Printer Friendly

Estreptococos beta-hemolitico en tilapias del nilo (Oreochromis niloticus) cultivadas en Sullana, Piura--Peru.

Beta-haemolytic streptococci in farmed Nile tilapia, Oreochromis niloticus, from Sullana-Piura, Peru

INTRODUCCION

En America del Sur, la produccion de tilapias ha crecido en las ultimas decadas (1). Estos ciclideos presentan caracteristicas notables de produccion, como rapido crecimiento, tolerancia a amplios rangos de condiciones ambientales, disponibilidad en comer gran variedad de alimentos, produccion de carne blanca y relativo bajo costo de produccion (2,3).

La intensificacion de la produccion de tilapia y altas densidades, son condiciones favorables para la diseminacion de enfermedades (4); que inducen procesos inflamatorios, comprometiendo la respuesta inmune (5,6) que termina con la muerte del animal. Actualmente se conocen varias epizootias que afectan los peces, generalmente causadas por agentes bacterianos (2). Las infecciones estreptococicas se han convertido en un problema importante en la produccion de tilapia, lo que genera alta morbilidad y/o mortalidad, y graves perdidas economicas en diferentes piscifactorias en el mundo (3,7).

Streptococcus agalactiae y Streptococcus iniae son las principales especies bacterianas que afectan la produccion de tilapia en el mundo (8). Sin embargo, algunos autores mencionan que S. iniae esta mas distribuido y afecta mayor numero de especies de peces que S. agalactiae (9). S. iniae provoca altos indices de mortalidad, que oscila entre el 30-50% (9). Ademas, este agente provoca cambios en filetes, que son inapropiadas para el comercio (2). En adicion, se ha informado que S. iniae es un patogeno zoonotico (10).

En Peru, el cultivo de la tilapia es una actividad promisoria. Sin embargo, la falta de identificacion y el conocimiento indicado para diagnosticar las enfermedades bacterianas que afectan este cultivo podria perjudicar su produccion (11). Previos estudios reportaron la existencia de signos clinicos y lesiones compatibles con Streptococcus spp. (12).

El objetivo de este estudio fue determinar si S. iniae esta presente en una piscifactoria intensiva de Oreochromis niloticus situada en Sullana-Piura, Peru.

MATERIALES Y METODOS

Diseno experimental. 150 tilapias fueron colectadas, 75 en la fase de pre engorde (33.5 [+ o -] 3.6 g) y 75 en la fase de engorde (670.5 [+ o -] 22.6 g) ; de pozas, con signos clinicos como: nado superficial y erratico, exoftalmia y lesiones hemorragicas en piel. Los animales fueron sacrificados con una dosis letal de benzocaina sodica 1:500 (v/v), previamente diluido en alcohol 98[grados] (0.1 g/mL) (13) y se procedio a la necropsia.

Localizacion. Las tilapias fueron muestreadas de una piscigranja de crianza intensiva ubicada en el distrito de Lancones, provincia de Sullana, departamento de Piura, zona nor-occidental del Peru (4[grados]38'27"S, 80[grados]32'55"O). El espejo de agua de la zona es 19.26 hectareas (Ha) y es abastecida por la represa de Poechos. Las areas y flujo de la piscigranja son: Recepcion de reproductores, reproduccion, alevinaje 1, alevinaje 2, crecimiento, pre-engorde, engorde y cosecha.

El estudio fue realizado entre los meses de Febrero y Junio del 2014, en este periodo la temperatura ambiental oscilo entre los 24[grados]C -35[grados]C. Asi mismo, el promedio de los parametros fisico-quimicos del agua registrados por la piscigranja (usando un sistema multisonda, modelo YSI-556) fueron:

Pre engorde: T[grados]: [grados]: 25.3 [+ o -] 1.8 [grados]C, Oxigeno disuelto (OD): 5.3 [+ o -] 0.6 mg/L, C[O.sub.2]: 4.1 [+ o -] 0.9 mg/, pH: 7.3 [+ o -] 0.6, nitritos: 0.008 [+ o -] 0.003 mg/L, amonio: 0.14 [+ o -] 0.02 mg/L, alcalinidad: 92.07 [+ o -] 2.6 mg/L y dureza: 92.5 [+ o -] 3.2 mg/L.

Engorde: T[grados]: 25.1 [+ o -] 2.2 [grados]C, Oxigeno disuelto (OD): 3.99 [+ o -] 0.9 mg/L, C[O.sub.2]: 2.93 [+ o -] 0.4 mg/L, pH: 5.7 [+ o -] 0.4, nitritos: 0 mg/L, amonio: 0.34 [+ o -] 0.12 mg/L, alcalinidad: 98.84 [+ o -] 3.1 mg/L y dureza: 93.2 [+ o -] 2.8.

Tamano muestral. Para determinar el tamano muestral se utilizo la formula de prevalencia limite para la deteccion de una enfermedad. El uso de esta formula implica que existe una probabilidad del 95% que se encuentre al menos un positivo de ser el caso que la prevalencia sea igual o mayor que la prevalencia limite (2.7%). Consecuentemente, la ausencia de positivos podria indicar la presencia de la enfermedad, pero su prevalencia seria menor de que la prevalencia limite.

Aspectos eticos. La investigacion fue aprobada por el Comite de Etica y Bienestar Animal (CEBA) de la Facultad de Medicina Veterinaria de la Universidad Nacional Mayor de San Marcos, acorde al cumplimiento de los principios y leyes internacionales como los senalados por el Institutional Animal Care and Use Comittee (IACUC).

Microbiologia. Se realizo un corte aseptico de los organos indicados (bazo, cerebro, higado y rinon anterior) y se introdujo el hisopo esteril del medio de transporte Stuart (Deltalab, S.L.U., Espana). El hisopado de las fueron sembradas por agotamiento en placas con agar sangre (enriquecidas con 5% de sangre de ovino), e incubadas a 30[grados]C por 24-48 horas.

