Printer Friendly

Enterotoxigenic genes in strains of Staphylococcus spp., isolated from cheese made in Pamplona-Colombia/genes enterotoxigenicos en cepas de Staphylococcus spp., aisladas a partir de queso elaborado en Pamplona-Colombia.

INTRODUCTION

Foodborne Illnesses (FBI) are a growing problem to public health around the world, resulting in the ingestion of food contaminated with microorganisms, pluricellular organisms (helminthes), chemical and/or toxic substances. The most obvious clinical manifestations of FBIs are gastrointestinal: however, these illnesses can have chronic effects on health, including neurological, gynecological or immunological symptoms, as well as damage multiple organs, and cause cancer or death (1).

One of the most important etiologic agents of FBIs in the world is Staphylococcus aureus. The term "staphylococci" defines a group of Gram positive coco bacteria that divide on more than one plane to form three-dimensional cell bunches. Staphylococcus belongs to order I Bacillales of the Staphylococcaceae family (2); 18 species of Staphylococcus that affect food have been described, and coagulase positive ones such as S. aureus is the one that is most transmitted by food (3).

Staphylococci are normal inhabitants of the body surface of the majority of warm blooded animals, present in mucous and skin, and for this reason the most important source of these bacteria in food are nasal passages and food handlers that have wounds and/or boils on hands and arms; additionally, domestic animals such as cows can be bearers of this bacteria, since S. aureus is an important mastitis producer in milk-producing females, which contaminates cheese made from it (3).

Staphylococcus aureus produces a wide range of substances associated with virulence, among them enzymes, cytotoxins, exotoxins, exfoliative toxins and enterotoxins (4).

The main factor for virulence of Staphylococcus involved in staphylococcal food poisoning (SFP) is the production of enterotoxins (SE). S. aureus produces five typical toxins: SEA, SEB, SEC, SED and SEE, which produce emesis in primates. The enterotoxins that are best characterized are ESA and ESB; the most frequent outbreaks of ETAs are ESA and ESP (4). S. aureus enterotoxins are thermostable, and thus resist thermal treatments to which food is subjected (3).

FBI is acquired when consuming food where the microorganism has preformed one or several of its enterotoxins. Symptoms generally develop 6 hours after ingesting contaminated food, characterized by vomiting, nausea, abdominal spasms and diarrhea. It can cause death in persons whose autoimmune system is compromised. FBI is self-limiting and is not a notifiable illness, which means that many outbreaks and cases are not reported. In the United States of America (USA) it has been calculated that only from 1 to 5% of all food poisoning cases are reported; however, it is estimated that it causes 14% of the FBIs in the country (5). S. aureus is considered one of the principal agents causing FBIs in the world, and the pathogen is more frequently associated with cheese made with raw milk (6).

In the United States, it is calculated that more than 241,000 domestic cases of staphylococcal food poisoning (SFP) occur annually; keeping in mind that the hospitalization rate is 6.4% for confirmed laboratory cases, an average of 1,064 of these cases were hospitalized, resulting in 6 deaths (7). In France in 2008, S. aureus was confirmed as the second causative agent of FBIs after Salmonella and is the first suspected agent in 42.5% of FBI outbreaks.

In Latin America many types of fresh artisan cheese exist; within FBIs are SFPs. In provinces of countries in the region, such as Cuba and Argentina, S. aureus has been one of the principal bacteria implicated in FBI outbreaks in periods from 2004-2008 and 1993-2001, respectively, with artisan cheese being an important food involved in those outbreaks (8,9).

In Colombia, S. aureus is found among the principal microorganisms that are on the FBI surveillance network (10). Among published outbreaks is one that happened in the Atlantic Department in a school cafeteria from the Santo Tomas municipality and one that happened in the Honda municipality (Tolima), which affected people who participated in a community event; the causative agent in these outbreaks was S. aureus (11,12).

The objectives of this study were to detect the prevalence of positive Staphylococcus coagulasa in doble crema (double cream) cheese made in the city of Pamplona, establishing if the analyzed cheese samples did or did not comply with the allowable limits for this bacteria as established by the Colombian Technical Standard (NTC) 750, and also to determine the presence of genes that codify ESA, ESB, ESC, ESD and ESE enterotoxins in positive Staphylococcus coagulasa strains by means of the Polymerase Chain Reaction (PCR).

MATERIALS AND METHODS

Sampling. Over the course of a year, 100 samples of 200 g of doble crema (double cream) cheese made in Pamplona and sold in formally established places were collected. The samples were refrigerated and transported in the same conditions for immediate microbiological analysis.

Isolation of Staphylococcus. The NTC 4779 recommendation (13) was followed: 10 g of the sample was taken and homogenized in 90 mL of 0.1% peptonized water (Oxoid, Basingstoke, United Kingdom), making decimal dilutions up to [10.sup.-3]; later 0.1 mL of dilutions [10.sup.-3] y [10.sup.-2] were piped (depending on the sample, at times [10.sup.-1] and [10.sup.-2] o [10.sup.-3] and [10.sup.-4] dilutions were inoculated) on the previously prepared surface of the Baird Parker medium (Oxoid); the inoculated dilution was spread with the help of a Drigalsky loop until the surface was very dry, incubating at 35 [+ or -] 2[degrees]C for 48 hours. After the incubation time, plates that contained from 20-200 black, shiny colonies were selected having white shrunken borders and surrounded by clear areas that contrasted with the opaque medium, areas with precipitated calcium and magnesium salts, which were then counted; a minimum of three colonies were used for the coagulase test.

Testing the coagulase. The number of colonies to be confirmed were transferred in the same number of tubes that contained 5 mL of Brain Heart Infusion broth (BHI, Oxoid), concluding a positive control, incubating at 35 [+ or -] 2[degrees]C for 18-24 hours. After this time, 0.3 mL of each BHI broth was put into tubes that contained 0.3 mL of dehydrated plasma of rabbit-EDTA (bioMerieux SA, Marcy l'Etoile, France), and a tube of 0.3 mL of plasma as a negative control was also transferred, incubating at 35 [+ or -] 2[degrees]C. For the first six hours they were observed hourly, in negative cases the reading was extended to 24 hours. Once finalized the incubation time, the results were interpreted, based on tubes that presented plasma coagulation, comparing them with positive and negative controls. The calculation of positive Staphylococcus coagulasa was done keeping in mind the total number of colonies after 48 hours of incubation and the proportion of colonies confirmed for the coagulase test, using as a correction factor the relation: positive colonies/ examined colonies, reporting Colony Forming Units (CFU)/g.

Detecting enterotoxigenic genes. From the positive coagulase strains cultivated in Soy Tripticase broth (Oxoid) and incubated at 37[degrees]C for 24 hours, 1 mL was transferred, centrifuged in a Eppendorf 5415D micro centrifuge at 12,000 rpm/3 min. Later 200 [micro]L of Chelex (Bio-Rad, Hercules, California, USA) was added, the pellet was completely re-suspended and incubated at 56[degrees]C for 30 min. Each tube was agitated in a vortex for 10 seconds; later each tube was placed on a heating block (JP Selecta S.A, Barcelona) at 100[degrees]C for 8 minutes. Then each tube was again agitated and finally centrifuged at 12,000 rpm /3 min. The concentration of DNA used was quantified using a Spectrophotometer-UV Q3000 (Quawell, Beijing, China). Using 3 [micro]L of the DNA (50 ng/[micro]L approximately) the PCR was done, and for this, corresponding pairs of primers for each enterotoxin were used at a concentration of 25mM and a commercial cocktail, 5 PRIME MasterMix (Taq polimerase, buffer, dNTPs y [Mg.sup.+2]) (5 PRIME Hamburg, Germany). Different genes were amplified in a Mastercycler Personal (Eppendorf, Hamburg, Germany); the sequence of the primers used and the length of the amplified ones are shown in table 1 (14).

The amplification products (5 [micro]l) were subjected to electrophoresis in agarose gel (Bio-Rad) at 1% p/v at 100 V for 1 h. Visualization was done by means of staining with RedSafeTM (iNtRon Biotechnology, INC., Sungnam, Kyungki-Do, Korea), using a transiluminator ultraviolet light, Mini-Transiluminator (Bio-Rad) and documented with the Digimage System application connected to a Canon Power Shot G11 digital camera (Major Science, Taipei, Taiwan).

RESULTS

The prevalence of positive Staphylocuccus coagulase (SCP) in the analyzed samples was 31%. Additionally, 27% of the samples did not comply with NTC 750 (15), which establishes the microbiological requirements (among them positive Staphylococcus coagulase), for fresh cheese (Table 2). In 23% of the samples a concentration of SCP greater or equal to 104 UFC/g was found.

Of the 65 strains studied, genes that codified for the production of enterotoxins were found in 24.6% of the strains, which were isolated from 12 samples. The prevalence of genes for ESB, ESA and ESD in these strains was 18.5%, 4.6%, and 3.0%, respectively (Table 3, Figure 1). In one of the strains studied genes detected for ESA and ESB simultaneously. The presence of genes to produce ESC or ESE was not detected.

[FIGURE 1 OMITTED]

DISCUSSION

A high prevalence of SCP was found in the samples. These results concur with those found by Mendonca et al (16), who analyzed samples of fresh cheese sold in Brazil, determining a prevalence of 30.9%; similarly, data found by Maldonado and Llanca (17) in samples of cheese sold in Girardot, Aragua State, Venezuela, found SCP in 25% of the analyzed samples. However, these results are different from those found by other authors such as Rodriguez et al (18), who were not able to isolate SCP in samples of artisan cheese sold in Upata, Bolivar, Venezuela. Can and Celik (19) analyzed samples of cheese from Turkey, detecting SPC in 9.5% of the cheese samples. Jakobsen et al (20) detected SCP in 47.3% of samples of fresh artisan cheese made in Norway. In Colombia, Vanegas et al (10) isolated SCP in 100% of the samples sold in stores, on the street and in markets in Bogota.

On the other hand, an important percentage of samples did not comply with Colombian legislation that regulates these products (15). Different results were found by Giammanco et al, who determined that only 4% of the samples of traditional, fresh Sicilian cheese did not comply with European legislation (> [10.sup.3] CFU/g) (17). However, authors such as Maldonado and Llanca determined that 100% of samples of fresh cheese in the form of cakes sold in Girardot, Aragua State, Venezuela, did not comply with Covenin, the Venezuelan Commission of Industrial Regulations (> [10.sup.4] CFU/g). Lujan et al (22) determined that 80% of the samples of fresh artisan cheese sold in three districts of Lima, Peru, did not comply with the Peruvian Technical Standards (> [10.sup.2] CFU/g). Komatsu et al (23) detected that 88% of the samples of cheese made in the city of Uberlandia, Brazil, did not comply with the standards established by the Ministry of Health for S. aureus (5.0 x [10.sup.2] CFU/g).

The gene that codifies ESB was the main enterotoxic gene detected in this study, followed by ESA; results concur with the findings of Gucukoglu et al (24), who analyzed samples of ice cream and found that the main enterotoxin produced was ESB. Valero-Leal (25) also found that ESB was the main enterotoxin detected in samples of milk and fresh cow cheese from Zulia State (Venezuela). On the other hand, Vanegas et al (10) detected ESA in 100% of the SCP strains isolated from artisan cheese from Bogota.

It has been determined that ESB is responsible for close to 10% of FBIs in the USA (4). Its lethal dose 50 (LD50) is 0.02mcg/kg (26), and concentrations of this toxin of just 0.4 [micro]g/kg can induce symptoms in humans; additionally, it has been observed that individuals exposed to ESB manifest more severe symptoms than those exposed to ESA (5). On the other hand, it has been demonstrated that this enterotoxin maintains biological activity after heating to 60 [degrees]C for 16 hours, and the optimum temperature for producing it in cultures is 39.4[degrees]C (3), conditions that favor its presence in fresh cheese.

An important percentage of samples analyzed found a concentration of SCP greater or equal to [10.sup.4] CFU/g; the lowest number of S. aureus cells required to produce the minimum level of enterotoxins considered necessary to provoke illness depends on the type of enterotoxin. For example, ESA has been detected in concentrations of [10.sup.4] CFU/g (3); it is recognized, in general, that this value is found between [10.sup.5]-[10.sup.8] CFU/g (5). However, there is data from reported SFP outbreaks in which SCP counts are from 7.6 x 102 (27), a concentration found in 33% of the samples analyzed in this study.

Double cream cheese in Pamplona is made using raw milk and applying artisan processes where intrinsic and/or extrinsic factors do not exist that limit or control the presence of Staphylococcus aureus. Stretching, which is done between 40[degrees]C and 42[degrees]C, allows growth, since it can grow up to 47.8[degrees]C; the pH of the finished product (5.35.6) does not control growth or the spread of this bacteria, since it can grow in pH of up to 4.0; the percentage of salt in the cheese (3.47% NaCl), is not considered a limitation for this bacteria, since it is halotolerant and can survive in salt concentrations of up to 20% p/p (5). Additionally, contamination can occur in any stage of production, since making the product implies intense contact with handlers, utensils, environments, among others. These stages are done at temperatures above 25[degrees]C that favor the spread of the bacteria, since S. aureus has a generation time of 0.8 h at this temperature (28) and therefore produces enterotoxins.

On the other hand, the presence of this bacteria in this type of cheese could indicate contamination on the skin, mouth or nasal passages of handlers that came into direct contact with the food and did not follow minimal hygiene standards, such as the use of gloves, mouth coverings, caps or protective clothing, as well as poor cleaning of surfaces, equipment and utensils, which could be seen in some dairy microbusinesses in the province of Pamplona (29). Other sources of contamination could be milk with mastitis, work equipment and tools, air, dust and water. It is evident that inadequate cleaning and disinfecting practices increase the persistence of the bacteria in cheese processing equipment and environments, and the demonstrated resistance of S.aureus to disinfectants when a biofilm is formed is added to this (30).

In conclusion, a high prevalence of Staphylococcus was found in samples of double cream cheese made in Pamplona, reflecting inadequate hygiene practices and disinfection used all along the processing chain, so that it is necessary to train food handlers in Good Manufacturing Practices. Additionally, the storage temperature of milk and the finished product should be controlled so as to minimize the spread of the bacteria.

Finding enterotoxigenic genes in 24.6% of the analyzed strains that correspond to the toxins that are most frequently found in FBI outbreaks indicates that double cream cheese made in Pamplona can be a public health risk.

Acknowledgements

Universidad de Pamplona. Faculty of Basic Sciences, Department of Microbiology, students of the Semillero of the Investigation Group in Microbiology and Biotechnology, Paola Andrea Naranjo, Yelitza Lizcano and Vanessa Ortega.

INTRODUCCION

Las Enfermedades de Origen Alimentario (ETAs) son un problema creciente de salud publica en todo el mundo, resultando de la ingestion de alimentos contaminados con microorganismos, organismos pluricelulares (helmintos), sustancias quimicas y/o toxinas. Las manifestaciones clinicas mas evidentes de las ETAs son de tipo gastrointestinal: sin embargo, estas enfermedades pueden tener efectos cronicos sobre la salud, incluyendo sintomas neurologicos, ginecologicos o inmunologicos, como tambien dano a multiples organos, cancer y la muerte (1).

Dentro de los agentes etiologicos mas importantes de ETAs en el mundo se encuentra Staphylococcus aureus. El termino "estafilococos" define un grupo de bacterias en forma de cocos Gram-positivos que se dividen en mas de un plano para formar racimos tridimensionales de celulas. El genero Staphylococcus, pertenece al orden I Bacillales, familia Staphylococcaceae (2); se han descrito 18 especies de Staphylococcus de importancia en alimentos, siendo, las especies coagulasa-positivas como S. aureus las que mas se transmiten por alimentos (3).

Los estafilococos son habitantes normales de las superficies corporales de la mayoria de los animales de sangre caliente, encontrandose en las mucosas y en la piel, por esta razon la fuente mas importante de estas bacterias en los alimentos son los portadores nasales y las personas con heridas y/o forunculos en manos y brazos que manipulan los alimentos; adicionalmente, animales domesticos como vacas pueden ser portadores de esta bacteria ya que S. aureus es importante productor de mastitis en hembras lecheras contaminando el queso elaborado con la misma (3).

Staphylococcus aureus produce una gama amplia de sustancias asociadas con la virulencia, entre ellas enzimas, citotoxinas, exotoxinas, toxinas exfoliativas y enterotoxinas (4).

El principal factor de virulencia de Staphylococcus involucrado en la intoxicacion alimentaria estafilococica (IAE) es la produccion de enterotoxinas (SE). S. aureus produce cinco toxinas tipicas: SEA, SEB, SEC SED y SEE las cuales producen emesis en primates. Las enterotoxinas mejor caracterizadas son la ESA y ESB; las mas frecuentes en brotes de ETAs son la ESA y la ESB (4). Las enterotoxinas de S. aureus son termoestables, de tal manera que resisten los tratamientos termicos a los cuales se someten los alimentos (3).

La IAE, se adquiere al consumir un alimento en el cual el microorganismo ha preformado una o varias de sus enterotoxinas. Los sintomas se desarrollan, generalmente, 6 horas despues de la ingestion del alimento contaminado, caracterizandose por vomitos, nauseas, espasmos abdominales y diarrea. En personas inmunocomprometidas puede ocasionar la muerte. La IAE es autolimitante y no es una enfermedad de declaracion obligatoria, aspectos que hacen que muchos brotes y casos no se informen. En los Estados Unidos de Norteamerica (USA) se ha calculado que solo son declarados entre el 1 y el 5% de todos los casos por esta intoxicacion, a pesar de esto, se estima que es la causante del 14% de ETAs en ese pais (5). Se considera que S. aureus es uno de los principales agentes causales de ETAs en el mundo, y es el patogeno mas frecuentemente asociado a quesos elaborados con leche cruda (6).

En USA, se calcula que ocurren mas de 241,000 casos domesticos de IAE anualmente; teniendo en cuenta una tasa aproximada de hospitalizacion del 6.4%, para los casos confirmados en el laboratorio, en promedio 1,064 de estos casos fueron hospitalizados resultando en 6 muertes (7). En Francia, en el 2008, fue confirmado S. aureus como el segundo agente causal de ETAs despues de Salmonella y se le considera el primer agente sospechoso del 42.5% de los brotes de ETAs (6).

En Latinoamerica existen muchos tipos de quesos frescos artesanales; dentro de las ETAs se destaca la IAE. En provincias de paises de la region como Cuba y Argentina, S. aureus ha sido de las principales bacterias implicadas en brotes de ETAs en los periodos 2004-2008 y 1993-2001, respectivamente, resultando el queso artesanal un importante alimento involucrado en los mismos (8,9).

En Colombia, S. aureus se encuentra entre los principales microorganismos que se declaran en la red de vigilancia de ETAs (10). Dentro de los brotes publicados se destacan el sucedido en el departamento del Atlantico en el comedor de un colegio del municipio de Santo Tomas y el ocurrido en el municipio de Honda (Tolima) el cual afecto a personas que participaban de un evento comunitario; en estos brotes se implico como agente causal principal a S. aureus (11,12).

Los objetivos del presente trabajo fueron detectar la prevalencia de Staphylococcus coagulasa positivos en muestras de queso doble crema artesanal elaborado en la ciudad de Pamplona, estableciendo si las muestras de queso analizadas cumplian o no con los limites permisibles para esta bacteria establecidos por la Norma Tecnica Colombiana (NTC) 750 y tambien determinar la presencia de genes que codifican las enterotoxinas ESA, ESB, ESC, ESD y ESE, en las cepas de Staphylococcus coagulasa positivas, mediante la realizacion de la Reaccion en Cadena de la Polimerasa (PCR).

MATERIALES Y METODOS

Muestreo. Durante el lapso de un ano, se recolectaron 100 muestras de 200 g de queso doble crema elaborado en Pamplona, expendido en lugares formalmente establecidos. Las muestras fueron refrigeradas y transportadas en las mismas condiciones y realizando los analisis microbiologicos inmediatamente.

Aislamiento de Staphylococcus. Se siguio el protocolo recomendado por la NTC 4779 (13), asi: se tomaron 10 g de la muestra y se homogeneizaron en 90 mL de agua peptonada 0.1% (Oxoid, Basingstoke, United Kingdom), realizando diluciones decimales hasta [10.sup.-3]; posteriormente se pipeteo 0.1 mL de las diluciones [10.sup.-3] y [10.sup.-2] (dependiendo de la muestra en algunos casos se inocularon las diluciones [10.sup.-1] y [10.sup.-2] o [10.sup.-3] y [10.sup.-4]) sobre la superficie del medio Baird Parker (Oxoid), previamente preparado; se extendio el inoculo con ayuda de un asa de Drigalsky hasta que la superficie quedo bien seca, incubando a 35 [+ or -] 2[degrees]C durante 48 horas. Transcurrido el periodo de incubacion se seleccionaron las placas que contenian entre 20-200 colonias negras y brillantes con bordes reducidos blancos, rodeadas de zonas claras que contrastan con el medio opaco, zona de precipitado de sales de calcio y magnesio, las cuales fueron contadas; se tomo un minimo de tres colonias para realizar la prueba de la coagulasa.

Prueba de la coagulasa. Se transfirio el numero de colonias a confirmar en un mismo numero de tubos que contenian 5 mL de caldo Infusion Cerebro Corazon (BHI, Oxoid), incluyendo un control positivo, incubando a 35 [+ or -] 2[degrees]C durante 18-24 horas. Pasado este tiempo, se pasaron 0.3 mL de cada caldo BHI a tubos que contenian 0.3 mL de plasma deshidratado de conejo-EDTA (bioMerieux SA, Marcy l'Etoile, France), igualmente se transfirio a un tubo 0.3 mL del plasma como control negativo, incubando a 35 [+ or -] 2[degrees]C. Se observo cada hora durante las primeras seis horas, en caso negativo se realizo la lectura hasta las 24 horas. Una vez finalizado el tiempo de incubacion, se interpretaron los resultados, con base en los tubos que presentaron coagulacion del plasma, comparandolos con los controles positivos y negativos. Se realizo el calculo de Staphylococcus coagulasa positivo teniendo en cuenta el numero total de colonias despues de las 48 horas de incubacion y la proporcion de colonias confirmadas por la prueba de la coagulasa, utilizando como factor de correccion la relacion: colonias positivas/colonias examinadas, informando Unidades Formadoras de Colonia (UFC)/g.

Deteccion de genes enterotoxigenicos. A partir de las cepas coagulasa positivas crecidas en caldo Tripticasa de Soja (Oxoid), e incubadas a 37[degrees]C durante 24 horas, se transfirio 1 mL, centrifugando en una microcentrifuga Eppendorf 5415D a 12,000 rpm/3 min. Posteriormente se adicionaron 200 [micro]L de Chelex (Bio-Rad, Hercules, California, EEUU), resuspendiendo el "pellet" completamente e incubando a 56[degrees]C por 30 min. Se agito cada tubo empleando un vortex durante 10 segundos; luego se transfirio cada tubo a un bloque de calentamiento (JP Selecta S.A, Barcelona) a 100[degrees]C durante 8 minutos. Nuevamente se agito cada tubo y finalmente se centrifugo a 12,000 rpm /3 min. Se cuantifico la concentracion de ADN empleando un Espectrofotometro-UV Q3000 (Quawell, Beijing, China). Partiendo de 3 [micro]L del ADN (50 ng/[micro]L aproximadamente) se llevo a cabo la PCR, para esto, se emplearon los pares de cebadores correspondientes para cada enterotoxina a una concentracion de 25 mM y un coctel comercial 5 PRIME MasterMix (Taq polimerasa, buffer, dNTPs y [Mg.sup.+2]) (5 PRIME Hamburgo, Alemania). Fueron amplificados los diferentes genes en un equipo Mastercycler Personal (Eppendorf, Hamburgo, Alemania); la secuencia de los cebadores empleados y la longitud de los amplificados se muestran en la tabla 1 (14).

Se sometieron los productos de la amplificacion (5 [micro]l) a electroforesis en gel de agarosa (BioRad) al 1% p/v a 100 V durante 1 h. Se realizo la visualizacion mediante tincion con RedSafeTM (iNtRon Biotechnology, INC., Sungnam, Kyungki-Do, Korea), empleando un transiluminador de luz ultravioleta, Mini-Transiluminador (Bio-Rad) y documentando con la aplicacion del Digimage System acoplado a una camara digital Canon Power Shot G11 (Major Science, Taipei, Taiwan).

RESULTADOS

La prevalencia de Staphylocuccus coagulasa positivos (SCP) en las muestras analizadas fue del 31%. Adicionalmente, el 27% de las muestras incumplieron la NTC 750 (15), que establece los requisitos microbiologicos (entre ellos Staphylococcus coagulasa positivos), para queso fresco (Tabla 2). En el 23% de las muestras, se encontro una concentracion de SCP mayor o igual a [10.sup.4] UFC/g.

De 65 cepas estudiadas se detectaron genes que codificaron para la produccion de las enterotoxinas investigadas en el 24.6% de las cepas, las cuales fueron aisladas a partir de 12 muestras. La prevalencia de genes para ESB, ESA y ESD en estas cepas fue de 18.5%, 4.6%, y 3.0%, respectivamente (Tabla 3, Figura 1). En una de las cepas estudiadas se detectaron los genes para las ESA y ESB simultaneamente. No se detecto la presencia de genes para produccion de ESC ni ESE.

DISCUSION

Se encontro una alta prevalencia de SCP en las muestras. Estos resultados concuerdan con los hallados por Mendonca et al (16) quienes analizaron muestras de queso fresco expendido en Brasil, determinando una prevalencia del 30.9%; de igual forma se relaciona con los datos hallados por Maldonado y Llanca (17), en muestras de queso comercializado en Girardot estado Aragua, Venezuela quienes encontraron SCP en el 25% de las muestras analizadas. Sin embargo, estos resultados distan de los hallados por otros autores como Rodriguez et al (18) quienes no lograron aislar SCP en muestras de queso artesanal comercializado en Upata, Bolivar, Venezuela. Can y Celik (19) analizaron muestras de queso de origen turco, detectando SCP en el 9.5% de las muestras de queso. Jakobsen et al (20), detectaron SCP en el 47.3% de muestras de queso fresco elaborado artesanalmente en Noruega. En Colombia, Vanegas et al (10) aislaron SCP en el 100% de muestras de queso expendido en tiendas, ventas callejeras y mercados de la ciudad de Bogota.

Por otro lado, un importante porcentaje de muestras incumplieron la legislacion colombiana que reglamenta estos alimentos (15). Resultados diferentes hallaron Giammanco et al, quienes determinaron que solo el 4% de las muestras de queso fresco tradicional siciliano incumplian la legislacion europea (> [10.sup.3] UFC/g) (17). Sin embargo, otros autores como Maldonado y Llanca determinaron que el 100% de las muestras de queso fresco en forma de torta expendido en Girardot, estado Aragua, Venezuela incumplian la norma de la Comision Venezolana de Normas Industriales Covenin (> [10.sup.4] UFC/g). Lujan et al (22) determinaron que el 80% de muestras de queso fresco artesanal comercializado en tres distritos de Lima, Peru, incumplian la Norma Tecnica Peruana (> [10.sup.2] UFC/g). Komatsu et al (23) detectaron que el 88% de las muestras de queso elaborados en la ciudad de Uberlandia, Brasil, incumplian la norma establecida por el Ministerio de Salud para S. aureus (5.0 x [10.sup.2] UFC/g).

El gen que codifica la ESB fue el principal gen enterotoxico detectado en este estudio, seguido de la ESA; resultado que concuerda con los hallados por Gucukoglu et al (24) quienes analizando muestras de helado de crema, y encontraron que la principal enterotoxina producida fue la ESB. Valero-Leal (25), tambien hallaron que la ESB fue la principal enterotoxina detectada en muestras de leche y queso freso de vaca originarios del estado Zulia (Venezuela). Por otro lado Vanegas et al (10), detectaron la ESA en el 100% de las cepas SCP aisladas a partir de queso artesanal procedente de Bogota.

Se ha determinado que la ESB es responsable de cerca del 10% de los brotes de ETAs en USA (4). Su dosis letal 50 (LD50) es 0.02mcg/kg (26), concentraciones de esta toxina de tan solo 0.4 [micro]g/kg pueden inducir los sintomas en humanos; adicionalmente, se ha observado, que individuos expuestos a la ESB manifiestan sintomas mas severos que los expuestos a la ESA (5). De otra parte, se ha demostrado que esta enterotoxina retiene su actividad biologica luego del calentamiento a 60[degrees]C durante 16 horas, y la temperatura optima para su produccion en medio de cultivo es de 39.4[degrees]C (3), condiciones que favorecen su presencia en queso fresco.

En un porcentaje importante de las muestras analizadas, se encontro una concentracion de SCP mayor o igual a 104 UFC/g; el menor numero de celulas de S. aureus requeridos para la produccion del nivel minimo de enterotoxinas considerado necesario para provocar enfermedad depende del tipo de enterotoxina, por ejemplo la ESA se ha detectado en concentraciones de [10.sup.4] UFC/g (3); se reconoce, en general, que este valor se encuentra entre 105-108 UFC/g (5). Sin embargo, existen datos de brotes de IAE en los cuales se reportaron recuentos de SCP desde 7.6 x 102 (27), concentracion encontrada en el 33% de las muestras analizadas en este trabajo.

La elaboracion del queso doble crema, en Pamplona, se realiza empleando leche cruda como materia prima, aplicando procesos artesanales en los que no existen factores intrinsecos y/o extrinsecos, que limiten o controlen la presencia de Staphylococcus aureus: en primer lugar la etapa de hilado, que se realiza entre 40[degrees]C y 42[degrees]C, permite su crecimiento ya que puede crecer hasta los 47.8[degrees]C; el pH del producto terminado (5.3-5.6) no controla el crecimiento ni la multiplicacion de esta bacteria porque puede crecer a pH incluso de 4.0; el porcentaje de sal del queso (3.47% NaCl), no se considera limitante para esta bacteria ya que es halotolerante soportando concentraciones de sal hasta del 20% p/p (5). Adicional mente, se puede presentar contaminacion en cualquier etapa del proceso de elaboracion ya que la obtencion del producto implica etapas con elevado contacto con manipuladores, utensilios, ambientes, entre otros, etapas que se realizan a temperaturas superiores a 25[degrees]C que favorecen la multiplicacion de la bacteria, ya que S. aureus presenta un tiempo de generacion en la leche de 0.8 h a esta temperatura (28), y por ende la produccion de enterotoxinas.

Por otra parte, la presencia de esta bacteria en este tipo de queso podria indicar contaminacion a partir de la piel, boca o fosas nasales de los manipuladores que entraron en contacto directo con el alimento y no contaban con las minimas normas de higiene, como el uso de guantes, tapa bocas, gorros y batas, ademas de la deficiente higiene de superficies, equipos y utensilios, lo cual pudo comprobarse en algunas microempresas lacteas de la provincia de Pamplona (29). Otras fuentes de contaminacion pueden ser, leche con mastitis, equipos y utensilios de trabajo, aire, polvo y agua. Es evidente que inadecuadas practicas de limpieza y desinfeccion aumentan la persistencia de la bacteria en los equipos y ambientes de procesamiento del queso; a esto hay que sumar la demostrada resistencia de S.aureus a desinfectantes cuando forma biopeliculas (30).

En conclusion, se encontro una alta prevalencia de Staphylococcus en las muestras de queso doble crema elaborado en Pamplona, reflejando inadecuadas practicas de higiene y desinfeccion empleadas a lo largo de toda la cadena de procesamiento del mismo, de tal manera que se debe capacitar a los manipuladores en Buenas Practicas de Manufactura. Ademas, se deben controlar la temperatura de almacenamiento de la leche y del producto terminado para minimizar la multiplicacion de la bacteria.

El hecho de encontrar en el 24.6% de las cepas analizadas, genes enterotoxigenicos correspondientes a las toxinas mas frecuentemente implicadas en brotes de ETAs, indica que el queso doble crema elaborado en Pamplona puede representar un peligro para la salud publica.

Agradecimientos

A la Universidad de Pamplona. Facultad de Ciencias Basicas, Departamento de Microbiologia, estudiantes del Semillero del Grupo de Investigacion en Microbiologia y Biotecnologia, Paola Andrea Naranjo, Yelitza Lizcano y Vanessa Ortega.

REFERENCES

(1.) Haagsma J, Polinder S, Stein C, Havelaar A. Systematic review of foodborne burden of disease studies: Quality assessment of data and methodology. Int J Food Microbiol 2013; 166(1):34-47.

(2.) Yakoubou S, Xu D, Cote JC. Phylogeny of the Order Bacillales inferred from 3' 16S rDNA and 5' 16S-23S ITS nucleotide sequences. Nat Sci 2010; 2(9):990-997

(3.) Jay J, Loessner M, Golden D. Modern Food Microbiology. Seventh Edition. New York: Springer; 2005.

(4.) Pinchuk I, Beswick E, Reyes V. Review Staphylococcal Enterotoxins. Toxins 2010; 2(8):2177-2197.

(5.) Doyle M, Buchanan R. Food Microbiology: Fundamentals and Frontiers. 4 th edition. Washington: ASM Press; 2013.

(6.) Cretenet M, Even S, Le Loir Y. Unveiling Staphylococcus aureus enterotoxin production in dairy products: a review of recent advances to face new challenges. Dairy Sci Technol 2011; 91(2):127-150.

(7.) Scallan E, Hoekstra R, Angulo F, Tauxe R, Widdowson M, Roy S, Lones J, Griffin M. Foodborne illness acquired in the United States-Major pathogens. Emerg Infect Dis 2011; 17(1):7-15.

(8.) Lopez D, Rivero E, Martinez A, Alegret M. Enfermedades transmitidas por alimentos en Villa Clara. Rev Cubana Hig Epidemiol 2013;51(2):203-213.

(9.) Di Pietro S, Haritchabalet K, Cantoni G, Iglesias L, Mancini S, Temperoni A, Labanchi J, Barbarossa N, Garcia M, Cofre M, Rosales S, Herrero E, Bigatti R, Orellana O, Larrieu E. Vigilancia epidemiologica de enfermedades transmitidas por alimentos en la Provincia de Rio Negro, Argentina, 1993-2001. Medicina 2004; 64(2):120-124.

(10.) Vanegas M, Gonzalez L, Martinez A, Buitrago F. Aislamiento y caracterizacion de cepas de Staphylococcus enterotoxigenicos aislados de quesos en Bogota. Rev MVZ Cordoba 2008; 13(2):1288-1293.

(11.) Guerra-Sarmiento M, Palacios-Gonzalez D, Maestre-Serrano R, Baena-Del Valle J, Gomez-Camargo D. Identificacion de Agentes Etiologicos Aislados de Muestras Biologicas en Brote por Intoxicacion Alimentaria en el Departamento de Atlantico, Colombia 2008. Rev Cienc Biomed 2013; 4(2):233-241.

(12.) Santos M, Santos C, Gonzalez J, Lopez M. Brote de intoxicacion alimentaria en el municipio de Honda, Tolima, Colombia, Junio de 2009. Inf Quinc Epidemiol Nac 2009; 14(21):321-327.

(13.) NTC 4779. Norma Tecnica Colombiana. Microbiologia de alimentos y alimentos para animales. Metodo horizontal para el recuento de Estafilococos coagulasa positiva (Staphylococcus aureus y otras especies). Bogota, D.C.: Instituto Colombiano de Normas Tecnicas y Certificacion (ICONTEC); 2007. URL Disponible en: http://tienda.icontec.org/ brief/NTC4779.pdf

(14.) Linage B, Rodriguez-Calleja J, Otero A, Garcia-Lopez M, Santos J. Characterization of coagulase-positive staphylococci isolated from tank and silo ewe milk. J Dairy Sci 2012; 95(4):1639-1644.

(15.) NTC 750. Norma Tecnica Colombiana. Productos Lacteos. Queso. Bogota, D.C.: Instituto Colombiano de Normas Tecnicas y Certificacion (ICONTEC); 2000. URL Disponible en: http://tienda.icontec.org/brief/ NTC750.pdf

(16.) Mendonca M, Nogueira V, Keizo Y, Tassinari O, Nero L. Foodborne pathogens and microbiological characteristics of raw milk soft cheese produced and on retail sale in Brazil. Foodborne Pathog Dis 2009; 6(2):245-249.

(17.) Maldonado R, Llanca L. Estudio de la calidad del queso de mano comercializado en el municipio Girardot, estado Aragua, Venezuela. Rev Cientif FCV-LUZ 2008; 18(4):431-436.

(18.) Rodriguez C, Caldas L, Ogeerally P. Calidad sanitaria en queso artesanal tipo "telita". Upata, estado Bolivar, Venezuela. Rev Soc Venezolana Microb 2009; 29(2):98-102.

(19.) Can H, Celik T. Detection of enterotoxigenic and antimicrobial resistant S. aureus in Turkish cheeses. Food Cont 2012; 24(1-2):100-103.

(20.) Jakobsen R, Heggebo R, Sunde E, Skjervheim M. Staphylococcus aureus and Listeria monocytogenes in Norwegian raw milk cheese production. Food Microbiol 2011; 28(3):492-6.

(21.) Giammanco G, Pepe A, Aleo A, D'Agostino V, Milone S, Mammina C. Microbiological quality of Pecorino Siciliano "primosale" cheese on retail sale in the street markets of Palermo, Italy. New Microbiol 2011; 34(2):179-185.

(22.) Lujan D, Valentin M, Molina M. Evaluacion de la presencia de Staphylococcus aureus en quesos frescos artesanales en tres distritos de Lima - Peru. Respyn (en linea) 2006. (Fecha de acceso 3 de Abril de 2014); 7(2). URL disponible en: http://www.respyn.uanl.mx/ vii/2/articulos/quesos_frescos-1.htm

(23.) Komatsu R, Rodrigues M, Loreno W, Santos K. Ocorrencia de Staphylococcus coagulase positiva em queijo minas frescal produzido em Uberlandia-MG / Occurrence of Staphylococcus coagulase positiva in fresh minas cheese produced in Uberlandia-MG. Biosci J 2010; 26(2):316-321.

(24.) Gucukoglu A, Cadirci O, Terzi G, Kevenk TO, Ali[section]arli M. Determination of enterotoxigenic and methicillin resistant Staphylococcus aureus in ice cream. J Food Sci 2013; 78(5):738-741.

(25.) Valero-Leal K, Rivera-Salazar J, Valbuena, E, Boscan L, Valeris R, Castro G, Brinez W. Caracterizacion bioquimica y produccion de enterotoxinas de cepas de Staphylococcus aureus aisladas de leche cruda y queso fresco artesanal en fincas del estado Zulia. Rev Cientif FCV-LUZ 2012; 22(4):303-314.

(26.) Ahanotu E, Alvelo-Ceron D, Ravita T, Gaunt E. Staphylococcal Enterotoxin B as a Biological Weapon: Recognition, Management, and Surveillance of Staphylococcal Enterotoxin. Appl Biosaf 2006; 11(3):120-126.

(27.) Kerouanton A, Hennekinne J, Letertre C, Petit L, Chesneau O, Brisabois A, De Buyser ML. Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int J Food Microbiol 2007; 115(3):369-375.

(28.) Le Marc, Valik l, Medvedova A. Modelling the effect of the starter culture on the growth of Staphylococcus aureus in milk. Int J Food Microbiol 2009; 129(3):306-311.

(29.) Daza A, Herrera F, Naranjo A. Condiciones higienico-sanitarias aplicadas en la elaboracion de queso doble crema manufacturado en tres empresas de la provincia de Pamplona-Colombia. Bistua 2013; 11(2):61-73

(30.) Cabrera C, Gomez R, Zuniga A. La resistencia de bacterias a antibioticos, antisepticos y desinfectantes; una manifestacion de los mecanismos de supervivencia y adaptacion. Colomb Med 2007;38(2):149-158.

Fanny Herrera A, [1] * Ph. D, Jesus Santos B, [2] Ph.D.

[1] Universidad de Pamplona, Facultad de Ciencias Basicas, Departamento de Microbiologia, Grupo de Investigacion en Microbiologia y Biotecnologia (GIMBIO). Ciudad Universitaria, Pamplona, Norte de Santander, Colombia. [2] Universidad de Leon, Facultad de Veterinaria, Departamento de Higiene y Tecnologia de los Alimentos. Campus de Vegazana, A.A. Nro. 24071, Leon, Espana. Correspondencia: fannyh@unipamplona.edu.co

Received: April 2014; Accepted: November 2014.
Table 1. Genes, primers, hybridization temperatures,
and sizes expected in amplicons used to
determine the presence of enterotoxin genes
in positive S.aureus coagulase strains.

                                      TH
Gen   Primer Sequence (5' a 3')  ([degrees]C)   LEA (pb)

sea   ACGATCAATTTTTACAGC              56          544
      TGCATGTTTTCAGAGTTAATC

seb   GAATGATATTAATTCGCATC            55          416
      TCTTTGTCGTAAGATAAACTTC

sec   GACATAAAAGCTAGGAATTT            56          257
      AAATCGGATTAACATTATCCA

sed   TTACTAGTTTGGTAATATCTCCTT        58          334
      CCACCATAACAATTAATGC

see   ATAGATAAAGTTAAAACAAGCAA         52          170
      TAACTTACCGTGGACCC

TH: Temperature of hybridization; LEA: Expected amplicon length

Table 2. Quality of double cream samples studied
according to the positive Staphylococcus
coagulase count.

UFC/g               % SAMPLES      QUALITY
                    (N = 100)      CRITERIA

[greater than or        72           Good
equal to] 100

>100-1000               1        Marginally
                                  acceptable

>1000                   27       Inacceptable

(1): according to NTC 750

Table 3. Relationship of samples and strains
in which the studied enterotoxinogenic genes
were detected.

                    DETECTED
                  ENTEROTOXENIC
SAMPLE   STRAIN        GEN

9          8           ESD
12         9           ESD
29         15          ESB
29         16          ESB
50         45          ESB
54         54          ESA
67         57          ESA
70         59        ESA/ESB
70         60          ESB
78         61          ESB
78         62          ESB
78         63          ESB
80         64          ESB
82         65          ESB
83         66          ESB
84         67          ESB
COPYRIGHT 2015 Universidad de Cordoba
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:ORIGINAL
Author:Herrera, Fanny A.; Santos, Jesus B.
Publication:Revista MVZ (Medicina Veterinaria y Zootecnia)
Date:Jan 1, 2015
Words:6655
Previous Article:Quality index method developed for gutted and unguttedred tilapia (Oreochromis ssp)/Esquema del metodo indice de calidad desarrollado para tilapia...
Next Article:The search for the mdr1-1[DELTA] mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study)/Busqueda de la mutacion mdr1-1[DELTA]...

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters