Printer Friendly

Endothelial nitric oxide synthase and angiotensin converting enzyme gene polymorphisms in migraine patients/Migren hastalarinda endotelyal nitrik oksit sentaz ve anjiyotensin donusturucu enzim gen polimorfizmleri.

ABSTRACT

Introduction: In this study, we investigated the association of migraine with the Variable Number of Tandem Repeats (VNTR), repeated as 27 base pair, gene polymorphism in intron 4 of the endothelial nitric oxide synthase (e/VOS) and the insertion/deletion of angiotensin converting enzyme (ACE) gene polymorphisms.

Methods: One hundred and five migraine and ninety seven healthy female control subjects were enrolled in the study. The patients were subdivided as migraine with aura and without aura, and the frequency and severity of migraine headaches were recorded. The eNOS VNTR (e/VOS 4 a/b) and ACE insertion/deletion gene polymorphisms (ACE I/D) were assessed by polymerase chain reactions.

Results: The allele and genotype frequencies of eNOS 4 a/b gene polymorphism showed no difference between the migraine and control groups. The genotypic distribution of the ACE l/D gene polymorphism in the migraine group significantly differed from that in the control group. The DD and ID genotype increased the risk of migraine as much as 2.571 (95% CM. 138-5.811) and 4.453 (95% CI-2.006-9.883) compared to the II genotype. The same increased risk sustained for both genotypes in the migraine with aura subgroup, but only the ID genotype remained as the risk factor in the migraine without aura subgroup (OR-3.750, 95% CI-1.493-9.420). No association of gene polymorphisms with migraine frequency and severity was observed.

Conclusion: Our findings support the relationship between migraine and the ACE l/D gene polymorphism. However, no association was found between migraine and the e/VOS4 a/b gene polymorphism. (Archives of Neuropsychiatry 2013; 50:274-278) Key words: Migraine, genetic polymorphism, nitric oxide synthase, angiotensin converting enzyme

Conflict of interest: The authors report ed no conflict of interest related to this article

OZET

Giris: Bu calismada migren ile endotelyal nitrik oksit sentaz (e/VOS) geni intron 4'de, 27 bazlik tekrarlardan olusan Ardisik Kopya Sayisi Tekrarlari (VNTR) ve anjiyotensin donusturucu enzim IADE) genindeki insersiyon/delesyon polimorfizmlerinin iliskisi arastirildi.

Yontemler: Calismaya 105 migren basagrisi olan ve 97 saglikli kadin birey alindi. Migren hastalari aurali ve aurasiz olmak uzere iki gruba ayrilirken, migren atak sikligi ve siddeti kaydedildi. eNOS VNTR (eNOS 4a/b) ve ADE insersiyon/delesyon polimorfizmleri (ADE I/D) polimorfizmleri polimeraz zincir reaksiyonu yontemi ile belirlendi.

Bulgular: eNOS 4 a/b gen polimorfizminin alel ve genotip sikliklari migren ile kontrol grubu arasinda farklilik gostermedi. ADE l/D gen polimorfizminin migren grubunda genotipik dagilimi kontrol grubundan anlamli olarak farkli bulundu. DD ve ID genotiplerinin II genotipine gore migren olasiligini 2,571 (%95 CI-1,138-5,811) ile 4,453 (%95 Cl-2,006-9,883) oraninda artirdigi saptandi. Ayni risk artisi aurali migren alt grubunda her iki genotip icin surerken, aurasiz migren grubunda sadece ID genotipi icin korundu (OR- 3,750, %95 Cl-1,493-9,420). Migren sikligi ve siddeti ile gen polimorfizmleri arasinda iliski gozlenmedi.

Sonuc: Calismamiz ADE I/D gen polimorfizmi ile migren iliskisini desteklemistir. Ancak eNOS 4 a/b gen polimorfizmi ile migren arasinda iliski gosterilememistir. (Noropsikiyatri Arsivi 2013; 50:274-278)

Anahtar kelimeler: Migren, genetik polimorfizm, nitrik oksit sentaz, anjiyotensin donusturucu enzim

Cikar catismasi: Yazarlar bu makale ile ilgili olarak herhangi bir cikar catismasi bildirmemislerdir.

Giris

Migren tipi basagrisi toplumun yaklasik %12-18'ni etkileyen, onemli isgucu kaybina yol acan bir hastaliktir. Etyolojisi ve patofizyolojisi henuz net olarak aydinlatilamamistir. Ailesel sikligi nedeniyle genetik etkenler, sigara dumani, parfum kokusu, acik hava gibi tetikleyici faktorler nedeniyle de cevresel etkenlerin etyolojide rol oynadigi dusunulmektedir. Migrenin karmasik bir genetik zemini vardir ve bugun icin sorumlu tutulabilecek gen sayisi ve genetik yatkinlik alelleri netlesmemistir (1,2). Familyal hemiplejik migrende CACNA1A genindeki mutasyona bagli olarak P/Q tipi kalsiyum kanallarinin disfonksiyonu gosterilmistir (3). Pek cok gen polimorfizmleri de migren ve migren alt tipleri ile iliskisi yonunden arastirilmakta ve bu arastirmalarin sonucunda farkli sonuclar bildirilmektedir (4,5,6,7). Migrene genetik yatkinligi olan bireylerde trigeminovaskuler sistemin aktivasyonu ile norojenik inflamasyon ve sonucunda agri yanitinin ortaya cikisi muhtemel patofizyolojik mekanizma olarak kabul gormektedir. Nitrik oksit (NO) bu surecte duz kaslarin gevsemesi ile vazodilatasyona yol acmakta ve basagrisi baslangicinda onemli bir yer tutmaktadir (8). Agri fazinda NO duzeyi trombositlerde artmakta ve ekzojen NO basagrisini kotulestirmektedir (9). Nitrik oksitin trigeminal noronlarda norojenik inflamasyonun onemli bir mediatoru olan kalsitonin geni ile iliskili peptid duzeylerini de artirdigi gosterilmistir (10).

Nitrik oksit sentaz enzimi L-arjinin ve oksijen molekulunden NO sentezlenmesinde rol oynar. Bu enzimi kodlayan genlerin polimorfizmlerinin bazal NO duzeylerini etkiledigi gosterilmistir (11). Bir calismada NOS gen polimorfizminin aurali migren icin bagimsiz bir risk faktoru oldugunu bildirirken (12), diger calismalar bu iliskiyi desteklememistir (13,14).

Renin anjiyotensinsistemi(RAS)vaskulerreaktiviteyi duzenleyen bir sistem olup, ADE ve anjiyotensin 1 gen polimorfizmlerinin migren ile iliskisi belirsizdir (15, 16, 17). Ancak ADE inhibitoru lisinopril (18) ve anjiyotensin 1 reseptor blokeri olmesartanin (19) migren proflaksisinde etkinliginin gosterilmesi RAS sistemi ile migren arasinda olasi bir iliskiyi dusundurmektedir. Anjiyotensin donusturucu enzim DD genotipinin vaskuler tonusu arttirdigi, duz kas hipertrofisi, dusuk bradikinin duzeyi ve hiperkoagulabiliteye yol actigi oldugu bildirilmistir (19,20,21).

Biz calismamizda migren ve altturleri ile eNOS 4 a/b ve ADE I/D gen polimorfizmleri arasinda iliskiyi arastirmayi amacladik.

Yontem

Calismaya 105 migreni olan ve 97 saglikli kadin olgu alindi. Tum migren hastalari Noroloji Polikliniklerinde noroloji uzmanlari tarafindan degerlendirildi. Migren tanisi II. Basagrisi Bozukluklari Uluslararasi Siniflandirma Kriterlerine g ore konuldu (22). Tum hastalarin norolojik muayeneleri normaldi. Kontrol grubu gonullu sagliklilar, saglik personeli ve kadin dogum servisinde dogum yapmis olgulardan olusturuldu. Migren olgularinin basagrisi sikligi bir ayda atak sayisi olarak kaydedildi, agri siddeti ise gorsel analog olcek uzerinde belirlendi. Hasta ve kontrol grubunda olgularda hipertansiyon, diabetes mellitus, sigara kullanimi, ailede migren oykusu sorgulandi ve kaydedildi.