Fueron seleccionadas las colonias que presentaron caracteristicas de cocos Gram positivos, colonias pequenas blancas, translucidas o pigmentadas, ligeramente convexas, de hasta 2 [micron]m de diametro, con pruebas negativas para catalasa, oxidasa, motilidad y algun tipo de hemolisis, glucosa (Neogen Acumedia, Estados Unidos), lactosa (Sigma, Estados Unidos), maltosa (Sigma, Estados Unidos), manitol (Merck, Alemania), indol y produccion de [H.sub.2]S. En adicion, fueron consideradas las siguientes pruebas para diferenciar a la especie S. iniae: Produccion de acetoina (Voges Proskauer) (Remel, Estados Unidos), leucina-aminopeptidasa (LAP) (Remel, Estados Unidos), pirrolidonil arilamidasa (PYR) (Remel, Estados Unidos), hidrolisis de almidon (Merck, Alemania) e hidrolisis de esculina (Neogen, Acumedia, Estados Unidos). El protocolo para realizar las pruebas mencionadas fueron los descritos por el fabricante.

Histopatologia. Se realizo el corte de tejidos de aproximadamente 1 cm de diametro y fueron fijadas en solucion de formalina bufferada al 10%. Las muestras de bazo, branquias, cerebro, ciego, corazon, estomago, higado, intestino, musculo esqueletico, piel y rinon cefalico fueron procesadas de acuerdo con el protocolo convencional para estudios histologicos de tejidos fijados. Se realizaron secciones de corte de 5 [micron]m de grosor, fueron fijadas en laminas y coloreadas con hematoxilina-eosina (HE).

Biologia Molecular.

Extraccion de ADN. La extraccion de ADN fue realizada a partir de colonias aisladas de los organos de cada pez presuntivamente positivos para S. iniae por la bioquimica, con el kit comercial de PureLink Genomic DNA Kits (Invitrogen, Estados Unidos), siguiendo las instrucciones del fabricante para bacterias Gram positivas. Para el paso de purificacion de ADN se realizo la centrifugacion a 13000 x g por 1 minuto seguido de dos lavados con el buffer de elusion, utilizando 40 [micron]L en cada lavado. La concentracion de ADN y la razon de absorbancias (260/280 nm) fueron medidos usando un espectrofotometro (Nanodrop, Thermo Scientific, Waltham, MA, EUA). Finalmente el material genetico fue almacenado a -20[grados]C hasta su uso.

Controles. Las cepas utilizadas como controles positivos fueron S. iniae ATCC 29178, donada por el Laboratorio de Medicina Genomica de la Universidad Surcolombiana y S. iniae ATCC 29177 (Microbiologics, Estados Unidos). Ambas extraidas con el kit comercial de PureLink Genomic DNA Kits (Invitrogen, Estados Unidos). Por otro lado, se utilizo agua DEPC (Invitrogen, Estados Unidos) como control negativo.

PCR cualitativo en tiempo real. Los primers y sonda utilizados fueron para la deteccion de S. iniae fueron Forward 5'GTTTTCTTGAAGCTATTGCAGGTTT3', Reverse 5'CGCGCAAGGGTTTCATG3' y sonda 5'VIC-CTGCGGTTGCCATACCAGCAAGTATTCTA-TAMRA3' Estos primers y sonda fueron sintetizados a partir de la secuencia de nucleotidos de los genes IctP y IctO de S. iniae (no de acceso Y07622 en Genbank), utilizando el software Primer Express 3.0 Applied Biosystems (Life Technologies, Estados Unidos). La PCR se realizo por duplicado, resumidamente: 12.5 [micron]L de Taqman Universal PCR master mix (2x) (Invitrogen, Estados Unidos), 0,5 [micron]L de sonda (10 [micron]M) (Bioneer Corporation, Corea), 1,25 [micron]L de cada primer (10 [micron]M), 1 [micron]L de ADN (20 ng/[micron]L), 8,5 [micron]L agua DEPC (Invitrogen) para un volumen total de 25 [micron]L.

Las condiciones termicas utilizadas fueron : desnaturalizacion a 95[grados]C por 10 minutos, seguido por 40 ciclos de 15 segundos a 95[grados]C, 2 minutos de hibridacion a 50[grados]C y 1 minuto de extension a 60[grados] C utilizando el equipo Applied Biosystems 7500 (Life Technologies, Estados Unidos).

Analisis de los datos. Se realizo el calculo de la prevalencia de tilapias positivas a Streptococcus spp., por caracterizacion microbiologica y las tilapias presuntas positivas a S. iniae por bioquimica, mediante el programa incertidumbre @Risk (Palisade Corp) implementado en una planilla electronica Excel[R] (Microsoft Corp).

Para el calculo de la prevalencia de S. iniae en animales enfermos o con signos clinicos se desarrollo una simulacion estocastica de la distribucion beta empleando el programa de incertidumbre @Risk (Palisade Corp) implementado en una planilla electronica Excel[R] (Microsoft Corp). Brevemente, la probabilidad de infeccion en los peces aparentemente enfermos y sus intervalos se calcularon empleando una distribucion Beta con parametros [alfa] y [beta] donde:

[alfa]=positivos+1 y [beta]=negativos+1

Los intervalos de confianza se calcularon corriendo la simulacion por 30.000 interacciones.

Histopathology. To the histopathological reading of the 16 tilapia positive presumed to S. iniae was observed:

Spleen: In 12.5% (2/16) of the cuts, the perisplenic area was observed thickened with the presence of inflammatory exudate composed of neutrophils and macrophages on condensed fibrin, and in some cases, the presence of fibroblasts; compatible with a fibrin-suppurative acute or chronic type perisplenitis (Figure 2-a). In 50% (8/16) bacterial nests and areas of necrosis were noted. In addition, other cuts congestion showed 68.75% (11/16) in the depletion 18.75% (3/16) and increased melanomacrophages centres in 43.75% (7/16).

Brain: In 37.5% (6/16) of the cuts acute diffuse suppurative meningitis was observed. While, in 18.75% (3/16) was observed an infiltration of the brain with an exudate composed of neutrophils and macrophages, consistent with meningoencephalitis. In addition, congestion

RESULTADOS

Necropsia. Los hallazgos post-mortem evidenciaron cambios patologicos como exoftalmia, opacidad de los ojos, congestion de meninges, ascitis, lesiones hemorragicas en diferentes zonas del cuerpo, poro anal hemorragico, esplenomegalia, hepatomegalia y zonas necroticas sobre el musculo esqueletico (Figura 1a-e).

Microbiologia. Se identificaron 102 aislados positivos para Streptococcus spp. La distribucion de estos aislados por organo fue: en 18 higados (17.65%), 22 rinones anteriores (21.57%), 27 bazos (26.47%) y 35 cerebros (34.31%). Estos aislados, correspondieron a un total de 54 tilapias positivas para Streptococcus spp.

De los 102 aislados (n=19, 18.63%) se seleccionaron solo los beta-hemoliticos, caracteristico de S. iniae, obteniendose 19 (18.63 %) aislados. Estos aislados correspondieron a un total de 16 tilapias. En la tabla 1 se observa el perfil bioquimico de estos aislados.

La prevalencia media de tilapias positivas a Streptococcus spp., por caracterizacion microbiologica fue de 26% (21%-33%). Mientras que, la prevalencia media de las tilapias presuntas positivas por perfil bioquimico para S. iniae., fue de 10.12% (6%-15.10%).

Histopatologia. A la lectura histopatologica de las 16 tilapias presuntas positivas a S. iniae se observo:

Bazo: En el 12.5% (2/16) de los cortes, la zona periesplenica se observo engrosada con presencia de exudado inflamatorio compuesto por neutrofilos y macrofagos asentados sobre fibrina condensada, y en algunos casos, la presencia de fibroblastos; compatible con una periesplenitis fibrinosupurativa tipo aguda o cronica (Figura 2-a).

En el 50% (8/16) se observaron nidos bacterianos y zonas de necrosis. Ademas, otros cortes evidenciaron congestion 68.75% (11/16), deplecion en 18.75% (3/16), e incremento de centros de melanomacrofagos en el 43.75% (7/16).

Cerebro: En 37.5% (6/16) de los cortes se observo una meningitis supurativa difusa aguda. Mientras que, en 18.75% (3/16) se observo infiltrado celular con un exudado compuesto por neutrofilos y macrofagos, compatible con una meningoencefalitis. Ademas de, congestion de las meninges 18.75% (3/16) y en 6.25% (1/16) se evidencio zonas basofilas compatibles con nidos bacterianos (Figura 2-b).

Corazon: Se observo severa epicarditis fibrinosupurativa aguda y en otros casos, de tipo cronica, evidenciado en el 56.25% (9/16). En el miocardio compacto se observo disgregacion de algunas fibras musculares cardiacas, y entre ellas la presencia de un exudado inflamatorio compuesto por neutrofilos, macrofagos, celulas granulares eosinofilicas y globulos rojos, representando el 56.25% (9/16) (Figura 2-c).

Estomago: Se evidencio gastritis supurativa en el 18.75% (3/16).

Higado: La zona perihepatica se observo engrosada con presencia de exudado inflamatorio compuesto por neutrofilos (algunos ya degenerados), macrofagos y celulas granulares eosinofilicas (CGE) asentados sobre fibrina condensada y en otros casos, observaron fibroblastos. Estas lesiones fueron compatibles con severa perihepatitis fibrinosupurativa aguda y en otros casos, de tipo cronica, en 37.5% (6/16). Un corte con 6.35% (1/16) evidencio nidos bacterianos.

En 12.5% (2/16) de los cortes fueron observados granulomas, compuesto por macrofagos agregados, los cuales fueron circunscritos por fibroblastos (Figura 3-4). Por otro lado, 75% (12/16) de los peces muestreados presentaron necrosis. Mientras que, en 56.25% (9/16) se evidencio esteatosis y degeneracion hidropica de hepatocitos.

Intestino: Se observo infiltracion del epitelio intestinal, presencia de neutrofilos, macrofagos y melanomacrofagos representando 6.25% (1/16) de los casos. Infiltracion de la serosa por macrofagos tambien fue observado en 6.25% (1/16) de los casos. En un corte con 6.25% (1/16), se observo ademas hiperplasia del epitelio y necrosis; compatible con una leve a moderada enteritis supurativa difusa aguda.

Musculo esqueletico: El paquete muscular se observo con necrosis coagulativa representando 56.25% (9/16) de los casos (Figura 5), con presencia de algunas celulas inflamatorias (macrofagos, neutrofilos y celulas granulares eosinofilicas) en 6.25% (1/16) de los casos.

Ojos: Las capas de la retina se observaron disgregadas, evidenciando un proceso de edema en 31.25% (5/16). El epitelio de la cornea, plexo coroideo y tejido adiposo se observaron severamente infiltrados, con presencia de exudado compuesto por neutrofilos y macrofagos (panoftlamitis y paniculitis), compatible con una moderada a severa panoftalmitis supurativa aguda, lo cual representa 81.25% (13/16) de los casos. (Figura 6).

Trece cortes con 81.25% (13/16) evidenciaron celulas del epitelio pigmentario retinal dispersas, mostrando actividad fagocitaria.

Piel: En la epidermis se observo degeneracion hidropica y perdida del epitelio con necrosis en un corte representando el 6.25% (1/16). Por otro lado, en la dermis se observo detritus e infiltracion de exudado compuesto por celulas inflamatorias (neutrofilos y macrofagos), compatible con una dermatitis supurativa aguda, representando 12.5% (2/16) de los casos.

Biologia Molecular. De las 16 tilapias caracterizadas por bioquimica e histopatologia presuntas positivas para S. iniae, ningun pool amplifico acima del threshold en la PCR en tiempo real dentro de los 40 ciclos. Sin embargo, se estimo mediante el programa de incertidumbre @Risk (Palisade Corp), la prevalencia media de 0.66% (0.02%-2.41%) para S. iniae en las tilapias enfermas o con signos clinicos.

DISCUSION

El Peru presenta excelentes perspectivas de desarrollo acuicola y dentro de este marco, la tilapicultura es una actividad promisoria. Asi mismo, en los ultimos anos se ha incrementado el consumo y aceptacion de la tilapia, tanto en el mercado nacional como internacional (11). Siendo importante garantizar un optimo estado sanitario y ofrecer un producto inocuo al consumidor. Hasta la fecha, en el Peru solo existen reportes de parasitos presentes en estas especies de cultivo (12), este estudio representa uno de los primeros informes sobre la identificacion de los agentes bacterianos en tilapia.

La estreptococosis es una de las enfermedades bacterianas mas importantes que afectan el cultivo de peces, y dentro de las especies, el S. iniae es considerada la de mayor impacto en el cultivo de tilapias (9). Debido a los indices de morbilidad, mortalidad y costos de tratamiento que genera, asi como su repercusion en la salud publica (13,14).

