Evaluation of emm gene types, toxin gene profiles and clonal relatedness of group A streptococci.
INTRODUCTIONStreptococcus pyogenes (group A streptococciGAS) cause a wide spectrum of infections ranging from pharyngitis and skin infections to necrotising fasciitis and toxic shock syndrome [1]. Increase in the rate of invasive infections and related morbidity and mortality in the last few decades besides the presence of GAS strains in asypmtomatic carriers has gained attention to the virulence factors and have put forward the requirement to investigate the genetic characteristics of this microorganism including toxin gene profiles and emm types [1, 2]. M protein, encoded by emm gene, is particularly important both as a virulence factor and as the most important candidate for vaccine studies [1]. The 5' portion of emm gene which is critical for the achievement of immunological specificity has been sequenced for all of known M serotypes forming 124 emm types and the data are available at the CDC databases (http://www.cdc.gov/ncidod/biotech/ strep/emmtypes. html). The most common emm types reported are emm1, emm6, emm18, emmy8, emm49, emm75, emm95 and emm103 [3]. A 26-valent vaccine covering the estimated most common M types is on the agenda [4, 5]. Streptococcal pyrogenic toxins, which behave as superantigens, are also important in virulence of the bacteria and reported to be linked to infections with high morbidity and mortality [6, 7]. SpeA, speB, speC, speF, speG, speH, spel, speJ, speK, speL, speM, ssa, smeZ and smeZ2 are the known pyrogenic toxins of GAS defined until recently [6, 7]. Phylogenetic analyses give rise to the thought that the toxin genes are spread by horizontal transfer and the production of the toxic enzymes differ with varying emm types [1]. In this respect, it is crucial to know about the emm types, pyrogenic toxin gene profiles, clonal relatedness of the isolates in particular regions and to manifest any relation between them. It is also essential to determine the distribution of these parameters in the isolates from asymptomatic carrier population for all the better insight into GAS infections and virulence. The study in this area will also be useful for effective vaccine development.
The aim of this study is to evaluate and to compare emm gene types, toxin gene profiles and clonal relatedness of group A streptococci (GAS) obtained from patients with indicated GAS infections and from GAS carriers.
MATERIALS AND METHODS
This research has been performed with the approval of Zonguldak Karaelmas University, Training and Research Hospital Ethics Committee.
Patient isolates
GAS isolates were collected from patients admitted to our hospital with indicated GAS infections between January 2009 and April 2010.
Carrier isolates
GAS isolates were obtained from students aged between 7-14 years from three schools (School F, School A, School K) between November 2009 and June 2010. Informed consent forms from parents were taken for each student included. Three screening studies were performed with at least one month interval in each school. An accompanying otorhinolaryngologist was present in each of the screening studies for the physical examination of the students to eliminate respiratory tract infections and for the sampling. The students with at least two positive GAS cultures at the end of three screening studies without recent history and signs of infection were included in the study as carriers.
Isolate identification
Identification of GAS isolates was performed using bacitracin (0.04 U) and trimethoprim sulfamethoxazole (1.25/23.75 [micro]g) discs (Becton Dickinson, USA) and L-pyrrolidonyl arylamidase (PYR) test (Becton Dickinson, USA) as well as latex agglutination test (Plasmatec Lab. Products Ltd., UK) and BBL system (Becton Dickinson, USA) when needed.
DNA extraction
The DNA extraction was done by a commercial extraction kit (EZ-10 Spin Column Genomic DNA MiniPreps Kit, Bio Basic, Canada) as described by the manufacturer.
Typing of isolates
The emm typing was performed by DNA sequencing using the protocol recommended by Centers for Disease Control (CDC) (http://www.cdc.gov/ncidod/biotech/ strep/doc.html). ABI Prism 310 Genetic Analyser (Applied Biosystems, USA) and ABI Prism 310 Data Collection Software were used. The reference DNA sequences from CDC website (ftp://ftp.cdc.gov/pub/infectious_diseases /biotech/tsemm) were used. The global alignment was done by CLC Bioinformatics Software (Aarhus, Denmark) and the local alignment was performed by National Centre for Biotechnology Information (NCBI) Gene Bank and Basic Local Alignment Tool (BLAST) server.
Determination of toxin gene profiles
The presence of speA, speB, speC, speG and smeZ genes were tested by polymerase chain reaction (PCR) as described before [7-10]. The primers used for each gene is shown in Table 1.
Determination of clonal relatedness
The clonal relatedness of the isolates obtained from the patients and carriers was assessed using pulsed-field gel electrophoresis (PFGE) of the genomic DNA as described before with some modifications [11]. Restriction of the genomic DNA was achieved with 25U of SmaI (Sigma, Steinham, Germany) for 2h at 30[degrees]C. The DNA fragments were electro-phoresed by the CHEF-DR II system (BioRad Laboratories, Nazareth, Belgium) at 10[degrees]C at 6V/cm for 20h with initial and final switch times of 4,6 and 40 seconds, respectively. The PFGE profiles were analysed by GelCompar II Software (version 3.0; Applied Maths, Belgium) based on Dice coefficient. The dendogramme was generated by unweighted pair group method with mathematical averaging (UPGMA). According to the interpretative criteria of Tenover et al., [12] the isolates revealing more than 80% similarity were considered to be "closely related". Indistinguishable isolates were shown by a common "numeral". Closely related isolates were demonstrated by addition of a "letter" next to the numeral.
Statistical analysis
Statistical analyses were performed with SPSS for Windows, release 13.0 (SPSS Inc. Chicago, IL, USA). Distribution of numerical data was assessed by using one-sample Kolmogorov-Smirnov test. Differences between the groups according to the categorical variables and the association between the variables were assessed by Pearson's chi-square test and the Fisher's Exact test. The results were evaluated in 95% confidence interval and the value of statistical significance was accepted as: "p<0.05".
[FIGURE 1 OMITTED]
RESULTS
Patient isolates
A total of 79 clinical GAS isolates were obtained during the study period. A total of 66 of them were isolated from nasopharyngeal specimen.
Carrier isolates
A total of 60 GAS isolates were obtained from carriers in three schools after screening of 680 students of whom 538 were noted as healthy; 142 students were excluded from the study as they had particular signs of infection during the physical examination by the otorhinolaryngologist. The average rate of GAS carriage was found as 11.2%.
emm types
Of the 139 isolates included in the study, 112 were typeable by DNA sequencing for emm types (80.6%). A total of 21 distinct emm types (1, 2, 3, 3.1, 4, 5, 5.7, 11, 12, 24, 28, 28.9, 44, 71, 75, 77, 78.3, 85, 89 and 118) were detected; the most common types being emm12, emm89, emm1, emm77, emm4 and emm3 constituting 73.2% of the typeable isolates. The rates of detection of emm types was not significantly different in patients and carriers (p>0.05) (Figure 1).
Toxin gene profiles
PCR demonstrated the presence of speB in all of the isolates. The distribution of speA, speC, speG and smeZ genes in carriers and patients is shown in Table 2. The detection rates of the toxin genes did not differ significantly between patients and carriers (p>0.05). The isolates formed 14 out of the 16 probable toxin profiles when all five of the genes tested, speA, speB, speC, speG, smeZ in order, were marked as positive/negative. The distribution of toxin gene profiles in patients and carriers is shown in Table 3. The average number of toxin genes (out of the five genes tested) was 2.78 ([+ or -] 0.88) for the total of the isolates while it was 2,70 ([+ or -] 0.85) for carrier isolates and 2.85 ([+ or -] 0.91) for patient isolates; the difference was not statistically significant (p>0.05).
The clonal relatedness of the isolates
One isolate from each of the carriers was included in PFGE studies. A total of 61 clonotypes were established for the 133 isolates available for PFGE (Figure 2). Of the 133 isolates, 105 formed 33 clusters with 2-9 members while 28 had unique profiles. The clustering rate for the total of isolates was 78.9% (77.9% in patients and 80.4% in carriers); there was no significant difference between patients and carriers (p>0.0s) (see in Figure 2 K90/ K122, K62/K240, A496/A832, K64/K65, K216/K239, K75/K98, K129/K180).
[FIGURE 2 OMITTED]
Association of emm types, toxin genes profiles and PFGE profiles The distribution of toxin genes for the most common emm types in the present study in patients' and carriers' groups is shown in Table 4, Figure 2. The mean number of genes detected was significantly high in emmi type patient isolates compared to carrier isolates. (p<0.05). The presence of speA (11/14, p=0.005) and smeZ (8/14, p=0.004) was significantly higher in emm1 and the presence of speG was significantly lower in emm4 (p=0.005) when compared to the other emm types. All of the smeZ positiveemm1 type isolates belonged to patient group (Figure 2).
Vaccine coverage
Twelve of the 21 emm types detected in this study were covered by the 26-valent vaccine, constituting 77.7% of the emm typeable isolates.
DISCUSSION
Recent studies on GAS have focused on the bacterial cell structures and toxins related with severe infections. The presence of nasopharyngeal carriers besides high morbidity and mortality related to GAS infections have led researches to the evaluation of the molecular characteristics of patient and carrier isolates. The emm types are known to show variance in different regions and time periods [13, 14]. While emm1, emm3 and emm12 have gained predominance in the USA recently [6], various emm types are in advance in different European countries [13]. Previously reported predominant emm types are emm1, emm12, emm4, emm28 and emm3 in the USA [15]; emm1, emm12, emm3 , emm75 and emm4 in Mexico [3]; emm12, emm1, emm4 and28 in Chile [16]; emm77, emm1, emm28, emm89 and emm12 in Finland [17]; emmu, emm12, emm4 and emm1 in Taiwan [18]; emm1 and emm12 in Romania [19]; emm75, emm1, emm6, emm12, emm22, emm4 and emm5 in Italy [20] and emm1 and emm28 in Greece [13] while those are reported to be emm1, emm3 and emm28 in general [7, 13]. There are two studies in literature investigating emm types of nasopharyngeal isolates in our country; revealing predominance of emm12, emm3 and emm1 in Ankara [21], and emm1, emm3 and emm4 in Istanbul [22]. The most common types in our region were emm12, emm89, emm1, emm77, emm4 and emm3 (73.2% of the isolates) generating substantial concordance with the literature. It was remarkable that the rate of emm3 type was significantly higher in patients than in carriers while no significant difference was found for the other emm types. The superantigen gene prevalence in GAS can vary in particular regions and time periods besides the relation of these genes to particular emm types (the surface M protein is suggested influencing the entry of bacteriophage gene into the bacteria) [23]. The number and distribution of toxin genes and association with emm types is the subject of recent studies. In the present study, we investigated five genes and the isolates were found to reveal a mean of 2.78 genes in the total of the population creating no difference between patients and carriers. In our studied population, the presence of speB was 100% and that of speG was 81% in line with the previous reports [24-27]. The most variable rates are reported for speA and speC probably owing to the fact that they are not chromosomally coded and to intenseve research of these genes [25]. In our study, the rate of speA presence was 30.2% in total, creating no difference between patients and carriers. Schmitz et al. [7] suggested that investigating the toxin gene profiles formed by the presence/absence of the total of the toxin genes instead of individual toxin genes may be more crucial to understand the infection dynamics and reported the most common profiles found in their large population of isolates. When the profiles were adapted to the genes that were investigated in our study, ++-+-, -+++-, -+-+- profiles (defined by the presence/absence of speA, speB, speC, speG and smeZ in order) were among the most common profiles in corcordance with Schmitz's data [7]. Besides, the "++-++" profile was found in seven of the patients / none in carriers and "++---" profile was found in five of the carriers/none in patients. The rate of clustering was not significantly different in patients and carriers. The clustering rate was higher in the school where the rate of carriers was higher when compared to the other schools screened. When the clonal relation was evaluated including the emm types and toxin genes, it was observed that some clonally related isolates had the same emm types and toxin genes as well (Figure 2, K64/K65, K90/K122, K216/K239, K62/K240), however, there were some other isolates with clonal relatedness yielding different emm types and toxin genes (Figure 2, K50/K126). It was also worth attention that some of the clusters consisted of solely carrier isolates (PFGE profile 27, 29, 35) while others included patient isolates only (PFGE profile 15, 18, 37). In our study, among the most common emm types detected, emm1 had the highest mean number of toxin genes among the five genes tested. The mean number of genes detected was significantly higher in emm1 type patient isolates compared to carrier isolates. The presence of speA and smeZ was significantly higher in emm1 and the presence of speG was significantly lower in emm4 when compared to the other emm types. All of the smeZ positive-emm1 type isolates belonged to patient group. These findings are in concordance with previous reports by Darenberg et al. who found higher number of genes in emm1 [26] and Luca-Harari et al. who found association between emm1 and speA and lower rates of speG in emm4 and emm77 type isolates [13, 24]. Others studies also reported significant presence of speA, speG and smeZ in emm1 type isolates [2, 25]. The 26-valent vaccine covers proteins of the emm types of 24, 5, 6, 19, 29, 14, 1, 12, 28, 3, 1.2, 18, 2, 43, 13, 22, 11, 59, 33, 89, 101, 77, 114, 75, 76 and 92 types [4]. Studies on emm types included in the 26-valent vaccine have noted coverage rates of 86% from the USA [15] and 69% (16 emm types) from Europe [13]. There are two studies on emm types completed from our country reporting 76.9% coverage from Ankara [21] and 77% coverage from Istanbul [22]. Twelve of the 21 emm types detected in this study were covered by the 26-valent vaccine, constituting 77.7% of the emm typeable isolates. The types emm4, which is one of the most common types in the present study, and emmn8 are reported in the three studies from our country; however, they are not among vaccine coverage. On the whole, emm types reported until recently from our country are in 70-80% coverage of the 26-valent vaccine.
CONCLUSION
There are a number of subjects for further investigation on GAS such as the relation of emm1 type with increased number of toxin genes, the presence of certain emm types and toxin profiles in patients rather than in carriers, to put for ward relations between the clonotypes, emm types and toxin gene profiles as well as vaccine coverage for particular regions, to which the present study has made some contributions.
ACKNOWLEDGEMENTS
This study was supported by Zonguldak Karaelmas University Scientific Research Fund (Project Number: 2009-20-01-12).
DECLARATION OF INTEREST
None to declare.
REFERENCES
[1] Cunningham M. Pathogenesis of group A streptococcal infections. Clin Microbiol Rev. 2000:13: 470-511.
[2] Vlaminckx BJ, Mascini EM, Schellekens J, Schouls LM, Paauw A, Fluit AC., et al. Site-specific manifestations of invasive group a streptococcal disease: type distribution and corresponding patterns of virulence determinants. J Clin Microbiol. 2003:41: 4941-4949.
[3] Espinosa LE, Li Z, Gomez Barreto D, Calderon Jaimes E, Rodriguez RS, Sakota V. et al. M protein gene type distribution among group A streptococcal clinical isolates recovered in Mexico City, Mexico, from 1991 to 2000, and Durango, Mexico, from 1998 to 1999: overlap with type distribution within the United States. J Clin Microbiol. 2003:41(1):373-378.
[4] Dale JB, Penfound T, Chiang EY, Long V, Shulman ST, Beall B. Multivalent group A streptococcal vaccine elicits bactericidal antibodies against variant M subtypes. Clin Diagn Lab Immunol. 2005:12: 833-836.
[5] Hu MC, Walls MA, Stroop SD, Reddish MA, Beall B, Dale JB. Immunogenicity of a 26-valent group A streptococcal vaccine. Infect Immun. 2002:70: 2171-2177
[6] Johnson D, Kaplan E, VanGheem A, Facklam R, Beall B. Characterization of group A streptococci (Streptococcus pyogenes): correlation of M-protein and emm-gene type with T-protein agglutination pattern and serum opacity factor. J Med Microbiol. 2006:55: 157-164.
[7] Schmitz FJ, Beyer A, Charpentier E, Normark BH, Schade M, Fluit AC., et al. Toxin-gene profile heterogeneity among endemic invasive European group A streptococcal isolates. J Infect Dis. 2003:188: 1578-1586.
[8] Goshorn SC, Schlievert PM. Nucleotide sequence of streptococcal pyrogenic exotoxin type C. Infect Immun. 1988:56: 2518-2520
[9] Mollick JA, Miller GG, Musser JM, Cook RG, Grossman D, Rich RR. A novel superantigen isolated from pathogenic strains of Streptococcus pyogenes with aminoterminal homology to staphylococcal enterotoxins B and C. J Clin Invest. 1993:92: 710-709.
[10] Weeks CR, Ferretti JJ. Nucleotide sequence of the type A streptococcal exotoxin (erythrogenic toxin) gene from Streptococcus pyogenes bacteriophage T12. Infect Immun. 1986: 52: 144-150.
[11] Durmaz R, Durmaz B, Bayraktar M, Ozerol IH, Kalcioglu MT, Aktas E., et al. Prevalence of group A streptococcal carriers in asymptomatic children and clonal relatedness among isolates in Malatya, Turkey. J Clin Microbiol. 2003:41(11):5285-5287.
[12] Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995: 33: 2233-2239.
[13] Luca-Harari B, Darenberg J, Neal S, Siljander T, Strakova L, Tanna A., et al. Clinical and microbiological characteristics of severe Streptococcus pyogenes disease in Europe. J Clin Microbiol. 2009: 47: 1155-1165.
[14] O'Loughlin RE, Roberson A, Cieslak PR, Lynfield R, Gershman K, Craig A. et al., Active Bacterial Core Surveillance Team. The epidemiology of invasive group A streptococcal infection and potential vaccine implications: United States, 2000-2004. Clin Infect Dis. 200735(7):853-862.
[15] Shulman ST, Tanz RR, Kabat W, Kabat K, Cederlund E, Patel D, et al. US Streptococcal Pharyngitis Surveillance Group. Group A streptococcal pharyngitis serotype surveillance in North America, 2000-2002. Clin Infect Dis. 2004; 39(3):325-332.
[16] Wozniak A, Rojas P, Rodriguez C, Undabarrena A, Garate C, Riedel I., et al. M-protein gene-type distribution and hyaluronic acid capsule in group A Streptococcus clinical isolates in Chile: association of emm gene markers with csrR alleles. Epidemiol Infect. 2012;140: 1286-1295.
[17] Vahakuopus S, Vuento R, Siljander T, Syrjanen J, Vuopio J. Distribution of emm types in invasive and non-invasive group A and G streptococci. Eur J Clin Microbiol Infect Dis. 2012; 31: 1251-1256.
[18] Chiang-Ni C, Wu AB, Liu CC, Chen KT, Lin YS, Chuang WJ., et al. Emergence of uncommon emm types of Streptococcus pyogenes among adult patients in southern Taiwan. J Microbiol Immunol Infect. 2011; 44: 424-429.
[19] Luca-Harari B, Straut M, Cretoiu S, Surdeanu M, Ungureanu V, van der Linden M., et al. Molecular characterization of invasive and non-invasive Streptococcus pyogenes isolates from Romania. J Med Microbiol. 2008; 57: 1354-1363.
[20] Lorino G, Gherardi G, Angeletti S, De Cesaris M, Graziano N, Maringhini S., et al. Molecular characterisation and clonal analysis of group A streptococci causing pharyngitis among paediatric patients in Palermo, Italy. Clin Microbiol Infect. 2006;12(2):189-192.
[21] Akca G. Determination of M types of gruoup A beta hemolytic streptococci by "emm sequencing analyse. Ankara: Gazi University Faculty of Medicine; (2006).
[22] Erkin-Cakmak A. M protein (emm) gene typing of group A beta hemolytic streptococci isolated from pharyngeal cultures of children with acute tonsillopharyngitis in Istanbul. Istanbul: Istanbul University; (2009). (Thesis of Pediatrics)
[23] Mylvaganam H, Bjorvatn B, Osland A. Distribution and sequence variations of selected virulence genes among group A streptococcal isolates from western Norway. APMIS. 2000; 108: 771-778.
[24] Luca-Harari B, Ekelund K, van der Linden M, Staum-Kaltoft M, Hammerum AM, Jasir A. Clinical and epidemiological aspects of invasive Streptococcus pyogenes infections in Denmark during 2003 and 2004. J Clin Microbiol. 200836(1):79-86.
[25] Commons R, Rogers S, Gooding T, Danchin M, Carapetis J, Robins-BrowneR., et al. Superantigen genes in group A streptococcal isolates and their relationship with emm types. J Med Microbiol. 2008; 57: 1238-1246.
[26] Darenberg J, Luca-Harari B, Jasir A, Sandgren A, Pettersson H, Schalen C, et al. Molecular and clinical characteristics of invasive group A streptococcal infection in Sweden. Clin Infect Dis. 2007;45: 450-458.
[27] Rivera A, Rebollo M, Miro E, Mateo M, Navarro F, Gurgui M, Mirelis B, Coll P. Superantigen gene profile, emm type and antibiotic resistance genes among group A streptococcal isolates from Barcelona, Spain. J Med Microbiol. 2006;55(Pt 8):1115-1123.
Firat Zafer Mengeloglu (1) *, Elif Aktas (2), Baris Otlu (3), Fusun Comert (2), Canan Kulah (2), Ebru Tas (4), Vildan Sumbuloglu (5)
(1) Department of Medical Microbiology, Faculty of Medicine, Abant Izzet Baysal University, Golkoy, 14280 Bolu, Turkey. (2) Department of Medical Microbiology, Faculty of Medicine, Zonguldak Bulent Ecevit University, Esenkoy, Kozlu, 67600 Zonguldak, Turkey. (3) Department of Medical Microbiology, Faculty of Medicine, Inonu University, Elazig yolu 15. Km, Malatya, Turkey. (4) Department of Otorhinolaryngology, Faculty of Medicine, Zonguldak Bulent Ecevit University, Esenkoy, Kozlu, 67600, Zonguldak, Turkey. (5) epartment of Biostatistics, Faculty of Medicine, Zonguldak Bulent Ecevit University, Esenkoy, Kozlu, 67600 Zonguldak, Turkey.
* Corresponding author: Firat Zafer Mengeloglu, Department of Medical Microbiology, Faculty of Medicine, Abant Izzet Baysal University, Golkoy, 14280 Bolu, Turkey Phone: +90 533 6404908; Fax: +90 374 2534559 e-mail: mengeloglu@gmail.com
Submitted: 6 December 2012 / Accepted: 25 April 2013
TABLE 1. The primers used for determination of the presence of toxin genes. Toxin Primer F Primer R gene (5'[right arrow]3') (5'[right arrow]3') speA ACTTAAGAACCAAGAGATGG CCTTATTCTTAGGTATGAAC speB GGATCCCAACCAGTTGTTAAATCTCT AACGTTCTAAGGTTTGATGCCTACAA speC AAGTGACTCTAAGAAAGACA TTGAGTATCAATGTTTAATG speG AGAAACTTATTT GCCC TAGTAGCAAGGAAAAGG smeZ TAACTCCTGAAAAGAGGC CATTGGTTCTTCTTGATAAG Toxin Size of Reference gene amplification product (bp) speA 309 Weeks et al. [10] speB 764 Mollick et al. [9] speC 130 Goshorn et al. [8] speG 155 Schmitz et al. [7] smeZ 391 Schmitz et al. [7] TABLE 2. The distribution of speA, speC, speG and smeZ genes in carriers and patients speA speC n % p n % p Carriers (n=60) 21 35.0 0.377 29 48.3 0.788 Patients in (n=9) 21 26.6 40 50.6 Total 42 30.2 69 49.6 speG smeZ n % p n % p Carriers (n=60) 46 76.7 0.424 8 13.3 0.172 Patients in (n=9) 66 83.5 19 24.1 Total 112 80.6 27 19.4 TABLE 3. Distribution of toxin gene profiles in the groups. Toxin gene profiles speA speB speC speG smeZ - - - - - + - + - + - - + - + + - - + + - - - - + - - + - - - - - - - - - + + + + - + + + + - + - - + - - - - + - - + - + - + + - - - - - - - - - - - - - - - - Carriers Patients Total (n=60) (n=79) (n=139) 13 22 35 15 |9 34 7 8 15 5 6 11 6 2 8 0 7 7 2 4 6 5 0 5 2 3 5 3 1 4 1 3 4 0 3 3 0 1 1 1 0 1 0 0 0 0 0 0 The "++-++" profile was found in seven of the patients / none in carriers and "++---" profile was found in five of the carriers / none in patients. TABLE 4. Distribution of toxin genes in the most common emm types in respect to the isolate groups. emm type Total n Mean speA number of the toxin genes p (2) C (2) p C P C emm12 29 14 15 2.7 3.1 1 6 cmm89 16 7 9 2.6 2.7 0 5 emm1 14 9 5 4.1 2.2 8 3 cmm77 9 3 6 1.3 2.8 0 3 emm1 9 8 1 2.5 1.0 1 0 Total 77 41 36 3.4 2.7 10 17 emm type speC speG smeZ P C P C P C emm12 9 9 13 11 1 2 cmm89 5 2 6 7 0 2 emm1 3 1 9 2 8 0 cmm77 2 3 0 5 0 1 emm1 5 0 2 0 4 0 Total 24 15 30 25 13 5 Legend: (2) Patients' group, (2) Carriers' group
![]() ![]() ![]() ![]() | |
Author: | Mengeloglu, Firat Zafer; Aktas, Elif; Otlu, Baris; Comert, Fusun; Kulah, Canan; Tas, Ebru; Sumbulogl |
---|---|
Publication: | Bosnian Journal of Basic Medical Sciences |
Article Type: | Report |
Geographic Code: | 4EXBO |
Date: | Aug 1, 2013 |
Words: | 4115 |
Previous Article: | Association of dopamine receptor gene polymorphism and psychological personality traits in liability for opioid addiction. |
Next Article: | Kidney injury molecule-1 expression is closely associated with renal allograft damage. |
Topics: |