Calisma yerel etik kurul tarafindan onaylanmis ve olgulardan bilgilendirilmis onay formlari alinmistir.

DNA Izolasyonu

Icinde antikoagulan olarak ethylenediamine-tetraacetic acid (EDTA) bulunan tuplere 2 ml periferik kan toplandi. DNA, EDTA iceren kandan DNA izolasyon kiti (High Pure PCR Template Preparation Kit, Roche USA) ile izole edildi.

DNA safligi ve miktari spektrofotometrede 260 nm ve 280 nm'deki absorbans degerlerine gore belirlendi. DNA'lar %0,8 agoroz jel elektroforezinde yurutulerek EtBr ile boyandiktan sonra UV isigi altinda incelendi.

eNOS 4 a/b Gen Polimorfizminin Genotiplemesi

eNOS geni 21 kilo baz uzunlugunda 7q35-36 kromozomunda lokalizedir. eNOS intron 4 VNTR tekrarlanan bolgesi, 4 veya 5 kez tekrarlanmaktadir. Bu bolgenin 5 tekrari (b), 4 tekrari ise (a) olarak genotiplendirilir.

eNOS 4 a/b polimorfizminin degerlendirilmesinde F:5'AGGCCCTATGGTAGTGCCTT-3' ve R:5'-TCTCTTAGTG CTGT GGTCAC-3' primerleri kullanildi (23). Her bir primerden 0,5 nmol, 0,2 mM dNTP, 2,5 mM Mg[Cl.sub.2], 1X Taq Buffer (75 mM Tris-HCI pH 8,8, 20 mM [(N[H.sub.4]).sub.2]S[O.sub.4], %0,01 Tween 20), 0,75 unite Taq DNA polimeraz ve 100 ng genomik DNA eklenerek toplam 15 [micro]l olacak sekilde polimeraz zincir reaksiyonu (PZR) yapildi. PZR protokolu 94 [degrees]C'de 1 dakika baslangic denaturasyonu ile basladi, bunu 38 donguden olusan; 25 saniye 95 [degrees]C'de denaturasyon, 35 saniye 56 [degrees]C'de baglanma, 40 saniye 72 [degrees]C'de uzama takip etti ve sonunda 72 [degrees]C'de 5 dakika son uzama asamasi ile tamamlandi (23). Urunler EtBr iceren %2,5'lik agaroz jel elektroforezinde 110 volt'ta yurutuldu. UV isigi altinda incelendi ve polimorfizmlertanimlandi (Sekil 1).

ADE (I/D) gen polimorfizminin genotiplemesi

ADE geni 17. kromozomda(17q23,3),21 kbuzunlugunda, 26 ekson ve 25 introndan olusur. ADE (I/D) gen polimorfizmi 16. intronda tekrarlanan Alu dizisinin (274 baz cifti) varligiyla (Insersiyon) veya yokluguyla (Delesyon) ile karakterizedir.

Hasta ve kontrollerden izole edilen DNA'larla, ADE (l/D) polimorfizmini (rs4646994) belirlemek icin PZR yontemi kullanildi. 15 [micro]l'lik PZR hacmi icinde; 1X Taq Buffer, 2,5 mM Mg[Cl.sub.2], 0,2 mM dNTP 0,75 unite Taq DNA polimeraz, her primerden 0,5 nmol (F:5'CTGGAGACCACTCCCATCCTTTCT-3' ve R:5'GACGTGGCCATCACATTCGTCA GAT-3') ve 100 ng DNA kullanildi (24).

PZR protokolu; baslangic denaturasyonu 94 [degrees]C'de 5 dakika, 30 dongu icin; 94 [degrees]C'de 1 dakika denaturasyon, 58 [degrees]C'de 1 dakika baglanma ve 72 [degrees]C'de 1 dakika uzama, son olarak 72 [degrees]C'de 7 dakika uzama asamalari uygulandi (24). Urunler EtBr iceren %2'lik agaroz jel elektroforezinde 110 volt'ta yurutuldu. UV isigi altinda incelendi ve polimorfizmlertanimlandi (Sekil 2).

Istatistiksel Analiz

Sonuclar ortalamatstandart sapma ya da yuzde olarak ifade edildi. Gruplardan elde edilen degerlerin normal dagilimlara uygunlugu tek orneklem Kolmogrov-Smirnov testi ile analiz edildi. Gruplarin klinik ozelliklerinin kiyaslanmasinda Student-t testi kullanildi. Alel sikligi her iki grup genotiplerinden hesaplanarak Hardy Weinberg Denkligi testi ile analiz edildi. Iki grupta genotip ve alel farkliliklari Ki-kare testi ile karsilastirilarak odds orani ve %95 guven araligi degerleri hesaplandi. Genotip ve alel gruplarinin klinik ozellikler ile iliskisi Pearson korelasyon testi ile test edildi. p<0,05 istatistiksel olarak anlamli kabul edildi. Istatistiksel Analizler icin SPSS 19.0 ve Stata 12.0 programlari kullanildi.

Bulgular

Calismaya alinan migren ve saglikli kontrol olgularinin ozellikleri Tablo 1'de gorulmektedir. Her iki grup yas acisindan eslesmistir. Hipertansiyon ve diyabetes mellitus varligi her iki grupta farklilik gostermemistir.

ADE ve eNOS polimorfizmlerinin genotip ve alel sikligi sirasiyla Tablo 2 ve 3'te gosterilmistir. ADE genotip dagilimlari migren grubunda kontrollere gore belirgin farklilik gostermistir (p<0,001). Anjiyotensin donusturucu enzim DD ve ID genotipleri migren riskini II genotipine gore sirasiyla yaklasik 2,5 ve 4,5 kat artirmaktadir (Tablo 2). Ayni artmis risk oranlari aurali migren grubunda da gorulurken aurasiz migren grubunda sadece ID genotipi II genotipine gore 3,75 kat risk olusturmaktadir. Alel dagilimlari migren ve kontrol grubu arasinda anlamli fark gostermemistir (Tablo 2).

Endotelyal NOS genotip ve alel dagilimlari migren ve saglikli grupta benzer bulunmustur (Tablo 3).

Genotip ve alel gruplari ile hipertansiyon, diyabet, sigara, ailede migren oykusu, migren atak sikligi ve siddeti arasinda bir iliski gozlenmedi (tumu icin p>0,05).

Tartisma

Insanin genetik yapisi etnik ve irksal ozelligine gore degisebilmektedir. Bu nedenle farkli ulkelerde yapilan, farkli etnik ve irk yapisina sahip bireyleri iceren gen polimorfizm calismalari ayni sonuclari vermeyebilmektedir. Biz calismamizda olgu gruplari olarak Trakya, Edirne bolgesinde yasayan bireyleri inceledik. Edirne bolgesi henuz fazla goc almamis ve yogun nufus degisikligine ugramamis bolge olarak demografik ozelligini koruyan bir bolgedir. Calismamizda migren hastalarinda iki farkli gen polimorfizmi inceledik ve ADE gen polimorfizminin DD ve ID genotiplerinin migren grubunda II genotipine gore anlamli olarak daha yuksek oldugunu belirledik. Alt-grup incelemesinde aurali migren grubunda ayni genotiplerin anlamli farkliligi devam ederken aurasiz migren grubunda sadece ID genotipi II genotipine gore migren riskini artiran genotip olarak dikkati cekti. Tersten ifade edilecek olursa tum gruplarda II genotipi migren icin koruyucu bir genotip olarak ortaya cikti. eNOS gen polimorfizmi ise migren ve alt gruplarinda saglikli kontrol grubundan farklilik gostermedi.

Anjiyotensin donusturucu enzim gen polimorfizmini migren hastalarinda arastiran hem yurtici hem yurtdisi calismalar mevcuttur. Yakin zamanda yayinlanan Alasehirli ve ark.nin (25) calismalarinda ADE gen polimorfizminin Gaziantep bolgesinde yasayan migren hastalarinda ve sagliklilarda farkli olmadigi gorulmektedir. Istanbul bolgesinde yapilan baska bir calisma ise bizim calismamiz ile uyumlu olarak II genotipinin migren grubunda anlamli olarak dusuk oldugunu ve DD genotipli bireylerde ADE aktivitesinin yuksek oldugunu saptamistir (26). Benzer olarak Japonlarda aurali migren grubunda DD ve ID genotipleri riskfaktoru olarak saptanmistir (15). Bir calismada ise alt grup incelemesi yapildiginda sadece aurasiz migren grubunda DD genotipinin risk olusturdugu saptanmistir (16). Bu calismada ilaveten migren atak sikliginin DD genotiplilerde daha yuksek oldugu gorulmustur. Biz calismamizda genotipler ile migren atak sikligi ve suresi ile iliski saptamadik. Calismamizdan farkli olarak Norveclilerde yapilan bir calisma ise migren ile ADE gen polimorfizmi arasinda bir iliski gostermemektedir (17). Tum bu bilgilere zit olarak un ve ark. (27) ise erkek migrenli hastalarda DD genotipinin daha seyrek ve migren icin koruyucu ozellikte oldugunu bildirmektedirler.

Dolasimda olan ADE anjiyotensin l'in anjiyotensin II donusumunu saglar, bradikinin ortaya cikisina yol acar. Potent vazokonstriktor olan anjiyotensin II ve vazodilatator bradikinin vaskuler yeniden sekillenmede (remodeling) rol oynar. Dokuda ve dolasimda olan ADE duzeyleri ve aktivitesi siki bir genetik kontrol altindadir. ADE gen delesyon polimorfizminde dolasimdaki ADfaktivitesi artmistir (28). D alel ve DD genotipinin lakuner infarktlar ve koroner arter hastaligi ile pozitif iliskisini destekleyen calismalar yayinlanmistir (29,30). Bu iliskinin hiperkoagulabiliteye (19), azalmis bradikinin duzeyine, artmis vaskuler tonuse ve duz kas hipertrofisine bagli olabilecegi dusunulmektedir (20,21). Anjiyotensin donusturucu enzim ile migren patogenezi arasinda iliski henuz net degildir. Anjiyotensin donusturucu enzim opiat peptidlerin degradasyonunda katabolik bir rol oynadigi (31) ve migren hastalarinda ADE aktivitesinin sirkadian degisikliklerinin daha az oldugu belirlenmistir (32).

Calismamiz ulkemizde eNOS polimorfizmi ile migren iliskisini arastiran ilk calisma olup aralarinda bir iliski gostermemistir. Endotelyal NOS endotel hucrelerinden nitrik oksit sentezini saglayan enzimdir. Noronal (nNOS) ve induklenebilir NOS (INOS) olmak uzere iki farkli izotipi daha vardir. Yapilan calismalarin pek cogu hem INOS hem de eNOS gen polimorfizmlerinin migren ile iliskili olmadigini gostermistir (13,14). Ancak bir calismada /A/OSgen polimorfizminde (a) alelinin aurali migren grubunda aurasizlara gore daha sik oldugunu bildirilmistir (33). Benzer sekilde Borroni ve ark. (12) Asp/Asp genotipinin aurali migren riskini aurasiz migrene gore 3 kat artirdigi yonunde sonuc bildirmislerdir. Endotelyal NOS'un aspartat genetik varyasyonunda eNOS aktivitesinin azaldigi bildirilmistir (34).

Calismamizda olgu gruplarinin az sayida olgudan olusmasi, sadece kadin hastalari icermesi calismamizin sinirlayici yanlaridir. Sonuclarimiz bir bolgesel veri ozelligini tasimaktadir ve diger calismalarda elde edilen farkli sonuclar ile birlikte bir meta-analizde degerlendirildiginde daha anlamli bir sonuca gidilmesine olanak saglayacaktir. Gen polimorfizmlerinin migren ile iliskisinin ortaya konmasinin tedaviye yonelik planlamayi ve ilac secimini etkileyebilecegini dusunmekteyiz.

Doi: 10.4274/npa.y6665

Kaynaklar

(1.) Gardner K. The genetic basis of migraine: Howmuch do we know? Can J Neurol Sci 1999; 26:37-43.

(2.) Montagna P Molecular genetics of migraine headaches: A review. Cephalalgia 2000; 20:3-14.

(3.) Raskin NH, Gren MW. Migren ve Diger Basagrilari, Lewis R Rowland editor, B.Baslo, C.Gurses ceviri editorleri, Merritt's Neurology icinde, 11. baski, Istanbul, Gunes Tip Kitapevleri, 2008; s. 981-990.

(4.) Schurks M, Rist PM, Kurth T. Sex hormone receptor gene polymorphisms and migraine: a systematic review and meta-analysis. Cephalalgia 2010; 30:13061328.

(5.) Schurks M, Rist PM, Kurth T. 5-HTTLPR polymorphism in the serotonin transporter gene and migraine: a systematic review and meta-analysis. Cephalalgia 2010; 30:1296-1305.

(6.) Schurks M, Rist PM, Kurth T. STin2 VNTR polymorphism in the serotonin transporter gene and migraine: pooled and meta-analyses. J Headache Pain 2010; 11:317-326.

(7.) Schurks M, Rist PM, Kurth T. MTHFR 677C>T and ACE D/l polymorphisms in migraine: a systematic review and meta-analysis. Headache 2010; 50:588-599.

(8.) Akerman S, Williamson DJ, Kaube H, Goadsby PJ. Nitric oxide synthase inhibitors can antagonize neurogenic and calcitonin gene-related peptide induced dilation of dural meningeal vessels. Br J Pharmacol 2002; 137:62-68.

(9.) Neeb L, Reuter U. Nitric oxide in migraine. CNS Neurol Disord Drug Targets 2007; 6:258-264.

(10.) Bellamy J, Bowen EJ, Russo AR Durham PL. Nitric oxide regulation of calcitonin gene-related peptide gene expression in rat trigeminal ganglia neurons. Eur J Neurosci 2006; 23:2057-2066.

(11.) Veldman BA, Spiering W, Doevendans PA, Vervoort G, Kroon AA, de Leeuw PW, Smits R The Glu298Asp polymorphism of the N0S3 gene as a determinant of the baseline production of nitric oxide. J Hipertens 2002; 20:2023-2027.

(12.) Borroni B, Rao R, Liberini R Venturelli E, Cossandi M, Archetti S, Caimi L, Padovani A. Endothelial nitric oxide synthase (Glu298Asp) polymorphism is an independent risk factorfor migraine with aura. Headache 2006; 46:15751579.

(13.) Toriello M, Oterino A, Pascual J, Castillo J, Colas R, Alonso-Arranz A, RuizAlegria C, Quintela E, Monton F, Ruiz-Lavilla N. Lack of Association of Endothelial Nitric Oxide Synthase Polymorphisms and Migraine. Headache 2008;48:1115-1119.

(14.) Goncalves FM, Martins-Oliveira A, Speciali JG, Luizon MR, Izidoro-Toledo TC, Silva PS, Dach R Tanus-Santos JE. Endothelial nitric oxide synthase haplotypes associated with aura in patients with migraine. DNA Cell Biol 2011;30:363-369.

(15.) Kowa H, Fusayasu E, Ijiri T, Ishizaki K, Yasui K, Nakaso K, Kusumi M, Takeshima T, Nakashima K. Association of the insertion/deletion polymorphism of the angiotensin l-converting enzyme gene in patients of migraine with aura. Neurosci Lett 2005; 374:129-131.

(16.) Paterna S, Di Pasquale RD'Angelo A, Seidita G, Tuttolomondo A, Cardinale A ManiscalchiT, Follone G, Giubilato A.Tarantello M, Licata G. Angiotensin-converting enzyme gene deletion polymorphism determines an increase in frequency of migraine attacks in patients suffering from migraine without aura. Eur Neurol 2000; 43:133-136.

(17.) Tronvik E, Stovner LJ, Bovim G, White LR, Gladwin AJ, Owen K, Schrader H. Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients. BMC Neurol 2008; 8:4.

(18.) Schrader H, Stovner LJ, Helde G, Sand T, Bovim G. Prophylactic treatment of migraine with angiotensin converting enzyme inhibitor Randomised, placebo controlled, crossover study. BMJ 2001; 322:19-22.

(19.) Charles JA, Jotkowitz S, Byrd LH. Prevention of migraine with olmesartan in patients with hypertension/ prehypertension. Headache 2006; 46:503-507.

(20.) Erdos EG, Skidgel RA. The angiotensin l-converting enzyme. Lab Invest 1987; 56:345-348.

(21.) Dzau VJ. Theodore cooper Lecture: tissue angiotensin and pathobiology of vascular disease: a unifying hypothesis. Hypertension 2001; 37:1047-1052.

(22.) Headache Classification Sub-Committee of the International Headache Society. International Classification of Headache Disorders, 2nd edn. Cephalgia 2004;24:1-160

(23.) Wang XL. Sim AS, Badenhap RR McCredle RM, Wilcken DE. A smoking-dependent risk of coronary artery disease associated with a polymorphism of the endothelial nitric oxide synthase gene. Nat Med 1996; 2:41-45.

(24.) Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/ deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res 1992; 20:1433.

(25.) Alasehirli B, Gur M, Akcali A, Geyik S, Bulbul B, Sayar D, Yilmaz M, Neyal A, Neyal M. Angiotensin converting enzyme gene insetion/deletion polymorphism in migraine patients. Turk Norol Derg 2009; 15:161-165.

(26.) Kara I, Ozkok E, Aydin M, Orhan N, Cetinkaya Y, Gencer M, Kilic G, Tireli H. Combined effects of ACE and MMP-3 polymorphisms on migraine development. Cephalalgia 2007; 27:235-243.

(27.) Lin JJ, Wang PJ, Chen CH, Yueh KC, Lin SZ, Harn HJ. Homozygous deletion genotype of angiotensin converting enzyme confers protection against migraine in man. Acta Neurol Taiwan 2005; 14:120-125.

(28.) Rigat B, Hubert C, Alhenc-Gelas R Cambien R Corvol R Soubrier R An insertion/deletion polymorphism in the angiotensin l-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86:1343-1346.

(29.) Markus HS, Barley J, Lunt R, Bland JM, Jeffery S, Carter ND, Brown MM. Angiotensin-converting enzyme gene deletion polymorphism. A new risk factor for lacunar stroke but not carotid atheroma. Stroke 1995; 26:1329-1333.

(30.) Cambien R Poirier 0, Lecerf L, Evans A, Cambou JR Arveiler D, Luc G, Bard JM, Bara L, Ricard S, Tiret L, Amouyel R Alhenc-Gelas R Soubrier R Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature 1992; 15:359:641-644.

(31.) Skidgel RA, Erdos EG. Angiotensin converting enzyme (ACE) and neprilysin hydrolyze neuropeptides: a brief history, the beginning and follow-ups to early studies. Peptides 2004; 25:521-525.

(32.) Martelletti R Cugini R Letizia C, Di Palma L, Battisti R Granata M, Scavo D, Giacovazzo M. Chronopathology for angiotensin converting enzyme circadian rhythm in migraine. Chronobiologia 1990; 17:59-64.

(33.) de O S Mansur T, Goncalves FM, Martins-Oliveira A, Speciali JG, Dach R Lacchini R, Tanus-Santos JE. Inducible nitric oxide synthase haplotype associated with migraine and aura. Mol Cell Biochem 2012; 364:303-308.

(34.) Fairchild TA, Fulton D, Fontana JT, Gratton JR McCabeTJ, Sessa WC. Acidic hydrolysis as a mechanism for the cleavage of the Glu(298)Asp variant of human endothelial nitric-oxide synthase. J Biol Chem 2001; 276:26674-26679.

Tammam SIPAHI [1], Baburhan GULDIKEN [2], Levent KABAYEL [3], Orkide PALABIYIK [1], Hulya OZKAN [3], Tulay OKMAN KILIC [4], Necdet SUT [5], Nilda TURGUT [6]

[1] Trakya Universitesi Tip Fakultesi, Biyofizik Anabilim Dali, Edirne, Turkiye

[2] Trakya Universitesi Tip Fakultesi, Noroloji Anabilim Dali, Edirne, Turkiye

[3] Edirne Devlet Hastanesi Universitesi Tip Fakultesi, Noroloji Anabilim Dali, Edirne, Turkiye

[4] Trakya Universitesi Tip Fakultesi, Kadin Hastaliklari ve Dogum Anabilim Dali, Edirne, Turkiye

[5] Trakya Universitesi Tip Fakultesi, Biyoistatistik Anabilim Dali, Edirne, Turkiye

[6] Namik Kemal Universitesi Tip Fakultesi, Noroloji Anabilim Dali, Tekirdag, Turkiye

Yazisma Adresi/Correspondence Address

Dr. Tammam Sipahi, Trakya Universitesi Tip Fakultesi, Biyofizik Anabilim Dali, Edirne, Turkiye Gsm: +90 555 390 46 37 E-posta: tammamOtrakya edu.tr Received/Gelis tarihi: 09.05.2012 Accepted/Kabul tarihi: 10.06.2012

Tablo 1. Migren hastalari ve kontrol bireylerinin ozellikleri

                      Migren (n=105)        Kontrol (n=97)        P

Yas                 38,07 [+ or -] 9,78   35,69 [+ or -] 7,35   0,053
Hipertansiyon (%)          18,1                  15,6           0,776
Diabetes                    3,0                   5,3           0,487
mellitus (%)
Sigara (%)                 34,3                  15,0           0,004
Ailede migren (%)           52                   18,5           0,004

Tablo 2. Anjiyotensin donusturucu enzim alel ve genotip sikligi
ile Odd oranlari

                    D       I       P       DD      ID      II

Migren grubu (%)    61,4    38,6    0,06    34,3    54,3    11,4

Kontrol grubu (%)   52,5    47,5            36,1    33      30,9

Aurali

migren grubu (%)    63,3    36,7    0,36    35,6    55,6    8,9

Aurasiz migren

grubu (%)           60,0    40,0            33,3    53,3    13,3

                    P                        00 (%95 GA)

                                 DD vs.ID    0,577 (0,306-1,090)

Migren grubu (%)    0,001 (a)    DD vs II    2,571 (1,138-5,811)

                                 ID vs II    4,453 (2,006-9,883)

Kontrol grubu (%)

Aurali              0,006 (b)    DD vs.ID    0,585 (0,266-1,289)

migren grubu (%)    0.777 (c)    DD vs II    3,429 (1,033-11,375)

                                 ID vs II    5,859 (1,824-18,824)

Aurasiz migren                   DD vs.ID    0,571 (0,274-1,193)

grubu (%)           0,014 (d)    DD vs II    2,143 (0,825-5,563)

                                 ID vs II    3,750 (1,493-9,420)

(a) Migren - kontrol gruptan

(b) Aurali migren - kontrol gruplan

(c) Aurali migren - aurasiz migren gruplan

(d) Aurasiz migren - kontrol gruplan

00 Odds orani

GA Guven araligi

Tablo 3. Endotelyal nitrik oksit sentaz alel ve genotip sikligi

                            a       b       p       aa

Migren grubu (%)            17,6    82,4    0,22    5,7

Kontrol grubu (%)           17,0    83,0            1,0

Aurali migren grubu (%)     15,6    84,4    80,9    6,7

Aurasiz migren grubu (%)    19,1    80,9            5,0

                            ab      bb      P

Migren grubu (%)            23,8    70,5    0,106

Kontrol grubu (%)           31,9    67,1    (a)

Aurali migren grubu (%)     17,8    75,5    0,49 (b)
                                            0,446 (c)
Aurasiz migren grubu (%)    28,3    66,7    0,293 (d)

(a) Migren - kontrol gruplan

(b) Aurali migren - kontrol gruplan

(c) Aurali migren - aurasiz migren gruplan

(d) Aurasiz migren - kontrol gruplan
COPYRIGHT 2013 AVES
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research Article/ Arastirma Makalesi
Author:Sispahi, Tammam; Guldiken, Baburhan; Kabayel, Levent; Palabiyik, Orkide; Ozkan, Hulya; Kilic, Tulay
Publication:Archives of Neuropsychiatry
Article Type:Report
Date:Sep 1, 2013
Words:3701
Previous Article:Injuries in patients with epilepsy and some factors associated with injury/epilepsili hastalarda yaralanmalar ve iliskili bazi faktorler.
Next Article:An unusual case: the comorbidity of mood disorder and 17-[alpha]-hydroxylase deficiency/Cok nadir gorulen bir olgu: 17-[alpha] hidroksilaz eksikligi...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters