Printer Friendly

Evaluacion de la baciloscopia, cultivo y reaccion en cadena de la polimerasa para el diagnostico de tuberculosis pulmonary.

Resumen

La utilidad de la baciloscopia, cultivo y la Reaccion en Cadena de la Polimerasa (RCP) fue evaluada en 31 muestras de esputo, provenientes de pacientes de ambos sexos, sin distincion de grupo etnico y edades comprendidas entre los 17 Y 80 anos, con manifestaciones clinicas, hallazgos radiologicos y/o datos epidemiologicos sugestivos de tuberculosis pulmonar. A todas las muestras, se les practico baciloscopia utilizando la tecnica de coloracion de Ziehl- Neelsen. Se utilizo el medio de cultivo Ogawa-Kudoh como estandar. Los objetivos para el ensayo de RCP fueron los genes que codifican la proteina de 32-KDa. y la secuencia de insercion IS6110. Luego de la amplificacion, se obtuvo un fragmento de 984 pares de bases correspondiente a la secuencia de insercion IS6110 y otro de 506 pares, correspondiente al antigeno alfa 32-KDa. Del total de muestras examinadas por el metodo de Ziehl-Neelsen, 19 resultaron positivas y 12 resultaron negativas (61,29 y 38,71% respectivamente). De las 31 muestras sembradas 19 (61,29%) resultaron positivas y 12 (38,71%) fueron negativas al cultivo. De todas las muestras amplificadas, 22 (70,96%) mostraron la presencia de fragmentos de ADN correspondientes tanto a la secuencia de insercion IS6110, como al antigeno alfa 32 KDa., mientras que en 9 (2%04%) no se detecto la presencia de ADN micobacteriano por el metodo de RCP. La sensibilidad de la prueba RCP fue virtualmente de 100% y su especificidad fue del 75%. Se demostro que el RCP, basado en la amplificacion simultanea del elemento de insercion IS6110 y del gen que codifica el antigeno alfa en un solo paso, puede identificar infecciones por micobacterias a partir de muestras de esputo. Se concluye que esta tecnica es mas sensible que los procedimientos bacteriologicos de rutina (examen directo y cultivo) y la convierten en una herramienta muy poderosa para el diagnostico de tuberculosis pulmonar y otras enfermedades micobacterianas.

Palabras clave: Tuberculosis, RCP, Examen directo, cultivo.

Evaluation of Baciloscopy, Cultivation and Polimerasa Chain Reaction for the Diagnostic of Lung Tuberculosis

Abstract

The utility of baciloscopy, cultivation and Polimerasa Chain Reaction of (PCR) was evaluated in 31 sputum samples, of patient of both sexes, without distinction of etnial grup and ages between 17 and 80 years, with clinical manifestations, discoveries radiological and/or suggestive epidemic data of lung tuberculosis. To all the samples they were practiced baciloscopy using the technique of Ziehl-Neelsen. The Ogawa-Kudoh cultivation was used like standard. The objectives for the rehearsal of PCR were the genes that code the protein 32-KDa (alpha antigen) and the insertion sequence IS6110. After the amplification was obtained a fragment of 984 couples of bases corresponding to the sequence of insert IS6110 and another of 506 couples corresponding to the alpha antigen. Of the total of samples examined by the Ziehl-Neelsen method, 19 were positive and 12 were negative (61.29 and 38.71% respectively). 19 samples (61.29%) were positive and 12 (38.71%) were negative to the cultivation. Of all amplified samples, 22 (70.69%) showed the presence of fragments corresponding to DNA so much to the sequence of insert IS6110 like the antigen alpha 32-KDa, while in 9 (20.04%) presence of DNA mycobacterium was not detected for RCP method. The sensibility of the RCP test was virtually 100% and its specificity was of 100%. It was demonstrated that RCP, based on the simultaneous amplification of the insertion element IS6110 and the gene that codes the alpha antigen in a single step, can identify mycobacterium infections. We conclude also that is more sensitive that routine bacteriological procedures (direct exam and cultivation) and can be a very powerful tool for the diagnosis of lung tuberculosis and other mycobacterium diseases.

Key words: Tuberculosis, RCP, direct exam, cultivation.

Introduccion

El descubrimiento de la quimioterapia efectiva para erradicar la tisis (nombre por el cual se conocio durante mucho tiempo la enfermedad) trajo consigo la creencia que la tuberculosis seria facilmente erradicable. Sin embargo, el tiempo se encargo de demostrar lo contrario y la conjuncion de factores psicosociales, epidemiologicos, administrativos, operativos han permitido que la tuberculosis continue y se baila transformado, actualmente, en una verdadera plaga para el hombre (1).

La Tuberculosis es una de las enfermedades infecciosas que mata a mas personas en el mundo entero. La mortalidad mundial por tuberculosis es aproximadamente de 2 millones de personas por ano (2).

La OMS ha estimado que entre el ano 2000 y el 2020, 200 millones de personas enfermaran y 35 millones moriran de tuberculosis si no se hace un riguroso control. Alrededor de 8 millones de personas en todo el mundo, enferma de tuberculosis cada ano (2, 3).

Los datos obtenidos por la OMS permiten hacer las siguientes afirmaciones:

* Cada segundo una persona es infectada por primera vez por el bacilo tuberculoso.

* Cerca del 1% de la poblacion mundial es infectada por primera vez por el bacilo tuberculoso cada ano.

* Un tercio de la poblacion mundial esta actualmente infectada por el bacilo tuberculoso.

* Del 5 al 10% de las personas infectadas con el bacilo tuberculoso (pero no infectado con HIV) enfermaran de tuberculosis en algun momento de su vida (3).

Para el ano 2002 se produjeron cerca de 2 millones de muertes por tuberculosis en todo el mundo, siendo la region del sur-este asiatico quien aporto la mayor proporcion con 625 mil, seguida por la region africana con 556 mil. Las Americas aportaron aproximadamente 6 mil muertes por tuberculosis (3).

La pandemia del VIH ha traido un gran impacto en la epidemiologia de la tuberculosis. Para finales del ano 2000, aproximadamente 12 millones de las 36 millones de personas infectadas con el VIH en todo el mundo, tenian coinfeccion con M. tuberculosis y 8.4 millones (70%) de esos coinfectados, viven en la region del Africa Subsahariana (4). La infeccion por VIH incrementa 40% el riesgo de conversion de infeccion a enfermedad (4,5) Y por lo tanto tambien incrementa la transmision de la tuberculosis a la poblacion general. La tuberculosis es responsable de aproximadamente el 15% de las muertes por SIDA en todo el mundo (4).

El problema se combina con la emergencia de cepas de M. tuberculosis resistentes a las drogas actualmente usadas, principalmente a la Isoniazida y a la Rifampieina, las dos drogas antituberculosas mas potentes, originando cepas multirresistentes, las cuales han alcanzado proporciones alarmantes en algunos paises, especialmente en al antigua Union Sovietica (5, 6).

El problema diagnostico de la Tuberculosis

El diagnostico clinico de la tuberculosis es dificil de establecer. A tal punto que muchos autores la han catalogado como "la gran simuladora" (1), presentandose muchas veces bajo la forma de cuadros clinico--radiologicos completamente atipicos e inusuales, que desconciertan al medico en cuanto a la orientacion diagnostica. Por lo tanto los hallazgos clinicos y radiologicos que se observan en los pacientes tuberculosos, no aportan siempre datos patognomonicos que permitan su diagnostico (1).

El diagnostico bacteriologico de la tuberculosis no esta exento de errores: la baciloseopia, a traves del examen directo de la muestra y coloracion con la tecnica de Ziehl-Neelsen, no es 100% confiable, pues el bacilo no siempre es detectado en las muestras clinicas examinadas. La microscopia, utilizando la tecnica de coloracion de Ziehl--Neelsen, es rapida, economica y sencilla. La sensibilidad deja mucho que desear, varia dependiendo del tipo de muestra y la micobacteria involucrada, ya que como regla deben existir entre cinco mil a diez mil bacilos por ml. de expectoracion para que tengan un 50% de posibilidades de ser detectados al microscopio; solo cuando el numero de bacilos alcanza a mas de 100.000 por ml. de expectoracion, podemos esperar que las baciloscopias sean consistentemente positivas (7). Utilizando la tincion fluorescente, este numero puede ser tan bajo como 1.000 bacilos por mL (7, 8).

Ademas la presencia de bacilos acido alcohol resistentes en el examen directo de muestras clinicas, no siempre garantiza que se trate de un bacilo tuberculoso, pues puede tratarse de una micobacteria atipica o de otro microorganismo que comparta la caracteristica de acido alcohol resistencia (M. leprae, Actinomyces, Nocardia). Esto puede ocasionar graves problemas diagnosticos y terapeuticos. El rango de sensibilidad de la baciloscopia, oscila entre 50--80% yla especificidad es virtualmente del 100% (7).

El cultivo. Al lado de la baciloscopia, el diagnostico bacteriologico de la tuberculosis, debe complementarse con el cultivo. El cultivo es una tecnica que tiene mayor sensibilidad (70-90%), ya que basta que existan mas de 10 bacilos/ ml., en muestras digeridas y concentradas, para que sea positivo. Recordemos que la baciloscopia solo utiliza 0,01 ml. de la muestra, efectuando un extendido de unos 10.000 campos microscopicos, de los cuales en el mejor de los casos, solo se leen 100 a 200 campos; en cambio, los cultivos procesan 0,1 ml. de expectoracion (8).

El aislamiento de las micobacterias por cultivo es entorpecido por su lento crecimiento. Un promedio de incubacion de 4 semanas en medios convencionales se requiere antes que pueda ser detectado crecimiento. Los metodos de identificacion convencionales despues del cultivo incluyen determinacion de la velocidad de crecimiento, crecimiento a diferentes temperaturas, morfologia de la colonia, produccion de pigmentos y susceptibilidad a los agentes. De tal manera que en casos en los que se requiera una toma de decisiones rapidas para instaurar una terapeutica efectiva su valor es muy limitado (7, 8).

Se han hecho muchos intentos para mejorar los metodos de cultivo del bacilo tuberculoso, de modo que se pueda disponer de sus resultados en plazos mas breves. Las tecnicas mas utiles a este respecto parecen ser las radiometricas, que permiten hacer el diagnostico de muchas infecciones bacterianas en pocas horas y de la tuberculosis en pocos dias. Ademas, tienen una mayor sensibilidad que los metodos bacteriologicos tradicionales. Se han descrito metodos de cultivo mas rapidos como: El metodo radiometrico BACTEC, el sistema ESP Myco, el sistema MB/BacT Alert, el sistema de tubo MGIT, el sistema Septi-Chek AFB, la deteccion de microcolonias en medios solidos (9-15). Desafortunadamente tales pruebas son costosas en su inicio, requieren de personal altamente calificado y su sensibilidad y especincidad son muy variables de uno a otro laboratorio. Por lo tanto no estan disponibles en todos los paises en vias de desarrollo.

Por lo tanto, las tecnicas bacteriologicas tradicionales de laboratorio (baciloscopia y cultivo), a pesar que tienen una buena sensibilidad y especificidad, no son lo suficientemente utiles cuando se requiere de un diagnostico precoz y especifico (formas extrapulmonares, primoinfeccion tuberculosa en ninos, formas cerradas, infeccion micobacteriana en pacientes VIH).

Las Tecnicas de Biologia Molecular: De las tecnicas de biologia molecular, la amplificacion de acidos nucleicos como la Reaccion en Cadena de la Polimerasa (RCP) es una tecnica muy util para el diagnostico bacteriologico de la tuberculosis, pues permite un diagnostico rapido, sensible y especifico, a traves de la identificacion del ADN o ARN presente en las muestras clinicas, pudiendo despejar los problemas derivados de los procedimientos habituales de laboratorio (13).

Los resultados del RCP igual que los de la microscopia, pueden ser obtenidos 24 horas despues de recibir la muestra. La especificidad y sensibilidad excede a la de la micros copia. Estudios han reportado sensibilidades entre 74-91% y especificidades entre 95-100% (14).

Se han descrito muchos ensayos de RCP para la detectacion de bacterias del Complejo M. tuberculosis. Existen dos metodos basados en la amplificacion de acidos nucleicos aprobados por la FDA (Food and Drug Administration) para la deteccion de M. tuberculosis, a partir de muestras respiratorias con baciloscopias positivas. Ellas son la prueba MTD (Amplified Mycobacterium tuberculosis Direct Test) de Gen-Probe[R], San Diego, California; y la prueba AMPLICOR de Roche[R] Diagnostic Systems, Inc., Branchburg, New Jersey (15). En este sentido, la prueba de AMPLICOR desarrollada por Roche Diagnostic Systems[R] ha mostrado ser una herramienta muy util para el diagnostico precoz de tuberculosis, con una sensibilidad y especificidad de 76.4% y 99.8% respectivamente (16-18), no solo a partir de muestras respiratorias sino tambien a partir de muestras de fluidos y tejidos corporales (18).

Se han publicado estudios basados en la amplificacion de muchas secuencias de M. tuberculosis, la secuencias de proteinas de 32 kDa (19), 65 kDa (20). Sin embargo, el objetivo mas comun para la amplificacion es la secuencia de insercion IS6110, la cual solo esta presente en las micobacterias que pertenecen al Complejo M. tuberculosis (17, 20-24).

La IS (secuencia de insercion) IS6110 es un miembro de la familia IS3. Los miembros de esta familia son los grupos de IS bacterianas mas ampliamente extendidas, siendo eneontradas en mas de 24 generos de bacterias Gram positivas y Gram negativas (22). La mayoria de las cepas de M. tuberculosis tienen entre 8 y 15 copias del elemento de insercion IS6110 (22, 25). La especificidad y la naturaleza repetitiva del IS6110 lo hacen un objetivo ideal para la amplificacion por RCP (26).

La secuencia de insercion IS6110 frecuentemente se encuentra en un locus unico en el genoma del complejo M. tuberculosis denominado region "Direct Repeat" (DR) (22). La region DR consiste en secuencias repetitivas de 36pb separadas por espaciadores no repetitivos cuyas longitudes varian de 27 a 41 pb (22, 27). Esta region ha sido completamente secuenciada en M. tuberculosis. La gran mayoria de las cepas contienen uno o mas elementos IS6110 en la region DR.

Herramientas de biologia molecular, tales como Fingerprinting (RFLP: polimorfismo de longitud de fragmentos de restriccion) o la tecnica de Spoligotyping (28, 29) es altamente efectiva para tipificar las micobacterias y determinar los genotipos de los aislamientos clinicos. En tuberculosis humana la tipificacion molecular se logra por el uso de la secuencia de insercion IS6110 (20, 22, 30, 31). En M.bovis, IS6110 es menos util porque el genoma de la mayoria de las cepas contiene solo algunas copias de IS6110 (22, 32). Estudios han indicado que algunas cepas de M. tuberculosis pueden ser mas facilmente transmitidas y ultimadamente, mas exitosas en la produccion de infeccion y/o enfermedad (33).

Para incrementar nuestro conocimiento sobre la biologia del bacilo tuberculoso, se ha determinado la secuencia genomica completa de la cepa mas ampliamente utilizada, H37Rv (34). Analisis de bioinformatica han llevado a la identificacion de aproximadamente 4.000 genes en la secuencia genomica de 4.41 Mb y han provisto un gran aporte al desarrollo de la bioquimica, genetica e inmunologia de esta temida bacteria. La informacion de la secuencia genetica de esta cepa esta centralizada en TubercuList (http://www.pasteur.fr/Biol/Tu bercuList/) (34).

La gran ventaja de las reacciones de amplificacion de acidos nucleicos, sobre el cultivo es la velocidad con la cual el diagnostico puede ser hecho. A diferencia de la microscopia, el Mycobacterium infectante puede ser directamente identificado.

Materiales y Metodos

Poblacion

Se procesaron 31 muestras de esputo, de pacientes de ambos sexos, sin distincion de grupo etnico y edades comprendidas entre los 17 Y 80 anos, con manifestaciones clinicas, hallazgos radiologicos y/o datos epidemiologicos sugestivos de tuberculosis pulmonar. Las mismas se obtuvieron de individuos procedentes del area de hospitalizacion de Neumonologia y de la consulta de tisiologia del Hospital General del Sur de Maracaibo, el cual es Centro de Referencia Regional para el diagnostico de esta enfermedad. Se excluyeron de este estudio individuos con diagnostico establecido de tuberculosis o que esten recibiendo quimioterapia o profilaxia anti TBC.

Metodologia

1. Examen directo: A todas las muestras, se les practico examen microscopico directo (baciloscopia) utilizando la tecnica de coloracion de Ziehl-Neelsen. Para lo cual se tomo como referencia el Servicio de bacteriologia del laboratorio del Hospital General del Sur de Maracaibo.

2. Cultivo: Se utilizo el medio de cultivo Ogawa-Kudoh como estandar para la siembra de las muestras de esputo. La siembra se realizo en el Laboratorio de HLA e Inmunogenetica del Banco de Sangre de Maracaibo, en una campana de flujo laminar y utilizando el procedimiento de descontaminacion de la muestra por el metodo de Kudoh. (35, 36).

Los cultivos se incubaron a 37 grados centigrados en estufa de incubacion (Precision Scientific C.O) y con las tapas ligeramente flojas los dos primeros dias y luego se cerraron.

Los cultivos se revisaron a los 4, 8,15, 30 y 60 dias y se hicieron registros de tiempo de crecimiento de los mismos.

No se practico analisis e identificacion bioquimica de los cultivos obtenidos.

3. Obtencion de ADN a partir de esputo: Tanto la extraccion del ADN como la amplificacion del mismo, se practico en el Laboratorio de HLA, Inmunologia y Genetica del Banco de Sangre del Estado Zulia. Las muestras fueron digeridas por el metodo N-acetil-L-cistedna-NaOH y concentradas por centrifugacion. El ADN fue aislado de 1 mi de esputo por el metodo fenol-cloroformo (37).

4. Reaccion en Cadena de la Polimerasa (RCP): Los objetivos para el ensayo de RCP fueron los genes que codifican el antigeno de 32-KDa (19) y la secuencia de insercion IS6110 (24). Para la amplificacion del elemento de insercion IS6110, fueron desarrollados primers especificos (IS5 - IS6) utilizando el programa de computacion Oligo version 4.0. (38) IS5 (5'CGGAGACGGTGCGTAAGTGG) e IS6 (5'GATGGACCGCCAGGGCTrGC). Tambien se desarrollaron primers especificos (MT1 y MT2) MT1 (5'TTCCTGACCAGCGAGCrGCCG) y MT2 (5'CCCCAGTACTCCCAGCTGTGC); para amplificar el gen que codifica el antigeno alfa 32-KDa (26) presente en todas las micobacterias descritas. Todas las reacciones se realizaron en un volumen final de 50 [my]l conteniendo 100 ng de ADN purificado, buffer de reaccion 1 X, 2.5 U de Taq polimerasa, 0.2 mM de cada desoxynucleotido trifosfato, 15 pmol de IS5 - IS6, 10 pmol de MT1 - MT2. La reaccion fue llevada a cabo en un termociclador automatizado MJ Researeh Inc. Las muestras fueron desnaturalizadas a 94[grados]C por 5 minutos y se practicaron 35 ciclos de amplificacion. Los ciclos consistieron en desnaturalizacion a 91[grados]C por 1 minuto, alineacion a 61[grados]C por 90 segundos y extension a 72[grados]C por 2 minutos. Con una extension prolongada de 10 minutos a 72[grados]C. Se establecieron controles positivos y controles negativos de la reaccion.

5. Verificacion de la ampliacion: Despues de la amplificacion, 10 [my]l de la mezcla la reaccion fue analizada por electroforesis con gel de agarosa al 1%. Los productos amplificados fueron tenidos con bromuro de ethidio y fueron visualizados por transiluminacion.

Resultados

Microscopia Directa:

De las 31 muestras de esputo examinadas por el metodo de Ziehl-Neelsen, 19 resultaron positivas (BK +) y 12 resultaron negativas (BK -). Lo cual representa un porcentaje de 61,29% y 38,71% respectivamente ( Tabla 1).

Cultivo

Utilizando como estandar el medio de cultivo Ogawa--Kudoh, se sembraron todas las muestras de esputo. De las 31 muestras sembradas 19 (61,29%) resultaron positivas y 12 (38,71%) fueron negativas al cultivo (Tabla 2).

RCP Se observaron fragmentos de 984 pares de bases y 506 pares de bases correspondientes a la secuencia de insercion IS6110 y al antigeno alfa 32 KDa respectivamente en 22 de las 31 muestras amplificadas (Fig. 1).

[FIGURA 1 OMITIR]

En la Tabla 3 se muestran los resultados del RCP. De todas las muestras amplificadas, 22 (70,96%) mostraron la presencia de fragmentos de ADN correspondientes tanto a la secuencia de insercion IS6110, como al antigeno alfa 32 KDa. Mientras que en 9 (29,04%) no se detecto la presencia de ADN micobacteriano por el metodo de RCP.

Cuando se relacionaron los hallazgos obtenidos en la microscopia, cultivo y RCP, se obtuvieron los siguientes resultados plasmados en la Tabla 4.

En nuestro estudio se utilizo como estandar de oro el cultivo para determinar la sensibilidad y especificidad de la pruebas BK y RCP.

Del total de muestras estudiadas, se obtuvo 1 cultivo positivo proveniente de una baciloscopia negativa, el resto de los cultivos positivos (18), tambien fueron positivos a la baciloscopia. Solo se obtuvo un cultivo negativo proveniente de una baciloscopia positiva, el resto de los cultivos negativos (11), tambien fueron negativos a la baciloscopia De esta manera, puede decirse que la sensibilidad del BK es del 94,74%, mientras que la especificad se estima en 91,67%. Tambien es factible concluir que la capacidad predictiva de resultados positivos del BK respecto al cultivo es del 94,74% mientras que la capacidad predictiva de resultados negativos es de 91,67%.

En forma analoga, al relacionar la prueba RCP con respecto al cultivo se tienen los resultados presentados en la Tabla 5.

De las 22 amplificaciones positivas, 3 resultaron negativas al cultivo. Luego se puede concluir que la sensibilidad de la prueba RCP es del 100% y su especificidad es del 75%. Ademas, la capacidad predictiva positiva de la prueba RCP respecto al cultivo es de 86.4% mientras que su capacidad predictiva de resultados negativos es del 100%. A los mismos resultados se llega al relacionar los datos de la prueba RCP y la prueba de cultivo.

Discusion

La Tuberculosis, en los actuales momentos, sigue siendo un problema de salud publica a nivel mundial. Se requiere de un diagnostico precoz y especifico principalmente en las formas extrapulmonares, infeccion tuberculosa en ninos infeccion micobacteriana en pacientes VIH y formas cerradas muy poco baciliferas, en donde la microscopia y el cultivo tienen grandes limitantes. El rango de sensibilidad de la baciloscopia, oscila entre 50 - 80% y la especificidad es virtualmente del 100% (7). El cultivo es una tecnica que tiene mayor sensibilidad (70-90%) (8). El aislamiento de las micobacterias por cultivo es entorpecido por su lento crecimiento. Un promedio de incubacion de 4 semanas en medios convencionales se requiere antes que pueda ser detectado crecimiento. De tal manera que en casos en los que se requiera una toma de decisiones rapidas para instaurar una terapeutica efectiva su valor es muy limitado (7-8).

La RCP ha mostrado ser una herramienta muy util para el diagnostico de tuberculosis. En la actualidad se han desarrollado varios ensayos de RCP, para la deteccion de M. tuberculosis a partir de muestras de esputo mostrando diversos grados de sensibilidad y especificidad (15, 16, 39, 20, 21, 23, 40).

Nosotros realizamos un estudio prospectivo en donde nos propusimos evaluar la utilidad de la RCP para el diagnostico de tuberculosis pulmonar, comparandola con las tecnicas bacteriologicas habituales, como la baciloscopia y el cultivo.

Al analizar los resultados obtenidos entre la baciloseopia y el cultivo, encontramos que la sensibilidad de la baciloseopia fue del 94,74%, mucho mayor que la reportada en los trabajos publicarlos por Gording y colaboradores (7). Esto probablemente sea debido al hecho que los resultados de la baciloscopia dependen sustancialmente de la carga bacilar de la muestra y nuestros pacientes fueron seleccionados previamente por hallazgos clinicos y radiologicos sugestivos de tuberculosis pulmonar, por lo que es de esperar que las baciloscopias sean consistentemente positivas en estos pacientes. El mismo fenomeno se observo en el caso de los cultivos. Apreciamos una baciloscopia positiva con un cultivo negativo. Al estudiar la historia clinica de este paciente (No. 7) nos encontramos que se encontraba recibiendo tratamiento antituberculoso para el momento de la toma de la muestra. Por lo tanto este fenomeno puede deberse a la presencia de bacilos inviables o muertos que son incapaces de crecer en los medios de cultivos. Este paciente igualmente resulto positivo cuando se le practico amplificacion de acidos nucleicos, ya que esta prueba detecta la presencia del ADN micobacteriano.

Encontramos que la sensibilidad de la RCP en nuestro estudio fue del 100% y la especificidad fue del 75%. Sin embargo algunos estudios reportan una sensibilidad relativamente mas baja, como Andersen y cols. (39) Y Cohen y colaboradores (16), quienes encontraron sensibilidades para sus ensayos de RCP de 63 y 73% respectivamente. La RCP es una tecnica que requiere una estandarizacion minuciosa para evitar los problemas de la contaminacion. Estas bajas sensibilidades encontradas por estos autores pudieran explicarse por condiciones suboptimas de la prueba. Los resultados de este estudio pueden compararse con los resultados obtenidos por Shah y colaboradores (18), quienes obtuvieron sensibilidades similares utilizando la prueba Amplicor de Roche.

Cuando comparamos los resultados de la amplificacion de acidos nucleicos con el con el cultivo observamos que la sensibilidad de la PCR fue mayor que las tecnicas bacteriologicas tradicionales. Todos los pacientes con baciloscopias positivas y cultivos positivos, resultaron tambien positivos cuando se aplicaron las tecnicas de amplificacion de acidos nucleicos. En tres pacientes con examen directo y cultivo negativo la RCP fue positiva. Por lo tanto la RCP puede considerarse una herramienta muy util para el diagnostico de tuberculosis pulmonar, con sensibilidades mayores que las pruebas bacteriologicas rutinarias.

Todas las amplificaciones positivas mostraron las bandas correspondientes a las secuencias objetivo: una banda de 506 pares de bases, que corresponde a la secuencia de bases que codifica a la proteina de 32 KDa, el cual esta presente en todas las micobacterias (incluyendo Complejo M. tuberculosis y M. leprae) y que parece ser uno de los principales estimulantes de la respuesta celular y humoral contra las micobacterias (19), y otra banda de 984 pares de bases, que corresponde a los genes que codifican a la secuencia de insercion IS6110, el cual es especifico para el Complejo M. tuberculosis, que incluye el mycobacterium tuberculoso humano y bovino (21-24, 40). Estos resultados coinciden con los realizados por Borremans y colaboradores (19) quienes lograron clonar la secuencia genomica de la proteina de 32 kDa de M. tuberculosis. En el mismo orden de ideas, nuestro estudio concuerda con los resultados alcanzados por Hermans (22), Kox (40), T. D. Mchugh (41), Thierry y colaboradores (24) quienes hallaron que la amplificacion de la secuencia de insercion IS6110, a partir de muestras clinicas, permite identificar infecciones producidas por el Complejo M. tuberculosis, con mucha mayor sensibilidad y especificidad que el examen directo y el cultivo. Sin embargo recientes reportes han demostrado que existen algunas cepas de M. tuberculosis que no poseen la secuencia IS6110 en sus genomas (41,42). Asi, el uso de metodos de RCP basados en IS6110 puede conducir a resultados falsos negativos. Por otra parte, metodos de RCP basados exclusivamente en la secuencia IS6110, no discriminan entre M. tuberculosis y otras micobaeterias del Complejo M. tuberculosis (26,41).

En otras muestras clinicas la RCP ha mostrado resultados variables. En derrame pleural tuberculoso, la RCP tiene una sensibilidad de 20-80% (dependiendo de la secuencia genomica amplificada y el procedimiento utilizado en la extraccion del ADN) y una especificidad de 78-100% (43). Un estudio espanol reciente, demostro un 81% de especificidad y una 98% de sensibilidad para la RCP cuando se utilizo un segmento de 126 pares de bases de M. tuberculosis, en la evaluacion de derrame pleural (44). La RCP es positiva en el 100% de los cultivos positivos de liquido pleural y solo en 30-60% de los cultivos negativos de liquido pleural (43).

En el caso de meningitis tuberculosa, la RCP ha mostrado una sensibilidad del 75% y una especificidad del 94% en liquido cefalorraquideo, cuando se utiliza la IS6110 como objetivo de amplificacion (45, 46)

En el presente estudio, demostramos que el uso de las tecnicas de amplificacion de acidos nucleicos, como la RCP, basadas en la amplificacion simultanea del elemento de insercion IS6110 y del gen que codifica el antigeno alfa en un solo paso puede identificar infecciones por micobacterias a partir de muestras de esputo.

En conclusion, los resultados presentados demuestran que esta tecnica es mas sensible que los procedimientos bacteriologicos de rutina (examen directo y cultivo) y la convierten en una herramienta muy poderosa para el diagnostico de tuberculosis pulmonar y otras enfermedades micobacterianas.

Segun el reporte de MMWR 49(26):593-594,2000 (15), las pruebas de amplificacion de acidos nucleicos indudablemente aumentan la rapidez diagnostica, pero ellas, hasta la actualidad, no reemplazan el examen directo del esputo o el cultivo micobacteriano, esencial para la identificacion del microorganismo (las pruebas de amplificacion solo dan resultados para el Complejo M. tuberculosis), asi como para la realizacion de pruebas de sensibilidad a antimicrobianos. Tampoco reemplazan el juicio clinico. Su especificidad es muy variable entre diferentes laboratorios. Ademas las pruebas de amplificacion de acidos nucleicos frecuentemente permanecen positivas despues que los cultivos se hacen negativos durante la terapia y pueden permanecer positivas incluso despues de finalizar la terapia antituberculosa. Por lo tanto las pruebas de amplificacion de acidos no sustituyen a las pruebas bacteriologicas tradicionales para el diagnostico de la tuberculosis. No se recomienda utilizarlas en forma rutinaria para el diagnostico de la enfermedad, sino dependiendo del contexto clinico, epidemiologico y radiologico del paciente. Parece ser que sus principales aplicaciones se presentan cuando las pruebas bacteriologicas tradicionales no establecen un diagnostico concluyente, en el momento de tomar decisiones terapeuticas inmediatas (meningitis tuberculosas) y en los casos de tuberculosis infantil o asociada a SIDA.

Recibido: 20-09-05 / Aceptado: 16-11-05

Referencias Bibliograficas

(1) Torres C. Tuberculosis y otras micobacteriosis respiratorias. In: Velez H, Rojas W, Borrero J, Restrepo J. Fundamentos de Medicina. Neumologia. 5ta. Edicion. Medellin. Colombia. Editorial CIB 1998. p. 155-86.

(2) Guzman-Perez C, Vargas M. "Does aging modify pulmonary tuberculosis?" Chest; 1999;116: 961-967.

(3) World Health Organization. Fact Sheet No. 104. Revised March 2004.

(4) Pitchenik AE. "Tuberculosis control and the AIDS epidemic in developing countries". Ann Intern Med 1990; 113: 89-90.

(5) Braum MM, Byers RH, Heyward WL et al. "Acquired immunodeficiency syndrome and extra pulmonary tuberculosis in the United States". Arch Intern Med 1990; 150: 1913-1916.

(6) Dooley SW, Jarvis WR, Martone WJ, Snider Jr DE. "Multidrug-resistant tuberculosis". Ann Intern Med 1992; 117: 257-259.

(7) Gording F, Slutkin G. "The validity of acid fast smears in the diagnosis of pulmonary tuberculosis". Arch Path Lab Med 1990; 114: 1025-1027.

(8) Mioner H, Gebre N, Karlsson U et al.. "Diagnosis of pulmonary tuberculosis. Lancet 1994; 344: 127.

(9) Anargyros P, Astill DJS, Lira ISL. "Comparison of improved BACTEC and Lowenstein-Jensen media for culture of mycobacteria from clinical specimens". Clin Microbiol 1990; 28: 1288-1291.

(10) Middlebrook G, Reggiardo Z, Tigertt WD." Automatable radiometric detection of growth of Mycobacterium tuberculosis in selective media". Am Rev Resp Dis 1977; 115:1066-1069.

(11) Sewell DL, Rashad AL, Rourke Jr WJ, Poor SL, McCarthy JAC, Pfaller MA. "Comparison of the Septi-Chek AFB and BACTEC systems and conventional culture for recover of mycobacteria". J Clin Microbiol 1993; 31: 2689-2691.

(12) Welch DF, Guruswamy AP, Sides SJ, Shaw CH, Gilchrist MJR. "Timely culture for mycobacteria with utilizes a microcolony method". J Clin Microbiol 1993; 31: 2178-2184.

(13) Erlich, H. A., ed. PCR Technology: Principles and application for DNA amplification. Stockton. New York.

(14) Wilson St, Mcnerney R, Nye Pm, Godfrey-Fausset PD, Stoker NG, Voller A. "Progress toward a simplified polymerasa chain reaction and its application to diagnosis of tuberculosis". J Clin Microbiol 1993; 31: 776-782.

(15) CDC. "Nucleic acid amplification tests for tuberculosis". 2000 49(26):593-594.

(16) Cohen RA; Muzaffar S; Schwartz D; Bashir S; Luke S; McGartland LP; Kaul K. "Diagnosis of pulmonary tuberculosis using PCR assays on sputum collected within 24 hours of hospital admission". Ara J Respir Crit Care Med 1998;157 (1):156-6.

(17) Linuma Y; Ichiyama S; Yamori S; Oohama J; Takagi N; Hasegawa Y; Shimokata K; Nakashima N. "Diagnostic value of the Amplicor PCR assay for initial diagnosis and assessment of treatment response for pulmonary tuberculosis". Microbiol Immunol 1998;42(4):281-7

(18) Shah S; Miller A; Mastellone A; Kim K; Colaninno P; Hochstein L; D'Amato R. "Rapid diagnosis of tuberculosis in various biopsy and body fluid specimens by the AMPLICOR Mycobacterium tuberculosis polymerase chain reaction test". Chest 1998; 113(5):1190-4

(19) Borremans M; de Wit L; Volckaert G; Ooms J; de Bruyn J; Huygen K; van Vooren JP; Stelandre M; Verhofstadt R; Content J. "Cloning, sequence determination, and expression of a 32-kilodalton-protein gene of Mycobacterium tuberculosis". Infect Immun 1989; Oct; 57(10):3123-30.

(20) Cousins DV, Wilton SD, Francis BR, Gow BL.. "Use of polymerasa chain reaction for rapid diagnosis of tuberculosis". J Clin Microibiol 1992; 30: 255-258.

(21) Eisenach DK, Sifford MD, Cave MD, Bates JH, Crawfort JT., "Detection of Mycobacterium tuberculosis in sputum samples using a polymerasa chain reaction". Am Rev Respir Dis 1991; 144: 1160-1163.

(22) Hermans, P. W., D. van Soolingen, J. W. Dale, A. R. Schuitema, R. A. McAdam, D. Catty, and J. D. van Embden. "Insertion element IS986 from Mycobacterium tuberculosis: a useful tool for diagnosis and epidemiology of tuberculosis". J. Clin. Microbiol 1990; 28:2051-2058.

(23) Kolk AHJ, Schuitema ARJ, Kuijper S et al. "Detection of Mycobacterium tuberculosis in clinical samples by using polymerasa chain reaction and a nonradioactive detection system". J Clin Microbiol 1992.; 30: 2567-2575.

(24) Thierry D, Brisson-Noel A, Vincent-Levy-Frebault V, Nguyen S, Guesdon JL, Giequel B." Characterization of a Mycobacterium tuberculosis insertion sequence IS6110, and its application in diagnosis". J Clin Microbiol 1990; 28: 2668-2673.

(25) McAdam, R. A., P. W. Hermans, D. van Soolingen, Z. F. Zainudin, D. Catty, J. D. A. van Embden, and J. W. Dale. "Characterization of a Mycobacterium tuberculosis insertion sequence belonging to the IS3 family". Mol.Microbiol 1990; 4:1607-1613.

(26) van Embden, J. D. A., M. A. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, et al.. "Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology". J. Clin. Microbiol 1993; 31:406-409.

(27) Groenen PM, Bunschoten AE, van Soolingen D, van Embden JD. "Nature of DNA polymorphism in the direct repeat cluster of Mycobacterium tuberculosis; application for strain differentiation by a novel typing method". Mol Microbiol 1993; Dec; 10(5):1057-65.

(28) Kamerbeek, J., L. Schouls, A. Kolk, M. van Agterveld, D. van Soolingen, S. Kuijper, A. Bunschoten, et al. "Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology". J. Clin. Microbiol 1997; 35:907-914.

(29) Molhuizen, H. O., A. E. Bunschoten, L. M. Schouls, and J. D. A van Embden. "Rapid detection and simultaneous strain differentiation of Mycobacterium tuberculosis complex bacteria by spoligotyping". Methods Mol. Biol 1998; 101:381-394.

(30) Cave, M. D., K. D. Eisenach, G. Templeton, M. Salfinger, G. Mazurek, J. H. Bates, and J. T. Crawford. "Stability of DNA fingerprint pattern produced with IS6110 in strains of Mycobacterium tuberculosis". J. Clin. Microbiol 1994; 32:262-266.

(31) Cave, M. D., K. D. Eisenach, P. F. McDermott, J. H. Bates, and J. T. Crawford. "IS6110: conservation of sequence in the Mycobacterium tuberculosis complex and its utilization in DNA fingerprinting". Mol. Cell. Probes 1991;5:73-80.

(32) Van Soolingen, D., P. E. W. de Haas, J. Haagsma, T. Eger, P. W. M. Hermans, V. Ritacco, A. Alito, et al.. "Use of various genetic markers in differentiation of Mycobacterium bovis strains from animals and humans and for studying epidemiology of bovine tuberculosis". J. Clin. Microbiol 1994;. 32:2425-2433.

(33) Galway, S. E., P.C. Sanchez, T. F. Shinnick, I. Orme, T. Agerton, D. Hoy, J. S. Jones, et al. "An outbreak involving extensive transmission of a virulent strain of Mycobacterium tuberculosis". N. Engl. J. Med 1998; 338: 663.

(34) Cole ST. "What can be expected from sequencing of the Mycobacterium tuberculosis genome?" Bull Acad Natl Med 1999; 183(7):41-50.

(35) Kudoh S, Kudoh T. "A simple technique for culturing tubercle bacilli". Bull World Health Organ 1974; 51 (1): 71-82.

(36) Nava O." Eficacia del medio de cultivo Ogawa-Kudoh, para el diagnostico bacteriologico de tuberculosis pulmonar". Tesis de Grado. 200l. Universidad del Zulia. Facultad de Medicina.

(37) Del Portillo, P., L. A. Murillo, and M. E. Patarroyo. Amplification of a species-specific DNA fragment of Mycobacterium tuberculosis and its possible use in diagnosis. J. Clin. Microbiol 1991; 29:2163-2168.

(38) Wojciech, R. 1992. Oligo[TM] Version 4.0. National Biosciences, Inc., Plymouth, Minn.

(39) Andersen, A. B., S. Thybo, P. Godfrey-Faussett, and N. G. Stoker. "Polymerase chain reaction for detection of Mycobacterium tuberculosis in sputum". Eur. J. Clin. Microbiol. Infect. Dis 1993.12:922-927.

(40) Kox LFF, Rhienthong D, Medo Miranda A et al. "A more reliable PCR for detection of Mycobacterium tuberculosis in clinical samples". J Clin Microbiol 1994; 32: 672-678.

(41) T.D. Mchugh, l. E. Newport, and s. H. Gillespie. "I86110 Homologs Ate Present in Multiple Copies in Mycobacteria Other than Tuberculosis-Causing Mycobacteria". J Clin Microbiol 1997; 35: 1799-1771.

(42) Yuen, L.K.W., B. C. Ross, K. M. Jackson, and B. Dwyer. "Characterization of Mycobacterium tuberculosis strains from Vietnamese patients by Southern blot hybridization". J. Clin. Microbiol 1993; 31:1615-1618

(43) Ferrer J. "Pleural tuberculosis". Eur Resp J 1997; 10: 942-947.

(44) Villegas W, labrada LA, Saravia NG. "Evaluation of polymerase chain reaction, ADA and interferon- in pleural fluid for the differential diagnosis of pleural tuberculosis". Chest 2000; 18: 1355-64.

(45) Bonington, A., J. I. George-Strang, P. E. Klapper, S. V. Hood, W. Rubombora, M. Penny, R. Willers, and E. G.A. Wilkins. "Use of Roche amplicor in early diagnosis of tuberculosis meningitis". J. Clin. Microbiol 1998; 36:1251-1254

(46) Seth, P., G. K. Ahuja, N. Vijaya Bhanu, M. Behari, S. Bhowmik, S. Broor, L. Dar, and M. Chakraborty. "Evaluation of PCR for rapid diagnosis of clinically suspected tuberculosis meningitis". Tubercle Lung Dis 1996; 77:293-388.

Nava Paz, Orlando (1); Hassanhi, Manzur (2) y Prieto, Lisbeth (3)

(1) Catedra de Medicina Tropical. Facultad de Medicina. LUZ. (2) Laboratorio HLA e Inmunogenetica. Banco de Sangre de Maracaibo. (3) Hospital General del Sur. Maracaibo, Venezuela. E-mail: onabap@cantv.net
Tabla 1. Distribucion de muestras de esputo. Baciloscopia.

BK                Positivo %        Negativo %        Total %

Total             19 (61.29)        12 (38.71)        31 (100)

F.I.: Laboratorio de Bacteriologia.
Hospital General del Sur de Maracaibo.

Tabla 2. Distribucion de muestras de esputo. Cultivo.

Cultivo           Positivo %        Negativo %        Total %

Total             19 (61.29)        12 (38.71)        31 (100)

F.I.: Laboratorio HLA e Inmunogenetica.
Banco de Sangre de Maracaibo

Tabla 3. Distribucion de muestras de esputo. RCP.

RCP                 Positivo %        Negativo %           Total

Total               22 (70.96)        09 (29.04)         31 (100)

F.I.: Laboratorio HLA e Inmunogenetica. Banco de Sangre de Maracaibo.

Tabla 4. Relacion Prueba BK y Cultivo.

                      Cultivo           Cultivo
                     Positivo          Negativo            Total

BK Positivo             18                 1                19
BK Negativo              1                11                12
Total                   19                12                31

F.I.: Laboratorio HLA e Inmunogenetica. Banco de Sangre de Maracaibo.

Tabla 5. Relacion Prueba Cultivo y RCP.

                      Cultivo           Cultivo
                     Positivo          Negativo            Total

RCP Positivo            19                 3                22
RCP Negativo             0                 9                 9
Total                   19                12                31

F.I.: Laboratorio HLA e Inmunogenetica. Banco de Sangre de Maracaibo.
COPYRIGHT 2005 Universidad del Zulia, Escuela de Medicina
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Nava Paz, Orlando; Hassanhi, Manzur; Prieto, Lisbeth
Publication:Kasmera
Date:Jul 1, 2005
Words:6727
Previous Article:Caracterizacion fenotipica y susceptibilidad antimicrobiana de cepas clinicas de Stenotrophomonas maltophilia.
Next Article:Salmonella spp. y Shigella spp. asociados con sindrome diarreico agudo en ninos menores de seis anos de edad.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters