Printer Friendly

Errata.

Vol. 6, No. 5

In the article, "Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both [stx.sub.1] and [stx.sub.2], was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused.

Vol. 7, No. 1

In the International Update "Emerging Infectious Diseases in Russia, 1990-1999," by Sergey V. Netesov and J. Lyle Conrad, the area of Russia is given incorrectly. The area should be approximately 17,075,000 [km.sup.2]. We regret this error.

Vol. 7, No. 1

In the article "Quinolone and Macrolide Resistance in Campylobacter jejuni and C. coli: Resistance Mechanisms and Trends in Human Isolates," Figure 1, page 25, the genes should have been referred to as follows: gyrA and parC. In addition, Thr-90 should have been Asp-90. To view the correct figure, see URL: http://www.cdc.gov/ncidod/EID/ vol7no3/erratum.htm. We regret any confusion this error may have caused.
COPYRIGHT 2001 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Vol. 6, No. 5 and Vol. 7, No. 1
Publication:Emerging Infectious Diseases
Article Type:Correction Notice
Geographic Code:1USA
Date:May 1, 2001
Words:203
Previous Article:The Antibiotic Food-Chain Gang.
Next Article:Detail from La Primavera.
Topics:


Related Articles
1998 Index of Articles.
Erratum Vol. 5, No. 1.
1999 Index of Articles.
Stewart W. Holmes. (Profile).
News & notes.
Two proposed SSARS, Performance of Review Engagements and Standards for Accounting and Review Services, exposed for comment.

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters