Errata.
Vol. 6, No. 5In the article, "Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both [stx.sub.1] and [stx.sub.2], was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused.
Vol. 7, No. 1
In the International Update "Emerging Infectious Diseases in Russia, 1990-1999," by Sergey V. Netesov and J. Lyle Conrad, the area of Russia is given incorrectly. The area should be approximately 17,075,000 [km.sup.2]. We regret this error.
Vol. 7, No. 1
In the article "Quinolone and Macrolide Resistance in Campylobacter jejuni and C. coli: Resistance Mechanisms and Trends in Human Isolates," Figure 1, page 25, the genes should have been referred to as follows: gyrA and parC. In addition, Thr-90 should have been Asp-90. To view the correct figure, see URL: http://www.cdc.gov/ncidod/EID/ vol7no3/erratum.htm. We regret any confusion this error may have caused.
 Printer friendly
 Cite/link
 Email
 Feedback
| |
| Title Annotation: | Vol. 6, No. 5 and Vol. 7, No. 1 |
|---|---|
| Publication: | Emerging Infectious Diseases |
| Article Type: | Correction Notice |
| Geographic Code: | 1USA |
| Date: | May 1, 2001 |
| Words: | 203 |
| Previous Article: | The Antibiotic Food-Chain Gang. |
| Next Article: | Detail from La Primavera. |
| Topics: | |