Los principales hallazgos macroscopicos encontrados en este estudio como exoftalmia, opacidad de cornea, congestion en el cerebro, ascitis, petequias alrededor del poro anal, lesiones hemorragicas y necroticas sobre la piel y tejido muscular, hepatomegalia, esplenomegalia, depositos de fibrina en higado y corazon fueron sugestivas de una infeccion por Streptococcus spp. (8).

El 34.31% de aislamientos de Streptococcus spp., a partir del cerebro encontrado en el presente estudio respalda la predileccion de esta bacteria por este organo; como es sugerido por Salvador et al (15), considerandolo un importante organo para el aislamiento rutinario. Asi mismo, se determino que el bazo, rinon e higado son organos importantes para el aislamiento de Streptococcus spp., el cual fue de 26.47%, 21.57% y 17.65% respectivamente; estos organos tambien son considerados por Hernandez et al (16) como blancos para su aislamiento. Si bien en este estudio no se encontro un perfil bioquimico 100% caracteristico de S. iniae, acorde a Anshary et al (17), podemos inferir que se debe a las diferentes variaciones entre aislados como es reportado por Facklam et al (18).

Las lesiones histopatologicas observadas en este estudio son compatibles con una infeccion por Streptococcus spp. Siendo, los tejidos mas afectados: corazon, higado, ojo, bazo, y cerebro; reportando que estos serian los organos blanco de esta bacteria, acorde a lo encontrado por Salvador et al (15).

La presencia de epicarditis fibrinosa, periesplenitis fibrinosa, meningitis, granulomas hepatopancreaticos, nidos bacterianos, focos necroticos, infiltracion de hepatopancreas y presencia de centros de melanomacrofagos es reportado tambien por Chen et al (19) en tilapias positivas a S. iniae por PCR, lo cual hasta la histopatologia, podria llevarnos a suponer que la especie podria estar presente en este centro de cultivo. Asi mismo, la oftalmitis o panoftalmitis senala la predileccion de Streptococcus spp., por este organo, como tambien fue observado por Bromage y Owens (20). Por otro lado, el exudado observado en todos los organos caracterizados es principalmente mononuclear, con predominio de macrofagos y neutrofilos.

Algunos reportes indican que homologos de el gen IctoO solo son observados en bacterias con metabolismo fermentativo como S. iniae, Aerococcus viridans, S. equi subsp. zooepidemicus, S. pyogenes y Carnobacterium piscicola (21). Por lo tanto, este gen puede ser utilizado como molecula diana especifica para el desarrollo de ensayos de PCR especificos para la deteccion de S. iniae (22,23). No en tanto en este reporte no identificamos amplificaciones en PCR en tiempo real. Eso puede haber ocurrido debido a agentes inhibidores de la PCR dentro de las amuestras, que reducen la sensibilidad de la tecnica (21), como tambien podria ser otra especie con caracteristicas clinicas e histopatologicas semejantes a S. iniae.

Este estudio es el primero en determinar la presencia del genero Streptococcus por aislamiento microbiologico y lesiones anatomopatologicas compatibles con este agente bacteriano en una piscigranja de la provincia de Sullana, departamento de Piura, Peru. Se puede concluir que la especie S. iniae no estaba presente en los ejemplares de O. niloticus analizados en este centro de cultivo a la prevalencia limite de 2.7%. Sin embargo, es necesario realizar la confirmacion molecular de la especie de Streptococcus que se encuentra en este importante centro de cultivo para nuestro pais; pues los signos clinicos y lesiones encontrados no son exclusivos de una especie determinada de Streptococcus, lo cual complica mas su diagnostico laboratorial, siendo necesario el uso de pruebas moleculares mas especificas para su determinacion.

Agradecimientos

Al Vicerrectorado de Investigacion--Consejo Superior de Investigaciones--de la Universidad Nacional Mayor de San Marcos por el financiamiento de los proyectos: Proyecto Multidisciplinara y CON CON (Codigo No 140801031).

INTRODUCTION

In South America, tilapia production has grown in the last decades (1). The cichlids present notably characteristics for production, such as rapid growth, tolerance to a wide range of environmental conditions, available for eating a variety of foods, white meat and relatively low production costs (2,3).

The intensification of tilapia production and high stocking densities are favourable conditions to spread diseases (4); and that induce inflammatory process, dramatically compromising the immune response (5,6) ending with the death of the animal. Currently several epizooties that affect them, usually caused by bacterial agents are known (2). The Streptococcal infections have become a major problem in tilapia production, generating high morbidity and/or mortality, and severe economic losses in different fish farms in the world (3,7).

Streptococcus agalactiae and Streptococcus iniae are the main bacterial species that affect production of tilapia in the world (8). However, some authors mention that the S. iniae is more distributed, affecting a larger number of fish species than S. agalactiae (9). S. iniae causes high rates of mortality, which varies between 30-50% (9). Also, this agent causes changes in fillets, which are inappropriate for trade (2). In addition, it has been reported that S. iniae is a zoonotic pathogen (10).

In Peru, the tilapia production is a promising activity. However, there is a lack of identification and knowledge of bacterial diseases that affect this culture and could impair its production (11). Previous studies reported the existence of clinical signs and lesions consistent with Streptococcus spp. (12).

The aim of this study was to determine if S. iniae is present in an intensive fish farm of Oreochromis niloticus located in Sullana-Piura, Peru.

MATERIALS AND METHODS

Experimental design. 150 tilapias were collected 75 of the phases nursery (33.5 [+ o -] 3.6 g) and 75 grow-out (670.5 [+ o -] 22.6 g) from ponds with clinical signs such as shallow and erratic swimming, exophthalmia and haemorrhagic skin lesions. The animals were euthanized with a lethal dose of sodium benzocaine 1:500 (v/v) previously diluted in alcohol 98[grados] (0.1 g/mL) (13).

Location. The fish were sampled from an intensive fish farm located in the Lancone district, Sullana province, Piura department, to Peru north-western (4[degre] 38'27 "S 80[degre] 32'55" W). The water surface area is 19.26 hectares (Ha) and is supplied by the Poechos reserve. Flow areas and the fish farm are: reproductive reception, reproduction, breeding 1, breeding 2, growth, nursery, grow-out and harvest.

The study was performed between the months of February and June in 2014, with at room temperature between 24[grados]C-35[grados]C. Also, the averages of the physic-chemical parameters of the water recorded for the fish farm (using a multiprobe system, model YSI-556)were:

Nursery: T[grados]: 25.3 [+ o -] 1.8 [grados]C, Dissolved oxygen (DO): 5.3 [+ o -] 0.6 mg/L, C[O.sub.2]: 4.1 [+ o -] 0.9 mg/L, pH: 7.3 [+ o -] 0.6, nitrite: 0.008 [+ o -] 0.003 mg/L, ammonium: 0.14 [+ o -] 0.02 mg/L, alkalinity: 92.07 [+ o -] 2.6 mg/L, hardness: 92.5 [+ o -] 3.2 mg/L.

Grow-out: T[grados]: 25.1 [+ o -] 2.2 [grados]C, Dissolved oxygen (DO): 3.99 [+ o -] 0.9 mg/L, C[O.sub.2]: 2.93 [+ o -] 0.4 mg/L, pH: 5.7 [+ o -] 0.4, nitrite: 0 mg/L, ammonium: 0.34 [+ o -] 0.12 mg/L, alkalinity: 98.84 [+ o -] 3.1 mg/L, hardness: 93.2 [+ o -] 2.8 mg/L.

Sample size. To determine the sample size was used the limit prevalence formula for detection of a disease. The use of this formula means that there is a probability of the 95% to find at least one positive, if the prevalence is equal or greater than the limit prevalence (2.7%). Consequently, the absence of positive indicates that the disease to be present, its prevalence would be less than the limit prevalence.

Ethical aspects. The research was approved by the Committee of Ethics and Animal Welfare --CEAW (CEBA2005-009), School of Veterinary Medicine of the National University of San Marcos, according to compliance with international principles and laws as outlined by the Institutional Animal Care and Use Committee (IACUC).

Microbiology. Aseptic court of the indicated organs (spleen, brain, liver, and head kidney) was performed and the sterile swab from Stuart transport medium (Deltalab, SLU, Spain) was introduced. The swab samples were seeded in blood agar plates (supplemented with 5% sheep blood) and incubated at 30[grados]C for 24-48 hours.

Colonies were selected that showed characteristics of Gram positive cocci, small colonies white, translucent or pigmented, slightly convex, up to 2 [micron]m in diameter, with negative testing for catalase, oxidase and motility some haemolysis, glucose (Neogen Acumedia, USA), lactose (Sigma, USA), maltose (Sigma, USA), mannitol (Merck, Germany), indole and [H.sub.2]S production. In addition, were considered the following tests to differentiate the species S. iniae: acetoin production (Voges Proskauer) (Remel, USA), aminopeptidase leucine (LAP) (Remel, USA), arylamidase pyrrolidonyl (PYR) (Remel, USA), starch hydrolysis (Merck, Germany) and esculin hydrolysis (Neogen, Acumedia, USA). The protocol for the tests mentioned followed the manufacturer's recommendations.

Histopathology. Tissues cutting about 1.0 cm diameter were fixed in 10% buffered formalin solution. Samples of spleen, gills, brain, cecum, heart, stomach, liver, intestine, skeletal muscle, skin and head kidney were processed according to the standard protocol for histological studies of fixed tissues. Cross-sections with thickness of 5 [micron]m were fixed and stained with hematoxylineosin.

Molecular Biology.

DNA extraction. The DNA extraction was performed from pools of organs of each fish of the presumptively positive of S. iniae by biochemistry, with the commercial kit PureLink Genomic DNA Kit (Invitrogen, USA), following the manufacturer's instructions for Gram positive bacteria. For DNA purification step centrifugation at 13,000 x g was performed for 1 minute followed by two washes with the elution buffer, using 40 [micron]L each wash. DNA concentration and absorbance ratio (260/280 nm) were measured using a spectrophotometer (Nanodrop, Thermo Scientific, Waltham, MA, USA). Finally, the genetic material stored at -20[grados]C until use.

Controls. The strains used as positive controls were S. iniae ATCC 29178 donated by the Laboratory of Genomic Medicine of the Surcolombiana University and the S. iniae ATCC 29177 (MicroBioLogics, USA). Both extracted with the commercial kit PureLink Genomic DNA Kit (Invitrogen, USA). Furthermore, water DEPC (Invitrogen, USA) was used as negative control.

Qualitative real-time PCR. The primers and probe used for the detection of S. iniae were forward 5'GTTTTCTTGAAGCTATTGCAGGTT T3', reverse 5'CGCGCAAGGGTTTCATG3' and prove 5'VIC-CTGCGGTTGCCATACCAGCAAGTATTCTATAMRA3'. These primers and probe were synthesized from the sequence No. Y07622.1 lactate oxidase protein (lctO) using the Primer Express 3.0 Applied Biosystems Software (Life Technologies, USA). PCR was performed in duplicate, in short: 12.5 [micron]L of Taqman Universal PCR Master Mix (2x) (Invitrogen, USA), 0.5 [micron]L of probe (10 [micron]M) (Bioneer Corporation, Corea), 1.25 [micron]L of primer F (10 [micron]M), 1 25 [micron]L of primer R (10 [micron]M), 1 [micron]L of DNA (20 ng/[micron]L), 8.5 [micron]L of DEPC water (Invitrogen) to a total volume of 25 [micron]L.

Thermal conditions used were: denaturation at 95[grados]C for 10 minutes followed by 40 cycles of 15 seconds at 95[grados]C, 2 minutes annealing at 50[grados]C and 1 minute of extension at 60[grados]C using the equipment Applied Biosystems 7500 (Life Technologies, USA).

Data analysis. The calculation of the prevalence of positive to Streptococcus spp. tilapia was conducted. For microbiological characterization and tilapia S. iniae alleged positive by biochemical, by @Risk (Palisade Corp) uncertainty program implemented in Excel[R] spreadsheet (Microsoft Corp).

For the calculation of the prevalence of S. iniae in sick animals or with clinical signs was developed a stochastic simulation using beta distribution program @Risk Uncertainty (Palisade Corp) implemented in a spreadsheet Excel[R] (Microsoft Corp.). Briefly, the probability of infection in apparently sick fishes and their intervals were calculated using a Beta distribution with parameters [alfa] and [beta] where:

[alfa]=positivos+1 and [beta]=negativos+1

Confidence intervals were calculated running the simulation 30.000 interactions.

RESULTS

Necropsy. The post-mortem findings evidenced pathological changes such us exophthalmia, ocular opacity, congestion of meninges, ascites haemorrhagic lesions in different zones of the body, bleeding anal pore, splenomegaly, hepatomegaly and necrotic zones on the skeletal muscle (Figure 1a-e).

Microbiology. 102 positive isolates were identified as Streptococcus spp. The distribution of these isolates by organ were: liver (18) 17.65%, head kidney (22) 21. 57%, spleen (27) 26.47% and brain (35) 34.31%. These isolates corresponded to a total of 54 positive tilapia to Streptococcus spp.

From 102 isolates were selected (n = 19, 18.63%) only those with [beta]-haemolytic, characteristic of S. iniae. These isolates belong to a total of 16 tilapias. The table 1 shows the biochemical profile of these isolates.

The average prevalence of positive tilapia to Streptococcus spp., by microbiological characterization was 26% (21%-33%). Whereas, the average prevalence of positive presumed tilapias to S. iniae by biochemical profile was 10.12% (6%-15.10%). meninges in 18.75% (3/16) and 6.25% (1/16) for the presence bacterial nests were evidenced (Figure 2-b).

Histopathology. To the histopathological reading of the 16 tilapia positive presumed to S. iniae was observed:

Spleen: In 12.5% (2/16) of the cuts, the perisplenic area was observed thickened with the presence of inflammatory exudate composed of neutrophils and macrophages on condensed fibrin, and in some cases, the presence of fibroblasts; compatible with a fibrin-suppurative acute or chronic type perisplenitis (Figure 2-a). In 50% (8/16) bacterial nests and areas of necrosis were noted. In addition, other cuts congestion showed 68.75% (11/16) in the depletion 18.75% (3/16) and increased melanomacrophages centres in 43.75% (7/16).

Brain: In 37.5% (6/16) of the cuts acute diffuse suppurative meningitis was observed. While, in 18.75% (3/16) was observed an infiltration of the brain with an exudate composed of neutrophils and macrophages, consistent with meningoencephalitis. In addition, congestion meninges in 18.75% (3/16) and 6.25% (1/16) for the presence bacterial nests were evidenced (Figure 2-b).

Heart: Severe acute fibrinous suppurative epicarditis was observed and in other cases, chronic type, shown in 56.25% (9/16). In some compact infarction disintegration was observed cardiac muscle fibers, including the presence of inflammatory exudates comprising neutrophils, macrophages, eosinophilic granule cells (ECG) and red blood cells, representing 56.25% (9/16) (Figure 2-c).

Stomach: Suppurative gastritis was evidenced in 18.75% (3/16).

Liver: The thickened perihepatic area was observed with the presence of an inflammatory exudate composed of neutrophils (some or degenerate), macrophages and eosinophilic granule cells seated on fibrin condensed and in other cases, the presence of fibroblasts was demonstrated. These lesions were compatible with a severe acute suppurative fibrinperihepatitis and in other cases, chronic type, in 37.5% (6/16). A cut to 6.35% (1/16) showed the presence of bacterial nests.

In 12.5% (2/16) of the cuts granulomas, composed by aggregated macrophages which were circumscribed by fibroblasts. Also, the hepatopancreas showed an inflammatory exudate (Figure 3-4) it was evidenced. Moreover, 75% (12/16) of sample fish showed necrosis. While in 56.25% (9/16) steatosis and hydropic degeneration of hepatocytes was evidenced.

Intestine: Infiltration of the intestinal epithelium, presence of neutrophils, macrophages and melanomacrophages were observed representing 6.25% (1/16) of cases. Serosa macrophage infiltration was also observed at 6.25% (1/16) of cases. Cutting a 6.25% (1/16) plus epithelial hyperplasia and necrosis was observed; compatible with mild to moderate acute diffuse suppurative enteritis.

Skeletal Muscle: Coagulative necrosis was observed representing 56.25% (9/16) of the cases (Figure 5), presence of some inflammatory cells (macrophages, neutrophils and eosinophilic granule cells in 6.25% (1/16) of cases.

Eyes: The layers of the retina were observed disintegrated, demonstrating a process of oedema in 31.25% (5/16). The corneal epithelium, choroid plexus and adipose tissue were observed severely infiltrated with presence of exudate composed of neutrophils and macrophages (panoftlamitis and panniculitis), compatible with moderate to severe acute suppurative panophthalmitis, representing 81.25% (13/16) of cases (Figure 6).

Thirteen cuts with 81.25% (13/16) showed scattered cells of the retinal pigment epithelium, showing phagocytic activity.

Skin: The skin hydropic degeneration and necrosis with loss of epithelium was observed in a cut representing 6.25% (1/16). Furthermore, the dermis and infiltration of debris exudate comprising inflammatory cells (neutrophils and macrophages), consistent with acute suppurative dermatitis was observed, and representing 12.5%(2/16) cases.

Molecular Biology. From 16 tilapia characterized by biochemistry and histopathology positive presumed to S. iniae, any positive tilapia was found to real time PCR. However, it was estimated by uncertainty @Risk program (Palisade Corp), the mean prevalence of 0.66% (0.02%-2.41%) for S. iniae in diseased tilapias or with clinical signs.

DISCUSSION

Peru has excellent prospects for aquaculture development and within this framework; the farming of tilapia is a promising activity. Also, in recent years it has increased consumption and acceptance of tilapia, in national and international markets (11). It is important to ensure optimal health status and provide a safe product to the consumer. To date, in Peru there are only reports of parasites present in this species of reared (12). So, this study represents some of the first reports on the identification of bacterial agents in tilapia.

The streptococci is one of the most important bacterial diseases affecting fish farming, and within species, S. iniae is considered the greatest impact on tilapia farming (9). Due to the morbidity, mortality and treatment costs it generates, and its impact on public health (13,14).

It can be concluded that the species S. iniae was not present in the specimens of O. niloticus analysed in this fish farm to the limit prevalence of 2.7%. However, is necessary to confirm the species of Streptococcus found in this important farming centre for our country; because the clinic signs and lesions are not pathognomonic for Streptococcus infection, for this becomes necessary the use of molecular identification.

The main macroscopic findings in this study such as exophthalmos, corneal opacity, congestion in the brain, ascites, the bleeding anal pore, haemorrhagic and necrotic lesions on the skin and muscle tissue, liver, spleen, fibrin deposits in liver and heart were suggestive of Streptococcus spp. infection (8).

The 34.31% of isolates of Streptococcus spp., from the brain found in this study supports the predilection of this bacterium by this organ as suggested by Salvador et al (15), considering it an important organ for routine isolation. Also, it was determined that the spleen, kidney and liver are important organs for isolation of Streptococcus spp., which was 26.47%, 21.57% and 17.65% respectively.; these organs are also considered by Hernandez et al (16) as targets for their isolation. Even if in this study was not found a biochemical profile 100% typical to S. iniae, according to Anshary et al (17), we can infer that is due to the different variations between isolates as reported by Facklam et al (18).

Histopathological lesions observed in this study are consistent with infection by Streptococcus spp. The most affected tissues were: heart, liver, eye, spleen and brain; these organs are reporting that they would be the target organ of the bacteria, according to that found by Salvador et al (15).

The presence of epicarditis fibrinous, fibrinous perisplenitis, meningitis, hepatopancreatic granulomas, bacterial nests, necrotic foci, infiltration and presence hepatopancreas melanomacrophages centres is also reported by Chen et al (19) in positive tilapia to S. iniae, which until histopathology, could lead us to assume that the specie could be present in this fish farm. Also the ophthalmitis or panophthalmitis indicated the predilection of Streptococcus spp. for this organ, as was observed by Bromage and Owens (20). Furthermore, the exudate observed in all organs is mainly mononuclear, predominantly macrophages and neutrophils.

The 16S rRNA gene is usually used for the detection of S. iniae. However, Gibello et al (21) found that the gene encoding the protein lactate oxidase (IctO) is very unusual between species of Streptococcus spp.; for it, this gene is able to detect S. iniae with greater specificity than the 16S rRNA gene.

This study is the first to determine the presence of the genus Streptococcus spp., supported by microbiological isolation and pathological lesions in the Sullana province, Piura department, Peru.

DOI:dx.doi.org/10.21897/rmvz.925

Acknowledgements

The authors thank to the Vice Rectorate of Research--High Council of Research--of the San Marcos University for the financing of the projects: Multidisciplinary Project and CONCON (Code No 140 801 031).

REFERENCES

(1.) Padua SB, Menezes-Filho RN, Martins ML, Belo MAA; Ishikawa MM, Nascimento CA, Saturnino KC, Carrijo-Mauad JR. A survey of epitheliocystis disease in farmed Nile tilapia (Linnaeus, 1758) in Brazil. J Appl Ichthyol 2015; 31(5):927-930.

(2.) Jimenez AP, Rey AL, Penagos LG, Ariza MF, Figueroa J, Iregui CA. Streptococcus agalactiae: Hasta ahora el unico Streptococcus patogeno de tilapias cultivadas en Colombia. Rev Med Vet Zoot 2007; 54(2):285-294.

(3.) Castro MP, Claudiano GS, Petrillo TR, Shimada MT, Belo MAA, Machado CMM, Moraes JRE, Manrique WG, Moraes FR. Acute aerocystitis in Nile tilapia bred in net cages and supplemented with chromium carbochelate and Saccharomyces cerevisiae. Fish Shellfish Immunol 2014; 36(1):284-290.

(4.) Padua SB, Menezes-Filho RN, Belo MAA, Nagata MM. Nutritional additive Increases the survival rate and decreases parasitism in tilapia during the masculinization. Aqua Culture Asia Pacific 2014; 10(5):24-27.

(5.) Sakabe R, Moraes FR, Belo MAA, Moraes JER, Pilarski F. Kinects of cronic inflammation in Nile tilapia supplemented with essential fatty acids n-3 and n-6. Pesq Agropec Bras 2013; 48(3):313-319.

(6.) Manrique WG, Claudiano GS, Petrillo TR, Castro MP, Figueiredo MAP, Belo MAA, Moraes JRE, Moraes FR. Response of splenic melanomacrophage centers of Oreochromis niloticus (Linnaeus, 1758) to inflammatory stimuli by BCG and foreign bodies. J Appl Ichthyol 2014; 30(5):1001-1006.

(7.) Marcusso PF, Yunis J, Claudiano GS, Manrique WG, Salvador R, Moraes JRE, Moraes FR. Sodium fluorescein for early detection of skin ulcers in Aeromonas hydrophila infected Piaractus mesopotamicus. Bull Eur Ass Fish Pathol 2014; 34(3):102-106.

(8.) Amal MNA, Zamri-Saad M. Streptococcosis in tilapia (Oreochromis niloticus): A review. Pertanika. J of Tropic Agricul Sci 2011; 34(2):195-206.

(9.) Agnew W, Barnes A. Streptococcus iniae: An aquatic pathogen of global veterinary significance and a challenging candidate for reliable vaccination. Vet Microb 2007; 122(1-2):1-15.

(10.) Haenen O, Evans J y Berthe F. Bacterial infections from aquatic species: potential for and prevention of contact zoonoses. Ver sci tech Off Int Epiz 2013; 32(2):497-507.

(11.) Guerrero, PMB, Leon, JP, Valdivia, LM. Produccion, comercializacion y perspectivas de desarrollo de la acuicultura peruana. Cientifica 2014; 11(2):U8-133.

(12.) Asencios YO, Sanchez FB, Mendizabal HB, Pusari KH, Alfonso HO, Sayan AM, Figueiredo MAP, Manrique WG, Belo MAA, Chaupe NS. First report of Streptococcus agalactiae isolated from Oreochromis niloticus in Piura, Peru: Molecular identification and histopathological lesions. Aquac Rep 2016; 4:74-79.

(13.) Manrique WG, da Silva C, de Castro MP, Petrillo TR, Figueiredo MP, de Andrade MA, et al. Expresion of cellular components in granulomatous inflammatory response in Piaractus mesopotamicus Model. PLosONE 2015; 10(3):e0121625.

(14.) Figueiredo HC, Nobrega L, Leal CA, Pereira U, Mian G. Streptococcus iniae outbreaks in Brazilian Nile Tilapia (Oreochromis niloticus) farms. Brazil J Microbiol 2012; 43(2):576-580.

(15.) Salvador R, Eckehardt E, de Freitas J, Leonhadt J, Garcia L, Alves J. Isolation and characterization of Streptococcus spp. Group B. in Nile tilapias (Oreochromis niloticus) reared in hapas nets and earth nurseries in the northern region of Parana State, Brazil. Ciencia Rural 2005; 35(6):1374-1378.

(16.) Hernandez E, Figueroa J, Iregui C. Streptococcosis on a red tilapia, Oreochromis sp., farm: a case study. J Fish Dis 2009; 32:247-252.

(17.) Anshary H, Kurniawan RA, Sriwulan S, Ramli R, Baxa DV. Isolation and molecular identification of the etiological agents of streptococcosis in Nile tilapia (Oreochromis niloticus) cultured in net cages in Lake Sentani, Papua, Indonesia. Springe-rPlus 2014;3:627.

(18.) Facklam R, Elliot J, Shewmaker L y Reingold A. Identification and characterization of sporadic isolates from humans. J Clin Microbiol 2005; 43(2):933-937.

(19.) Chen CY, Chao CB, Bowser PR. Comparative histopathology of Streptococcus iniae and Streptococcus agalactiae-infected tilapia. Bull Eur Ass Fish Pathol 2007; 27(1):2-9.

(20.) Bromage ES, Owens L. Infection of barramundi Lates calcarifer with Streptococcus iniae: effects of different troutes of exposure. Dis Aquat Org 2002; 52(3):199-205.

(21.) Cai SH, Wang B, Lu YS, Jian JC, Wu ZH. Development of loop-mediated isothermal amplification method for rapid detection of Streptococcus iniae, the causative agent of streptococcosis in fish. J Basic Microbiol 2012; 52:116-122.

(22.) Gibello A, Collins MD, Dominguez L, Fernandez-Garayzabal JF, Richardson PT. Cloning and analysis of the L-lactate utilization genes from Streptococcus iniae. Appl Environ Microbiol 1999; 65(10):4346-4350.

(23.) Mata AI, Blanco MM, Dominguez L, Fernandez-Garayzabal JF, Gibello A, Development of a PCR assay for Streptococcus iniae based on the lactate oxidase (lctO) gene with potential diagnostic value. Vet Microbiol 2004; 101: 109-116.

Yessica Ortega A [1] MV, Frank Barreiro S [2] Tec Acui, Gina Castro S [1] MV, Karina Huancare P [1] MV, Alberto Manchego S [1] M.Sc, Marco AA Belo [3,4] Ph.D, Mayra AP Figueiredo [5] Ph.D, Wilson G Manrique [3] Ph.D, Nieves Sandoval Ch [1] * M.Sc.

[1] National University of San Marcos, School of Veterinary Medicine, Department of Ictiopathology, Av. Circunvalacion 2800, San Borja-Lima, Peru, [2] Surcolombiana University, Laboratory of Genomic Medicine, St. 9 No 14-03 Barrio Altico, Neiva-Huila, Colombia, [3] Brazil University--Descalvado Campus. Department of Veterinary Pathology, Av. Hilario da Silva Passos, 950--Parque Universitario Descalvado, CEP: 13690-970, Sao Paulo--Brazil. [4] Sao Paulo State University, Deparment of Preventive Veterinary Medicine, Via de Acesso Paulo Donato Castellane, S/N, CEP 14.884-900, Jaboticabal/ SP-Brazil. [5] University of Sao Paulo, Department of Clinical Analysis, Toxicology and Food Scienc, Laboratory of Virology, Bloco S, 1[grados] Andar, Av. do Cafe, s/n--CEP: 14040-903--Ribeirao Preto, Brazil. Correspondence: nieves.sandovalchaupe@gmail.com

Received: December 2015; Accepted: August 2016.

Leyenda: Figure 1 Macroscopic findings compatible with Streptococcus spp. in in Oreochromis niloticus. a) Exophthalmia (arrow). b) Haemorrhagic lesions on skin (circle) and bleeding anal pore (arrow). c) Necrotic lesions on skeletal muscle (circle). d) Congestion of the brain (arrow). e) Ascites (arrow).

Leyenda: Figure 2. Histopathological findings in Oreochromis niloticus. a) Photomicrograph of the spleen showing a fibrinosupurative splenitis (star). b) Photomicrograph of the brain showing congestion (star) and mononuclear infiltrate (arrow). c) Photomicrograph of the heart showing of the thickened epicardium (star) and mononuclear inflammatory exudate on fibrin deposits (arrow). Hematoxilin-Eosine, Scale bar = 20 [micron]m.

Leyenda: Figure 3. Histopathological findings in Oreochromis niloticus. Photomicrograph of the hepatopancreas showing a granulome with aggregated macrophages (star) and free melanomacrophages (arrows). Hematoxilin-Eosine, Scale bar = 20 [micron]m.

Leyenda: Figure 4. Histopathological findings in Oreochromis niloticus. Photomicrograph of the hepatopancreas showing inflammatory exudate around of the hepatopancreas (star). Hematoxilin-Eosine, Scale bar = 20 [micron]m.

Leyenda: Figure 5. Histopathological findings in Oreochromis niloticus. Photomicrograph of the skeletal muscle showing coagulative necrosis (circle). Hematoxilin-Eosine, Scale bar = 20 [micron]m.

Leyenda: Figure 6. Histopathological findings in Oreochromis niloticus. Photomicrograph of the eye showing macrophages, neutrophils (arrows) and cells of the pigmentary epithelium (star). Hematoxilin-Eosine, Scale bar = 20 [micron]m.
Table 1. Biochemical profile and microbiological
characteristics from 19 isolates of
Streptococcus spp. of Oreochromis niloticus
from fish farm in Sullana-Piura, Peru.

Characteristics     Isolated     %

[beta]-Haemolysis      19       100%
CAMP                   19       100%
Starch hydrolysis      13      68.42%
Voges-Proskauer        10      52.63%
LAP                    14      73.68%
Mannitol               11      57.89%
Maltose                16      84.21%
Esculin                11      57.89%
PYR                    3       0.16%
Glucose                18      94.73%
Lactose                14      73.68%
Indole                 9       47.37%
[H.sub.2]S             17      89.47%
COPYRIGHT 2017 Universidad de Cordoba
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:ORIGINAL
Author:Ortega A., Yessica; Acui, Frank Barreiro S.Tec; Castro S., Gina; Huancare P., Karina; Manchego S., A
Publication:Revista MVZ (Medicina Veterinaria y Zootecnia)
Date:Jan 1, 2017
Words:7559
Previous Article:Pythiosis cutanea en equinos tratados con acetonida de triamcinolona. Parte 2. Descripcion histologica e histoquimica.
Next Article:Seroprevalencia y factores de riesgo de Neospora caninum en pequenas granjas lecheras de la zona central de Chile.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters