Printer Friendly

Evaluation of Genes Encoding 4-N-Trimethylaminobutyraldehyde Dehydrogenase and 4-N-Trimethylamino-1-butanol Dehydrogenase from Pseudomonas sp. 13CM.

Byline: Md. Rezaul Bari, Naoki Akai, Jiro Arima and Nobuhiro Mori

Abstract

Quaternary ammonium compounds (QACs) found in many microbial environments, which have different biological functions. Recently, we obtained two enzymes, 4-N-trimethylaminobutyraldehyde dehydrogenase (TMABaldehyde-DH) and 4-N- trimethylamino-1-butanol dehydrogenase from Pseudomonas sp. 13CM those oxidizes QACs, respectively, 4-N- trimethylaminobutyraldehyde (TMABaldehyde) and 4-N-trimethylamino-1-butanol. TMABaldehyde-DH also mediates the biosynthesis of carnitine. In this study, the genes encoding both enzymes were sequenced and the TMABaldehyde-DH gene over-expressed in Escherichia coli. Their primary structures showed, respectively 93.95 (Percent) and 87.0 (Percent) positional identity with aldehyde dehydrogenase and iron containing alcohol dehydrogenase of Pseudomonas putida GB-1. Characterization of purified recombinant TMABaldehyde-DH, confirmed the enzyme had essentially the same properties as that of TMABaldehyde-DH purified from cell-free extract of Pseudomonas sp. 13CM.

It is indicated that the function of aldehyde dehydrogenase and iron containing alcohol dehydrogenase of Pseudomonas putida GB-1, function as oxidization of QACs. (c) 2013 Friends Science Publishers

Keywords: Quaternary ammonium compounds; Carnitine biosynthetic pathway; 4-N-trimethylaminobutyraldehyde-DH;Pseudomonas sp. 13CM

Introduction

Naturally occurring quaternary ammonium compounds including choline, glycine betaine and carnitine, found in many microbial environments, which have different biological functions. The microorganisms using the choline as a sole source of carbon and nitrogen and their respective degradation pathway have been well studied (Nagasawa et al., 1976; Ikuta et al., 1977; Mori et al., 1980; Abee et al.,1990; Boch et al., 1994, Mori et al., 1992, 2002). Much attention has been paid to the osmoprotective role of glycine betaine in a number of diverse microbial systems (Smith et al., 1988; Roberts, 2005; Annamalai and Venkitanarayanan, 2009). A wide ranges of genes, encode the enzymes involved in degradation of organic compounds have been cloned (Cheong and Oriel, 2000; An et al., 2001; Ibrahim, 2003; Comlekcioglu et al., 2010).

Recently, we identified a microorganism from soil as Pseudomonas sp. 13CM, grown on 4-N-trimethylamino-1- butanol (TMA-Butanol), and the enzyme 4-N- trimethylamino-1-butanol dehydrogenase (TMA-Butanol- DH) purified to apparent homogeneity. The isolated enzyme converts TMA-Butanol (considerable structural resemblance to choline as a theme) into trimethylamino butyraldehyde (TMABaldehyde) (Hassan et al., 2007). Additionally, 4-N-trimethylaminobutyraldehyde dehydrogenase (TMABaldehyde-DH), isolated from the same organism, oxidized TMABaldehyde to yield g-butyrobetaine (Hassan et al., 2008). Consistent with these observations, postulated a complete pathway of TMA- Butanol degradation.

TMABaldehyde-DH also responsible for the reactions of the biosynthetic route of L-carnitine (Hulse et al.,1978) that serves either as a nutrient, such as a carbon and nitrogen source (Kleber, 1997) or as an osmoprotectant (Robert et al., 2000). The enzyme, TMABaldehyde-DH has been also purified from bovine liver (Hulse and Henderson, 1980) and rat liver (Vaz et al., 2000). To improve the yield of the TMABaldehyde-DH from Pseudomonas sp. 13CM, we applied the general cloning technique. The present study deals with the sequencing of the genes encoding TMABaldehyde-DH and TMA-Butanol-DH from Pseudomonas sp. 13CM and enzymological properties of recombinant TMABaldehyde-DH, over-expressed in Escherichia coli.

Materials and Methods

Materials, Bacterial Strains and Plasmids

NAD+ and NADP+ were purchased from Oriental Yeast Co. Ltd. (Tokyo, Japan). TMA-Butanol iodide and TMABaldehyde iodide were prepared from, respectively, 4- dimethylamino-1-butanol and 4-aminobutyraldehyde dimethylacetal (Tokyo Kasei Kogyo Co. Ltd., Japan), according to the method described by Hassan et al. (2007). 4-dimethylaminobutyraldehyde dimethyl acetal was hydrolyzed by 0.1 M HCl overnight at room temperature to produce 4-dimethylaminobutyraldehyde (DMABaldehyde). All other chemicals and materials were of the highest purity grade. Pseudomonas sp. 13CM strain was used as the donor strain for the TMABaldehyde-DH and TMA-Butanol-DH gene (Hassan et al., 2007). Plasmid vector pET-24b (+) (Novagen, Madison, USA) was used for expression. E. coli JM109 and E. coli BL21 (DE3) cells were used as the host strain for general cloning and gene expression, respectively.

Sequence the Genes Encoding TMABaldehyde-DH and TMA-Butanol-DH

Choromosomal DNA was prepared from Pseudomonas sp. 13CM using the method of Saito and Miura (1963). The primers aldeNF, aldeR, alcoNF, alcoNR, and alcoR (Table1) were designed on the basis of N-terminal amino acid sequences of TMABaldehyde-DH and TMA-Butanol-DH from Pseudomonas sp. 13CM (Hassan et al., 2007, 2008) and from Pseudomonas putida-GB-1 genes (locus ID: B0KJD3, B0KJD2). The coding region was amplified using standard PCR method. PCR products were sequenced using the dideoxy chain-termination method (Sanger et al., 1977). The inverse PCR primers alde2F, alde2R, alco3F and alco3R (Table 1) were designed based on inverted repeats border sequences. The inverse PCR was performed to determine the nucleotide sequence of the regions upstream and downstream of the TMABaldehyde-DH and TMA- Butanol-DH gene (Ochman et al., 1988).

Construction of Expression Vector for TMABaldehyde- DH

The T7 promoter over-expression system of E. coli was used for TMABaldehyde-DH production. A DNA fragment containing the structural gene encoding TMABaldehyde- DH of Pseudomonas sp. 13CM was amplified by PCR using the primer pair 13CM_aldeF and 13CM_aldeR and thereby incorporating the 5'-NdeI and 3'-HindIII restriction sites (Table 1). The PCR product was digested with the appropriate restriction enzymes, alongside the relevant vectors; gel purified and then ligated using T4 DNA ligase. Resulting ligation mixture was then transformed into the E. coli JM109 cells. Colonies were screened for recombinant using standard plasmid DNA isolation techniques and retransformed into E. coli BL21 (DE3) for small-scale protein expression tests.

Over-expression and Purification of Recombinant TMABaldehyde-DH

Expression of recombinant TMABaldehyde-DH was induced with 0.3 mM isopropyl-b-D-thiogalactopyranoside (IPTG) at 25oC. After 16 h of cultivation, cells were harvested by centrifugation at 14000 x g for 20 min at 4oC and washed twice with 0.85 (Percent) KCl solution, stored at -20oC until protein purification. Purification of recombinant TMABaldehyde-DH was performed by hydrophobic chromatography using Phenyl-Toyopearl spin column. For this, cells were resuspended in 50 mM potassium phosphate buffer (pH 7.5) containing 1 mM DTT and disrupted at 4 oC by sonic treatment and centrifuged. To the cell free extract, same volume of 0.5 M of ammonium sulfate solution in the 50 mM potassium phosphate buffer (pH 7.5) containing 1 mM DTT was added.

The resulting solution was loaded onto a Phenyl-Toyopearl spin column equilibrated with the same buffer which contained 0.25 M of ammonium sulfate and desalted through repeated concentration or dilution against low salt buffer (50 mM potassium phosphate buffer, pH 7.5 containing 1 mM DTT). The protein concentration was determined using the Lowry method (Lowry, 1951) with bovine serum albumin as the standard or by the absorbance at 280 nm, where an E1cm value of 10.0 was used. Specific activity was defined as units of enzyme activity per mg protein.

Enzyme Activity Assay

The routine assay of TMABaldehyde-DH was performed at 30oC by monitoring the increase in absorbance at 340 nm. The reaction mixture (1.5 mL) in a cuvette contained 150 mM glycine-NaOH buffer (pH 9.5), 3.0 mM of NAD+ and an appropriate amount of the enzyme. The enzyme reaction was initiated by the addition of the TMABaldehyde iodide at a final concentration of 0.8 mM. One unit of enzyme activity was defined as the amount of enzyme that catalyzes the production of 1 (Mu)mol of NADH per min under the assay conditions. A molar absorption coefficient 6,200 M-1 for NADH was used in the calculation Polyacrylamide Gel Electrophoresis Native PAGE was performed using 10 (Percent) gels at pH 8.8 and that gels were run at 4oC. The protein was stained with Coomasie brilliant blue R-250 or checked for enzyme activity at room temperature.

For the activity staining, immediately after electrophoresis, gels were incubated at room temperature for 15 min and placed in the reaction mixture which contained 150 mM of glycine-NaOH buffer (pH 9.5), 0.064 mM of 1-methoxy phenazine methosulfate,0.24 mM of nitroblue tetrazolium, 0.12 mM of TMABaldehyde, and 3 mM of NAD+. SDS-PAGE was performed following the method of Laemmli (1970) at room temperature using the mini slab size 5-20 (Percent) gradient polyacrylamide gels purchased from Atto (Tokyo, Japan).

Table 1: PCR primer sequences used for sequencing of the Pseudomonas sp. 13CM TMABaldehyde-DH and TMA-Butanol-DH genes and expression vector construction

Primer###Direction###Sequence (5-3)###Tm

aldeNF###Forward###CCSCARCTSAGRGAYGCSGCSTAYTGG###68.1

aldeR###Reverse###AGSACSGGSCCGAAGATYTCYTC###61.4

alcoNF###Forward###ATGATYGAYAAYCTSTCSCCSCT###56.5

alcoNR###Reverse###AGSGGSGASAGRTTRTCRATCA###54.5

alcoR###Reverse###TCSGCSCCSGTSCCSGCSGTSGT###69.3

alde2F###Forward###CCTTCTGGTCAGCCGACCTCGG###75.0

alde2R###Reverse###GTCCACGTCAGGCTCACGGC###72.8

alco3F###Forward###CCTGGTGGCCCGGCAGAC###73.8

alco3R###Reverse###TGCCACTCGCGGAACGTCG###75.3

al3CMaldeF###Forward###GAGGGGATGCATATGCCGCAACTCAG###64.3

b13CM aldeR###Reverse###ACAGGGGGGAAGCTTGTCAATCACG###62.9

aNdel site (underlined); nHindIII site (underlined)

The purified enzyme samples were prepared for SDS- PAGE by mixing with an equal volume of 2x EzApply sample buffer (Atto, Tokyo, Japan) and boiled for 5 min before use. Gels were stained with Coomasie brilliant blue R-250.

Measurement of Molecular Mass

The molecular mass of purified enzyme was estimated by SDS-PAGE and gel filtration on a TSK-gel G3000SW column (0.78 x 30 cm) (Tosoh Corp., Tokyo, Japan) equilibrated with 50 mM potassium phosphate buffer (pH 7.5) containing 1 mM DTT at a flow rate of 0.5 mL min-1.

Approximate 42 mg of protein was loaded. The fraction (0.5 mL each) was quantified by absorption 280 nm and by assaying the enzymatic activity.

Results

Amino acid Sequence of TMABaldehyde-DH and TMA-Butanol-DH

The N-terminal amino acid sequences of TMABaldehyde-DH and TMA-Butanol-DH of Pseudomonas sp. 13CM had the similarity with, respectively, aldehyde dehydrogenase (B0KJD3) and iron containing alcohol dehydrogenase (B0KJD2) of Pseudomonas putida GB-1. Therefore, we assumed that both DHs obtained were the homologous with the enzymes of Pseudomonas putida GB-1. Using the inverse PCR technique, we obtained gene containing two Open Reading Frames (ORFs) coding for a 496 and 394 amino acids polypeptide chain for TMABaldehyde-DH and TMA-Butanol-DH, resepectively (Fig. 1). The deduced primary structure from ORF1 and ORF2 were completely matched with the N-terminus from Pseudomonas sp. 13 CM, respectively TMAbaldehyde-DH and TMA-Butanol-DH, analyzed previously (Hassan et al., 2007, 2008) by Edman degradation. The deduced amino acid sequences from Pseudomonas sp. 13CM were compared with other protein sequences.

Database analysis revealed that the primary structure of protein encoded in ORF1 and ORF2 showed high similarity with aldehyde dehydrogenase and iron containing alcohol dehydrogenase of P. putida GB-1 (Fig. 2). ORF1 (TMABaldehyde-DH), which encodes 496 amino acids also shares identity with betaine aldehyde dehydrgenase of Pseudomonas aeruginosa, TMABaldehyde-DH of rat liver (Fig. 2). Interestingly, g- glutamyl-g-aminobutyraldehyde dehydrogenase, which is responsible for oxidation of g-glutamyl-g-aminobutyraldehyde into g-glutamyl-g-aminobutyrate in putrescene utilization pathway of E. coli K-12 also showed a considerable positional identity to TMABaldehyde-DH of Pseudomonas sp. 13CM (Fig. 2).

Over-expression and Purification of Recombinant TMABaldehyde-DH

To clarify the function and role of Pseudomonas sp. 13CM TMABaldehyde-DH, we constructed the expression vector for production of TMABaldehyde-DH as described in Materials and Methods section. Upon induction with IPTG, recombinant TMABaldehyde-DH was expressed at 25oC. The expressed enzyme was partially purified by hydrophobic chromatography using Phenyl-Toyopearl spin column giving a preparation with a specific activity at 30.97 unit mg-1. The purified recombinant TMABaldehyde-DH appeared as single protein band on native PAGE and the enzyme activity was detected at the same position on the gel, additionally, moved as a single protein band with SDS- PAGE at around 55 kDa (Fig. 3). The molecular mass of the native enzyme was estimated by gel filtration on a TSK-Gel G3000SW column. The enzyme was eluted at a molecular mass of about 160 kDa (Fig. 4).

Substrate Specificity and Kinetic Assay

The recombinant TMABaldehyde-DH was very specific for NAD+ and did not react with NADP+. The enzyme oxidized TMABaldehyde iodide and DMABaldehyde iodide. No reduction reaction was observed. The enzyme showed no activity towards 4-aminobutyraldehyde, betainealdehyde, acetaldehyde, propionaldehyde, butyraldehyde, isovaleraldehyde and pivaleraldehyde. The apparent Km values for TMABaldehyde iodide, DMABaldehyde iodide and NAD+ were calculated to be 0.12, 0.07, and 0.15 mM, respectively.

Accession Numbers

The entire nucleotide sequence data reported in this article encoding the TMABaldehyde-DH and TMA-Butanol-DH genes have been deposited in the DDBJ database under the accession numbers AB741624 and AB741625, respectively.

Discussion

We disclosed an enzymatic reduction system composed of both TMA-Butanol-DH and TMABaldehyde-DH for the degradation of choline like structure 4-N- trimethylaminobutanol within the same organism, Pseudomonas sp. 13CM (Hassan et al., 2007, 2008). Recently, the microorganisms, degrading homocholine as the only source of carbon and nitrogen have been isolated in our laboratory and proposed a possible degradation pathway (Mohamed Ahmed et al., 2009a, b and 2010). The genes encoding the enzymes TMABaldehyde-DH and TMA-Butanol-DH of Pseudomonas sp. 13CM remained unknown. In this study, we sequenced the genes and constructed the recombinant TMABaldehyde-DH, first report of bacterial enzymes; mediate the L-carnitine biosynthetic reactions. The specific activity of 30.97 unit mg-1 in the present preparation showed the activity more than two times of TMABaldehyde-DH isolated from the cells of Pseudomonas sp. 13CM, 12.4 unit mg-1 (Hassan et al., 2008).

It also higher than those for TMABaldehyde-DH from Bos taurus (Hulse and Henderson, 1980) and Rattus norvegicus (Vaz et al., 2000), respectively, 5.1 unit mg-1 and 0.77 unit mg-1. The deduced amino acid sequence of TMABaldehyde-DH and TMA-Butanol-DH were respectively, similar to those of aldehyde dehydrogenase and alcohol dehydrogenase superfamily proteins. In particular, both of the enzymes have high similarity to proteins from P. putida GB-1(B0KJD3, B0KJD2) (Fig. 2). It uncovers the facts that the function of both enzymes of Pseudomonas putida GB-1, function as oxidization of quaternary ammonium compounds.

The deduced amino acid sequences (Fig. 1) and calculated molecular mass of TMABaldehyde-DH (53030.91 Da) and TMA-Butanol-DH (42090.94 Da), are in good agreement with that of the partial amino acid sequences and electrophoresis data described by Hassan et al. (2007, 2008). In addition, the present preparation of TMABaldehyde-DH, moved as a single protein band with SDS-PAGE at around 55 kDa (Fig. 3), which is in accordance with the theoretical monomeric molecular mass of the TMABaldehyde-DH. The molecular mass of the over-expressed TMABaldehyde-DH of Pseudomonas sp.

13CM is found to be 160 kDa by gel filtration (Fig. 4) suggesting that the protein existed in trimer in solution under native condition, which is similar to the molecular mass of TMABaldehyde-DH of B. taurus (Hulse and Henderson, 1980) and the same to the predicted molecular mass of TMABaldehyde-DH from R. norvegicus (Vaz et al., 2000).

In full agreement with Hassan et al. (2008), the recombinant enzyme showed oxidative activity toward only TMABaldehyde and no aldehyde produced by the reversible reaction. The recombinant protein in this study gave a Km value of 0.12 mM for TMABaldehyde is appeared to be higher than the Km values for TMABaldehyde-DHs from Pseudomonas sp. 13CM (Hassan et al., 2008), B. taurus (Hulse and Henderson, 1980), R. norvegicus (Vaz et al.,2000), respectively, 7.4, 4.2 and 1.4 mM. Both NAD+ and NADP+ can be used as coenzyme in R. norvegicus (Vaz etal., 2000), but the enzyme of B. taurus (Hulse and Henderson, 1980) and the enzymes purified from Pseudomonas sp. 13CM were highly specific only for NAD+. In conclusion, molecular cloning with Pseudomonas sp. 13CM as a gene donor led to the production of a large quantity of the enzyme in a recombinant strain.

Characterization of degradative genes, may explore to evaluate the microbial populations optimal for biodegradation and bioremediation technologies. Currently, further investigation is in progress to incorporate novel enzyme-cofactor interactions.

References

Abee, T., R. Palmen, K.J. Hellingwerf and W.N. Konings, 1990. Osmoregulation in Rhodobacter sphaeroides. J. Bacteriol., 172:149-154

An, H., H. Park and E. Kim, 2001. Cloning and expression of thermophilic catechol 1,2 dioxygenase gene (cat A) from Streptomyces setonii. FEMS. Microbiol. Lett., 195: 17-22

Annamalai, T. and K. Venkitanarayanan, 2009. Role of proP and proU in betaine uptake by Yersinia enterocolitica under cold and osmotic stress conditions. Appl. Environ. Microbiol., 75: 1471-1477

Boch, J., B. Kempf and E. Bremer, 1994. Osmoregulation in Bacillus subtilis: synthesis of the osmoprotectant glycine betaine from exogenously provided choline. J. Bacteriol., 176: 5364-5371

Cheong, T. and P. Oriel, 2000. Cloning of a wide spectrum amidase from Bacillus stearothermophilus BR 388 in E. coli and marked enhancement of amidase expression using directed evolution. Enzyme. Microb. Technol., 26: 152-158

Comlekcioglu, U., E. Ozkose, A. Tutus, I. Akyol and M.S. Ekinci, 2010. Cloning and characterization of cellulase and xylanase coding genes from anaerobic fungus Neocallimastix sp. GMLF1. Int. J. Agric. Biol., 12: 691-696

Hassan, M., S. Morimoto, H. Murakami, T. Ichiyanagi and N. Mori, 2007. Purification and characterization of 4-N-trimethylamino-1-butanol dehydrogenase of Pseudomonas sp. 13CM. Biosci. Biotechnol. Biochem., 71: 1439-1446

Hassan, M., M. Okada, T. Ichiyanagi and N. Mori, 2008. 4-N-trimethylaminobutyraldehyde dehydrogenase: purification and characterization of an enzyme from Pseudomonas sp. 13CM. Biosci. Biotechnol. Biochem., 72: 155-162

Hulse, J.D., S.R. Ellis and L.M. Henderson, 1978. Carnitine biosynthesis: b-Hydroxylation of trimethyllysine by an a-ketoglutarate-dependent mitochondrial dioxygenase. J. Biol. Chem., 253: 1654-1659

Hulse, J.D. and L.M. Henderson, 1980. Carnitine biosynthesis: Purification of 4-N'-trimethylaminobutyraldehyde dehydrogenase from beef liver. J. Biol. Chem., 255: 1146-115

Ibrahim, M.K., 2003. Cloning and nucleotide sequence of catechol 2,3-dioxygenase. gene from the naphthalene-degrading Pseudomonas putida NA3. Int. J. Agric. Biol., 5: 423-427

Ikuta, S., S. Imamura, H. Misaki and Y. Horiuchi, 1977. Purification and characterization of choline oxidase from Arthrobacter globiformis. J.Biochem., 82: 1741-1749

Kleber, P.H., 1997. Bacterial carnitine metabolism. FEMS. Microbiol. Lett.,147: 1-9

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685

Lowry, O.H., N.J. Rosebrough, A.L. Farr and R.J. Randall, 1951. Protein Measurement with Folin Phenol Reagent. J. Biol. Chem., 193: 265-275

Mohamed Ahmed, I.A., J. Arima, T. Ichiyanagi, E. Sakuno and N. Mori, 2009a. Isolation and characterization of 3-N-trimethylamino-1- propanol degrading Arthrobacter sp. strain E5. Res. J. Microbiol., 4:49-58

Mohamed Ahmed, I.A., J. Arima, T. Ichiyanagi, E. Sakuno and N. Mori, 2009b. Isolation and characterization of 3-N-trimethylamino-1- propanol degrading Rhodococcus sp. strain A2. FEMS. Microbiol. Lett., 296: 219-225

Mohamed Ahmed, I.A., J. Arima, T. Ichiyanagi, E. Sakuno and N. Mori, 2010. Isolation and characterization of homocholine-degrading Pseudomonas sp. strains A9 and B9b. World J. Microbiol. Biotechnol., 26: 1455-1464

Mori, N., B. Kawakami, K. Hyakutome, Y. Tani and Y. Yamada, 1980. Characterization of betaine aldehyde dehydrogenase from Cylindrocarpon didymum M-1. Agric. Biol. Chem., 44: 3015-3016

Mori, N., N. Yoshida and Y. Kitamoto, 1992. Purification and properties of betaine aldehyde dehydrogenase from Xanthomonas translucens. J.Ferment. Bioeng., 73: 352-356

Mori, N., S. Fuchigami and Y. Kitamoto, 2002. Purification and properties of betaine aldehyde dehydrogenase with high affinity for NADP from Arthrobacter globiformis. J. Biosci. Bioeng., 93: 130-135

Nagasawa, T., Y. Kawabata, Y. Tani and K. Ogata, 1976. Purification and characterization of betaine aldehyde dehydrogenase from Pseudomonas aeruginosa A-16. Agric. Biol. Chem., 40: 1743-1749

Ochman, H., A.S. Gerber and D.L. Hartl, 1988. Genetic applications of an inverse polymerase chain reaction. Genetics, 120: 621-623

Robert, H., C. Le Marrec, C. Blanco and M. Jebbar, 2000. Glycine betaine, carnitine and choline enhance salinity tolerance and prevent the accumulation of sodium to a level inhibiting growth of Tetragenococcus halophila. Appl. Environ. Microbiol., 66: 509-517

Roberts, M.F., 2005. Organic compatible solutes of halotolerant and halophilic microorganisms. Saline Syst., 1: 1-30

Sanger, F., S. Nicklen, and A.R. Coulson, 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci., 74: 5463-5467

Saito, H. and K. Miura, 1963. Preparation of transforming deoxyribonucleic acid by phenol treatment. Biochim. Biophys. Acta, 72: 619-629

Smith, L.T., J.A. Pocard, T. Bernard and D. Le Rudulier, 1988. Osmotic control of the glycine betaine biosynthesis and degradation in Rhizobium meliloti. J. Bacteriol., 170: 3142-3149

Vaz, F.M., S.W. Fouchier, R. Ofman, M. Sommer and R.J.A. Wanders, 2000. Molecular and biochemical characterization of rat g- trimethylaminobutyraldehyde dehydrogenase and evidence for the involvement of human aldehyde dehydrogenase 9 in carnitine biosynthesis. J. Biol. Chem., 275: 7390-7394

For correspondence: mrbari81@yahoo.com

To cite this paper: Bari, M.R., N. Akai, J. Arima and N. Mori, 2013. Evaluation of genes encoding 4-N-trimethylaminobutyraldehyde dehydrogenase and 4- N-trimethylamino-1-butanol dehydrogenase from Pseudomonas sp. 13CM. Int. J. Agric. Biol., 15: 238-244
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Bari, Rezaul; Akai, Naoki; Arima, Jiro; Mori, Nobuhiro
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9JAPA
Date:Apr 30, 2013
Words:3330
Previous Article:Supplementary Effects of Saccharomyces boulardii and Bacillus subtilis B10 on Digestive Enzyme Activities, Antioxidation Capacity and Blood...
Next Article:Effects of Carboxyl Methyl Cellulose and Edible Cow Gelatin on Physico-chemical, Textural and Sensory Properties of Yoghurt.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters