con lo cual, el TGF-[beta] podria ser un marcador clinico de dano hepatico que merece mas estudios. Diferentes autores han evaluado la activacion de la via de senalizacion TGF-[beta]/Smad en ratones observando en etapa temprana infiltracion de grasa en algunos hepatocitos hasta la presencia evidente de fibrosis, dichos estudios revelaron mayor expresion de Colageno tipo I a1 y TGF-[beta]1 en tejido hepatico (8, 41). Del mismo modo, Starkel y col. evidenciaron incremento en la expresion de TGF-[beta]1 y deposicion de colageno en tejido hepatico de ratones con esteatohepatitis (42). La expresion de COL1A2 confirma aun mas, la accion del TGF-[beta], y sugiere una evidencia de lo que se ha visto en modelos animales de enfermedades cronicas hepaticas, en los cuales se ha demostrado la localizacion de marcadores como procolagenos 1 A2 (43).

Al igual que los ensayos antes mencionados en modelos animales, Greco y col. y Sookoian y col., evaluaron la expresion genica en tejido hepatico humano de pacientes con NAFLD, encontrando genes relacionados con el metabolismo lipidico y genes implicados en la remodelacion de la matriz extracelular (44, 45). Estos hallazgos permiten confirmar con mayor certeza los resultados obtenidos en nuestro estudio al sugerir la activacion de la via de senalizacion del TGF-[beta] en tejido hepatico durante la esteatosis, e incluso, la expresion de TGF-[beta] en hepatocitos desde el momento mismo que se presentan factores de riesgo que hacen mucho mas probable la aparicion de esta patologia, estimulando la deposicion de mayor cantidad de colageno y contribuyendo con una posible progresion a fibrosis de no tomar medidas que reviertan dicho proceso.

Por otra parte, la regulacion a la baja de la MMP20 en todos los individuos analizados es muy interesante y amerita mayores estudios, ya que estudios han reportado que en las fases tempranas de lesion hepatica, se activan HSC caracterizadas por generacion de MMPs y degradacion local de la matriz normal del higado y favorecer la regeneracion del tejido (46). Pero los datos muestran una regulacion a la baja de MMP20, aun en el higado de los individuos con factores de riesgo, lo que hipoteticamente sugiere que las vias donde participa como proliferacion del hepatocito, apoptosis pueden estar afectadas en estos individuos.

A nivel de Cartagena de Indias es el primer estudio molecular de activacion temprana de genes implicados en la genesis de la fibrosis en pacientes con NAFLD y con factores asociados en humanos. Los resultados sugieren una activacion de las vias de senalizacion que conducen a fibrogenesis y su posible progresion a hepatocarcinoma en la condicion de factores de riesgo para NAFLD (HTA, obesidad, diabetes mellitus), y mucho mas acentuada en los pacientes con NAFLD, con lo cual este estudio amerita seguir evaluando las vias moleculares e intervenir en los individuos con factores de riesgo.

Fuentes de Financiacion

Los autores declaran financiacion por plan de Fortalecimiento del grupo Prometeus reconocido por Colciencias por la Universidad de Cartagena, Programa de jovenes investigadores e innovadores de Colciencias.

Agradecimientos

Los autores agradecen a la Universidad de Cartagena -Colciencias por apoyar este trabajo a traves del programa de Jovenes investigadores, estudiantes del semillero de investigacion del grupo 'Prometeus & Biomedicina aplicada a las ciencias clinicas", a los residentes de la especialidad en cirugia general y radiologia de la Universidad de Cartagena, al equipo medico de la unidad de imagenes diagnosticas y de la unidad de higado y vias biliares del hospital Universitario del Caribe, por su valiosa ayuda durante el desarrollo del estudio.

Referencias

(1.) Yki-Jarvinen H. Non-alcoholic fatty liver disease as a cause and a consequence of metabolic syndrome. Lancet Diabetes Endocrinol. 2014;2(11):901-10.

(2.) LaBrecque DR, Abbas Z, Anania F, Ferenci P, Khan AG, Goh KL, et al. World Gastroenterology Organisation global guidelines: Nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. J Clin Gastroenterol. 2014;48(6):467-73.

(3.) Ballestri S, Lonardo A, Bonapace S, Byrne CD, Loria P, Targher G. Risk of cardiovascular, cardiac and arrhythmic complications in patients with nonalcoholic fatty liver disease. World J Gastroenterol. 2014;20(7): 1724-45.

(4.) Koehler EM, Schouten JNL, Hansen BE, van Rooij FJA, Hofman A, Stricker BH, et al. Prevalence and risk factors of non-alcoholic fatty liver disease in the elderly: Results from the Rotterdam study. J Hepatol. 2012;57(6): 1305-11.

(5.) Kim W, Kim BG, Lee JS, Lee CK, Yeon JE, Chang MS, et al. Randomised clinical trial: the efficacy and safety of oltipraz, a liver X receptor alpha-inhibitory dithiolethione in patients with non-alcoholic fatty liver disease. Alimentary pharmacology & therapeutics. 2017.

(6.) Louka ML, Ramzy MM. Involvement of fibroblast-specific protein 1 (S100A4) and matrix metalloproteinase-13 (MMP-13) in CCl4-induced reversible liver fibrosis. Gene. 2016;579(1):29-33.

(7.) Yoshida K, Murata M, Yamaguchi T, Zaki KM. TGF-[beta]/Smad signaling during hepatic fibro-carcinogenesis (Review). Int J Oncol. 2014;45(4): 1363-71.

(8.) Yan C, Wang L, Li B, Zhang B-B, Zhang B, Wang Y-H, et al. The expression dynamics of transforming growth factor-[beta]/Smad signaling in the liver fibrosis experimentally caused by Clonorchis sinensis. Parasit Vectors. 2015;8:70.

(9.) Petta S, Valenti L, Bugianesi E, Targher G, Bellentani S, Bonino F, et al. A "systems medicine" approach to the study of non-alcoholic fatty liver disease. Dig Liver Dis. 2016;48(3):333-42.

(10.) Castera L, Pinzani M. Biopsy and non-invasive methods for the diagnosis of liver fibrosis: does it take two to tango? Gut. 2010;59(7):861-6.

(11.) World Medical A. World medical association declaration of helsinki: Ethical principles for medical research involving human subjects. JAMA. 2013;310(20):21914.

(12.) Yang L, Roh YS, Song J, Zhang B, Liu C, Loomba R, et al. TGF-[beta] Signaling in Hepatocytes Participates in Steatohepatitis Through Regulation of Cell Death and Lipid Metabolism. Hepatology. 2014;59(2):483-95.

(13.) Wang Z, Yao T, Song Z. Extracellular signal-regulated kinases 1/2 suppression aggravates transforming growth factor-beta1 hepatotoxicity: a potential mechanism for liver injury in methionine-choline deficient-diet-fed mice. Experimental biology and medicine (Maywood, NJ). 2010;235(11): 1347-55.

(14.) Browning JD, Kumar KS, Saboorian MH, Thiele DL. Ethnic differences in the prevalence of cryptogenic cirrhosis. The American journal of gastroenterology. 2004;99(2): 292-8.

(15.) Marchesini G, Bugianesi E, Forlani G, Cerrelli F, Lenzi M, Manini R, et al. Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome. Hepatology. 2003;37(4):917-23.

(16.) Adediran O, Akintunde AA, Edo AE, Opadijo OG, Araoye AM. Impact of urbanization and gender on frequency of metabolic syndrome among native Abuja settlers in Nigeria. J Cardiovasc Dis Res. 2012;3(3): 191-6.

(17.) Pandey RM, Gupta R, Misra A, Misra P, Singh V, Agrawal A, et al. Determinants of urban-rural differences in cardiovascular risk factors in middle-aged women in India: a cross-sectional study. Int J Cardiol. 2013;163(2): 157-62.

(18.) Aschner P, Aguilar-Salinas C, Aguirre L, Franco L, Gagliardino JJ, de Lapertosa SG, et al. Diabetes in South and Central America: An update. Diabetes Res Clin Pract. 2014;103(2):238-43.

(19.) Aschner P. Epidemiologia de la diabetes en Colombia. Av diabetol. 2010; 26(2): 95100.

(20.) Loomis AK, Kabadi S, Preiss D, Hyde C, Bonato V, St. Louis M, et al. Body Mass Index and Risk of Nonalcoholic Fatty Liver Disease: Two Electronic Health Record Prospective Studies. The Journal of Clinical Endocrinology and Metabolism. 2016; 101(3):945-52.

(21.) Zelber-Sagi S, Shoham D, Zvibel I, Abu-Abeid S, Shibolet O, Fishman S. Predictors for advanced fibrosis in morbidly obese non-alcoholic fatty liver patients. World Journal of Hepatology. 2017;9(2):91-8.

(22.) Donati G, Stagni B, Piscaglia F, Venturoli N, Morselli-Labate AM, Rasciti L, et al. Increased prevalence of fatty liver in arterial hypertensive patients with normal liver enzymes: role of insulin resistance. Gut. 2004;53(7): 1020-3.

(23.) Portillo-Sanchez P, Bril F, Maximos M, Lomonaco R, Biernacki D, Orsak B, et al. High Prevalence of Nonalcoholic Fatty Liver Disease in Patients With Type 2 Diabetes Mellitus and Normal Plasma Aminotransferase Levels. J Clin Endocrinol Metab. 2015;100(6):2231-8.

(24.) Watanabe S, Hashimoto E, Ikejima K, Uto H, Ono M, Sumida Y, et al. Evidence-based clinical practice guidelines for nonalcoholic fatty liver disease/ nonalcoholic steatohepatitis. Hepatol Res. 2015;45(4):363-77.

(25.) Nascimbeni F, Pais R, Bellentani S, Day CP, Ratziu V, Loria P, et al. From NAFLD in clinical practice to answers from guidelines. J Hepatol. 2013;59(4):859-71.

(26.) Jager S, Jacobs S, Kroger J, Stefan N, Fritsche A, Weikert C, et al. Association between the Fatty Liver Index and Risk of Type 2 Diabetes in the EPIC-Potsdam Study. PLoS One. 2015;10(4):e0124749.

(27.) Sung K-C, Wild SH, Byrne CD. Resolution of Fatty Liver and Risk of Incident Diabetes. J Clin Endocrinol Metab. 2013;98(9):3637-43.

(28.) The Korean Association for the Study of the L. KASL clinical practice guidelines: Management of nonalcoholic fatty liver disease. Clin Mol Hepatol. 2013;19(4):325-48.

(29.) Williams KH, Shackel NA, Gorrell MD, McLennan SV, Twigg SM. Diabetes and nonalcoholic Fatty liver disease: a pathogenic duo. EndocrRev. 2013;34(1):84-129.

(30.) Kim D, Choi S-Y, Park EH, Lee W, Kang JH, Kim W, et al. Nonalcoholic Fatty Liver Disease is Associated with Coronary Artery Calcification. Hepatology. 2012; 56(2): 10.1002/hep.25593.

(31.) Marchesini G, Brizi M, Morselli-Labate AM, Bianchi G, Bugianesi E, McCullough AJ, et al. Association of nonalcoholic fatty liver disease with insulin resistance. Am J Med. 1999;107(5):450-5.

(32.) Speliotes EK, Massaro JM, Hoffmann U, Vasan RS, Meigs JB, Sahani DV, et al. Fatty liver is associated with dyslipidemia and dysglycemia independent of visceral fat: the Framingham Heart Study. Hepatology. 2010;51(6): 1979-87.

(33.) Shen J, Chan HL-Y, Wong GL-H, Choi PC-L, Chan AW-H, Chan H-Y, et al. Non-invasive diagnosis of non-alcoholic steatohepatitis by combined serum biomarkers. J Hepatol 2012;56(6): 1363-70.

(34.) Kim Y-C, Cho Y-K, Lee W-Y, Kim H-J, Park J-H, Park D-I, et al. Serum adipocyte-specific fatty acid-binding protein is associated with nonalcoholic fatty liver disease in apparently healthy subjects. JNutr Biochem. 2011;22(3):289-92.

(35.) Liu X, Hamnvik O-PR, Chamberland JP, Petrou M, Gong H, Christophi CA, et al. Circulating alanine transaminase (ALT) and y-glutamyl transferase (GGT), but not fetuin-A, is associated with metabolic risk factors, at baseline and at two-year follow-up: the prospective Cyprus Metabolism Study. Metabolism: clinical and experimental. 2014;63(6):773-82.

(36.) Jo SK, Lee WY, Rhee EJ, Won JC, Jung CH, Park CY, et al. Serum gammaglutamyl transferase activity predicts future development of metabolic syndrome defined by 2 different criteria. Clinica chimica acta; international journal of clinical chemistry. 2009;403(1-2):234-40.

(37.) Mofrad PS, Sanyal AJ. Nonalcoholic fatty liver disease. MedGenMed. 2003;5(2): 14.

(38.) Joseph AEA, Saverymuttu SH, Al-Sam S, Cook MG, Maxwell JD. Comparison of liver histology with ultrasonography in assessing diffuse parenchymal liver disease. Clin Radiol. 1991;43(1):26-31.

(39.) Saadeh S, Younossi ZM, Remer EM, Gramlich T, Ong JP, Hurley M, et al. The utility of radiological imaging in nonalcoholic fatty liver disease. Gastroenterology. 2002;123(3):745-50.

(40.) Neuschwander-Tetri BA, Caldwell SH. Nonalcoholic steatohepatitis: summary of an AASLD Single Topic Conference. Hepatology. 2003;37(5): 1202-19.

(41.) Wang J, Zhang C, Wei X, Blagosklonov O, Lv G, Lu X, et al. TGF-[beta] and TGF-[beta]/Smad Signaling in the Interactions between Echinococcus multilocularis and Its Hosts. PLoS ONE. 2013;8(2):e55379.

(42.) Starkel P, Sempoux C, Leclercq I, Herin M, Deby C, Desager J-P, et al. Oxidative stress, KLF6 and transforming growth factor-| up-regulation differentiate non-alcoholic steatohepatitis progressing to fibrosis from uncomplicated steatosis in rats. J Hepatol. 2003;39(4):538-46.

(43.) Chu AS, Diaz R, Hui JJ, Yanger K, Zong Y, Alpini G, et al. Lineage tracing demonstrates no evidence of cholangiocyte epithelial-to-mesenchymal transition in murine models of hepatic fibrosis. Hepatology. 2011;53(5): 1685-95.

(44.) Greco D, Kotronen A, Westerbacka J, Puig O, Arkkila P, Kiviluoto T, et al. Gene expression in human NAFLD. Am J Physiol Gastrointest Liver Physiol. 2008;294(5):G1281-G7.

(45.) Sookoian S, Gianotti TF, Rosselli MS, Burgueno AL, Castano GO, Pirola CJ. Liver transcriptional profile of atherosclerosis-related genes in human nonalcoholic fatty liver disease. Atherosclerosis. 2011;218(2):378-85.

(46.) Benyon RC, Arthur MJ. Extracellular matrix degradation and the role of hepatic stellate cells. Seminars in liver disease. 2001;21(3):373-84.

Lina Lambis, Jose Belisario Solana, Amileth Suarez *

Dra. Lina Lambis Anaya: Investigadora Bacteriologa. Magister en Bioquimica. Grupo Prometeus & Biomedicina aplicada a las ciencias clinicas, Laboratorio de Bioquimica, Facultad de Medicina, Universidad de Cartagena; Dr. Jose Belisario Solana Tinoco: Especialista en Cirugia General y del Aparato Digestivo, Unidad de Higado Vias Biliares, Hospital Universitario del Caribe--Cartagena, Liga Contra el Cancer; Amileth Suarez Causado: Doctora en Bioquimica y Biologia Molecular. Grupo Prometeus & Biomedicina Aplicada a las Ciencias Clinicas, Docente de Bioquimica (PhD), Facultad de Medicina, Universidad de Cartagena. Cartagena (Colombia). Correspondencia: Dra. Amileth Suarez Causado, Cartagena (Colombia).

E-mail: asuarezc1@unicartagena.edu.co

Recibido: 23/m/2017 Aceptado: 25/VI/2018

Leyenda: Figura 1. Expresion genica de TGF-[beta]1, COL1A2 Y MMP20 mediante amplificacion por PCR convencional en tejido hepatico de individuos con factores de riesgo sin desarrollo de NAFLD, de individuos con NAFLD y en control sano. Se utiliza GUSB como gen de referencia. A. Amplificacion por PCR en geles de agarosa 1% de TGF-[beta]1, COL1A2 Y MMP20. B. Niveles de expresion relativa del ARNm de TGF-[beta]1 con respecto a GUSB por grupos. C. Niveles de expresion relativa del ARNm de COL1A2 con respecto a GUSB por grupos. D. Niveles de expresion relativa del ARNm de MMP20 con respecto a GUSB por grupos. Los asteriscos indican valores de p<0,05 al comparar los grupos Sin NAFLD / Con NAFLD frente al control.
Tabla 1. Distribucion de las caracteristicas sociodemograficas y
antropometricas de los participantes.

Caracteristicas sociodemograficas y antropometricas

                                   Total
                               participantes       Con NAFLD
                                  N = 83            n = 22
Edad, ([barra.X]) (DE)       55.4     (18.53)   51.2    (17.34)
Genero, n (%)
  Femenino                    63      (75.9)     14     (63.64)
  Masculino                   20      (24.1)      8     (36.36)
Procedencia, n (%)
  Urbano                      60      (72.3)     16     (72.73)
  Rural                       23      (27.7)      6     (27.27)
Medidas antropometricas,
([barra.X]) (DE)
  Peso                       77.2     (17.41)   83.45   (18.48)
  Talla                      1.61     (0.07)    1.63    (0.07)
  IMC                       29.86     (6.55)    31.54   (6.97)

                           Sin NAFLD n = 61    P

Edad, ([barra.X]) (DE)     56.9    (18.84)   0.214
Genero, n (%)
  Femenino                  49     (80.33)   0.117
  Masculino                 12     (19.67)
Procedencia, n (%)
  Urbano                    44     (72.13)   0.957
  Rural                     17     (27.87)
Medidas antropometricas,
([barra.X]) (DE)
  Peso                     75.03   (16.65)   0.061
  Talla                    1.60    (0.07)    0.195
  IMC                      29.29   (6.36)    0.186

(barra.X]) media; DE, Desviacion estandar
El peso fue medido en Kg y la Talla en metros.
* Estadisticamente significativo

Tabla 2. Factores de riesgo asociados con el desarrollo de NAFLD.

Factores de riesgo
asociados                Total participantes    Con NAFLD    Sin NAFLD
                               N (%)             n (%)        n (%)
                              83 (100)         22 (26.5)    61 (73.5)
Obesidad
  Si                         41 (49.4)         12 (54.5)    29 (47.5)
  No                         42 (50.6)         10 (45.5)    32 (52.5)
Diabetes mellitus
  Si                         29 (34.9)          8 (36.4)    21 (34.4)
  No                         54 (65.1)         14 (63.6)    40 (65.6)
Dislipidemia
  Si                         18 (21.7)          9 (40.9)     9 (14.8)
  No                         65 (78.3)         13 (59.1)    52 (85.2)
Hipertension arterial
  Si                         42 (50.6)          7 (31.8)    35 (57.4)
  No                         41 (49.4)         15 (68.2)    26 (42.6)

                          OR (IC 95%)         P

Obesidad
  Si                    1.32 (0.45-3.98)    0.573
  No
Diabetes mellitus
  Si                    1.09 (0.34-3.33)    0.870
  No
Dislipidemia
  Si                     4 (1.13-13.85)    0.011 *
  No
Hipertension arterial
  Si                    0.35 (0.11-1.07)   0.039 *
  No

OR, Odds Ratio; IC, Intervalo de confianza
* Estadisticamente significativo

Tabla 3. Niveles plasmaticos de los parametros bioquimicos
estudiados en los participantes.

Mediciones bioquimicas

                                 Total participantes
                                       Me [RI]
ALT (U/L)                          38         [20-129]
AST (U/L)                          38         [19-70]
AST/ALT                           1.0       [0.75-1.29]
Bilirrubina total (mg/dL)         0.90      [0.47-2.80]
Bilirrubina directa (mg/dL)       0.46      [0.19-2.11]
Bilirrubina indirecta (mg/dL)     0.34      [0.16-0.60]
GGT (U/L)                         201         [52-384]
Albumina (g/dL)                   3.29      [2.70-3.50]
TP (segundos)                     10.7       [9.9-12.2]
TPT (segundos)                    25.7      [22.8-29.5]
INR                               1.00      [0.93-1.10]
Glicemia                          99.5      [85.1-121.9]
Colesterol total (mg/dL)          168        [139-202]
Trigliceridos (mg/dL)             152        [133-199]
Fosfatasa alcalina (U/L)          307        [217-469]
Creatinina                        0.84      [0.69-1.01]
Plaquetas                        322500   [239250-428750]

Mediciones bioquimicas

                                       Con NAFLD
                                        Me [RI]
ALT (U/L)                          76         [28-133]
AST (U/L)                         49.5       [19-92.5]
AST/ALT                           0.84      [0.53-1.24]
Bilirrubina total (mg/dL)         0.74      [0.47-1.41]
Bilirrubina directa (mg/dL)       0.51      [0.28-1.15]
Bilirrubina indirecta (mg/dL)     0.23       [0.18-0.4]
GGT (U/L)                         136         [54-146]
Albumina (g/dL)                   3.42      [3.16-3.925]
TP (segundos)                     10.5      [10.3-14.1]
TPT (segundos)                   25.35      [21.9-27.05]
INR                               1.04      [0.96-1.24]
Glicemia                         108.4      [85.7-131.4]
Colesterol total (mg/dL)         193.2     [170.3-214.2]
Trigliceridos (mg/dL)            173.7     [133,9-243.3]
Fosfatasa alcalina (U/L)          376       [275-477.5]
Creatinina                       0.755      [0.55-1.05]
Plaquetas                        317000   [258500-430000]

Mediciones bioquimicas
                                    Sin NAFLD Me [RI]          P

ALT (U/L)                          27         [19-105]       0.073
AST (U/L)                          29         [20-67]        0.356
AST/ALT                           1.05      [0.83-1.30]      0.116
Bilirrubina total (mg/dL)         0.91      [0.535-2.95]     0.967
Bilirrubina directa (mg/dL)       0.41      [0.185-1.97]     0.561
Bilirrubina indirecta (mg/dL)     0.38      [0.18-0.65]      0.256
GGT (U/L)                         258         [47-586]       0.671
Albumina (g/dL)                   3.17      [2.61-3.43]      0.172
TP (segundos)                     10.7       [10-11.9]       0.416
TPT (segundos)                     26       [23.1-29.9]      0.336
INR                                1        [0.935-1.07]     0.311
Glicemia                          98.3      [85.1-120.7]     0.348
Colesterol total (mg/dL)         159.7     [137,4-194.5]     0.009 *
Trigliceridos (mg/dL)            151.77    [133.8 -189.9]    0.217
Fosfatasa alcalina (U/L)          279        [208--468]      0.452
Creatinina                        0,86      [0.75-0.97]      0.166
Plaquetas                        325000   [239500--425000]   0.918

ME, mediana; RI, Rango intercuartilico; ALT, Alanina
aminotransferasa; AST, Aspartato aminotransferasa; GGT, Gamma
glutamil transferasa; TP, Tiempo de protrombina; TPT, Tiempo
parcial de tromboplastina; INR, International Rormalizad Ratio; *
Estadisticamente significativo.
COPYRIGHT 2018 Asociacion Colombiana de Medicina Interna
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:TGF; factor de crecimiento transformante
Author:Lambis, Lina; Belisario Solana, Jose; Suarez, Amileth
Publication:Acta Medica Colombiana
Date:Jul 1, 2018
Words:6625
Previous Article:Experiencia con paratiroidectomia quirurgica en pacientes con enfermedad renal cronica e hiperparatiroidismo terciario.
Next Article:Patrones de prescripcion de medicamentos antitiroideos en una poblacion de Colombia.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters