Printer Friendly

Emergence of plasmid-mediated fosfomycin-resistance genes among escherichia coli isolates, France.

Fosfomycin is a broad-spectrum bactericidal antibiotic commonly used in Europe as a first-line oral agent for uncomplicated urinary tract infection (1). In France, it is the only first-line antimicrobial drug recommended for treatment of cystitis (97% susceptibility) and is used in 20%-30% of such treatments (2). However, it is receiving renewed worldwide attention as one of the most active agents for sparing carbapenems in extended spectrum [beta]-lactamase (ESBL)-producing isolates and for treatment of carbapeneme-resistant Enterobacteraceae (CRE) in combination with Colistin (3). In France, intravenous fosfomycin (3-4 g 4x/d) is used in combination with other drugs for the treatment of multidrug-resistant infections.

The evaluation of fosfomycin susceptibility in clinical strains is widely performed, but the molecular bases are rarely documented. Fosfomycin inhibits the initial step in peptidoglycan synthesis by irreversibly blocking MurA in both gram-positive and -negative bacteria. It is imported through the inner membrane through the glycerol-3-phosphate (G3P) transporter GlpT and the glucose-6-phosphate (G6P) transporter UhpT. Decreased expression or mutations in gl pT or uhpTgenes are the most frequent events leading to lowered susceptibility, whereas modification of the fosfomycin target MurA seems to be rare in clinical isolates (4). Another mechanism is the production of FosA, a glutathione S-transferase that inactivates fosfomycin by addition of a glutathione residue. This mechanism is particularly relevant because it is disseminative and frequently associated with ESBL-producing Escherichia coli. Since 2006, researchers in several countries in East Asia have described plasmid-mediated fosA3 and, less frequently, fosA5 (formerly fosKp96), which is mostly associated with CTX-M and co-harbored on a conjugative plasmid. Some studies have focused on human clinical strains in China (5), South Korea (6), or Japan (7), and others have addressed veterinary strains isolated throughout China from pets (8), livestock (9), or animal fodder (10). In 2016, Portugal reported the first imported case of a travel-related infection in Europe with an E. coli strain co-expressing fosA3 and CTX-M-15 (11). The possible dissemination of this gene is worrisome because fosA3 is generally surrounded by the IS26 insertion sequence on a composite transposon borne by the IncFII conjugative plasmid, which is known to be a dissemination vector of resistance genes worldwide. Here we report the prevalence and mechanisms of fosfomycin resistance among clinical human E. coli strans isolated in Paris, France.

The Study

We investigated the occurrence and molecular features of all fosfomycin-resistant E. col i isolated from hospitalized patients during a 12-month period (August 2014-July 2015). We performed bacterial identification by using VITEK 2 (BioMerieux, Marcy l'Etoile, France) and tested antibiotic susceptibility by using the disk diffusion method in accordance with 2016 Comite de l'Antibiogramme de la Societe Francaise de Microbiologic/European Committee on Antimicrobial Susceptibility Testing guidelines (http://www sfm-microbiologie.org/UserFiles/files/casfm/CASFM2016_ Vl_0_FEVRIER.pdf). We screened for fosfomycin resistance by using a 200-[micro]g disk with a diameter cutoff of [less than or equal to] 13 mm. We determined MIC by using the Etest method with Muller-Hinton agar containing 25 mg/L G6P.

Among 1,354 E. coli isolates tested, 12 (0.9%) showed confirmed resistance (MIC >128 mg/L). We explored the mechanism of fosfomycin resistance by growing these isolates for 48 hours at 35[degrees]C in M9 minimal medium agar supplemented with either G3P or G6P at 0.2% as the sole carbon source. Lack of growth showed impaired fosfomycin transport (12). Of the 12 isolates, 7 were double auxotrophic mutants with G6P and G3P (mean MIC 384 mg/L), 3 were auxotrophic only for G3P (mean MIC 597 mg/L), and 2 were capable of using both substrates and exhibited high-level resistance (MIC >1,024 mg/L). Paradoxically, single and double auxotroph strains had lower mean MICs than the 2 nonauxotroph strains. Because transport deficit could not account for the observed phenotype, we screened by PCR and sequenced genes coding enzymatic glutathione S-transferase variants fosA, fosA2, fosA3, fosA4, fosA5, and fosC2 (Table 1). In parallel, we screened inhibition of glutathione S-transferase activity by using FosA inhibitor phosphonoformiate (Figure) as described by Nakamura et al. (12). Results of these 2 tests were in agreement, with each detecting an ESBL-producing strain with enzymatic activity encoded by the fosA3 gene (MIC [greater than or equal to] 1,024 mg/L). Neither strain had been previously reported in France.

We determined the prevalence of enzymatic resistance to fosfomycin in ESBL-producing strains isolated since 2012 by using the same 2 tests. Surprisingly, among 23 strains resistant to fosfomycin with no epidemiologic link, 7 additional Fos A3-producing and 1 FosA 5-producing strains were detected, each with MIC [greater than or equal to] 1,024 mg/L. Overall 83% of fosfomycin-resistant ESBL-producing E. coli with MIC [greater than or equal to] 1,024 mg/L were FosA-positive. Auxotrophic tests showed that in addition of FosA production, fosfomycin transport was impaired in 6 strains. Chronologically, 2 strains were isolated in 2012, three in 2013, three in 2014, and two in 2015, meaning that FosA3-producing strains were present in France 6 years after the first isolation in Japan. The FosA5-producing strain was isolated from a clinical sample in France simultaneously with the original description of the strain in China (13). The sequencing of fosA5 showed 99% identity (with 96% coverage) with pHKU1, earlier described as an fosKP96-carrying IncN plasmid in Klebsiella pneumoniae (5).

Our sequencing of CTX-M genes showed that FosA3-producing strains were associated with CTX-M-15 (n = 5), CTX-M-55 (n = 3), and CTX-M-2 (n = 1), whereas the 1 FosA5-producing strain expressed CTX-M-14. We also conducted multilocus sequence typing and plasmid incompatibility grouptyping (14) (Table 2). These results show unambiguously that 8 strains of E. coli of different sequence types hosted 5 plasmid types that could be distinguished by their CTX-M variant and plasmid-incompatibility group types.

Nine out of 10 isolates yielded transconjugants in E. coli C600 (E. coli K12 derivative) or transformants in TOP 10 (DH10B derivative) E. coli. All 9 of these isolates expressed high-level resistance to fosfomycin (MIC > 1,024 mg/L), confirming that the observed resistance of the parent stra n was i ndeed attri butabl e to the fosA gene.

Conclusions

Although the prevalence of plasmid-mediated fosA3 genes in human clinical E. coli isolates has remained low in France since 2012, these genes are observed across numerous clones, sequence types, and molecular determinants and are always associated with ESBL CTX-M enzymes, suggesting multiple propagation events. Our results are consistent with FosA3-producing clinical strains previously isolated in Asia, which also co-express CTX-M enzymes. However, the CTX-M variant distribution between the strain in France and the strain in Asia is different, with CTX-M-15 having high prevalence in our collection. Medical records examination did not show a history of international travel in our patient population, and such a variety of fosfomycin-resistant E. coli lineages probably were not imported or transmitted. The broad use of oral fosfomycin has provided the opportunity to select for FosA producers. With the spread of CTX-M urinary tract infections in the community, the use of fosfomycin is likely to select for CTX-M-FosA co-producers and could lead to an increase of treatment failures with ESBL-producing organisms. Conversely, treatment of ESBL producers with fosfomycin should only be undertaken after testing for susceptibility because these ESBL-producers can be linked to the same genetic determinant. Moreover, the indiscriminate use of the oral formulation in the community is jeopardizing the usefulness of this antimicrobial agent. While the world is bracing for an epidemic of infectious diseases bearing plasmid-mediated Colistin resistance (15), a vast and ubiquitous reservoir for conjugative transmissible resistance to fosfomycin exists and can preclude its efficacy against extremely drug-resistant bacteria if the guidelines for the indiscriminate use of fosfomycin-trometamol are not urgently revised to safeguard this potent and well-tolerated agent. Because antimicrobial treatment of cystitis typically is motivated by concern for patient's comfort, withholding treatment or the promotion of pivmecillinam as a first-line antimicrobial drug should seriously be considered.

December 2011 : Zoonoses

* Risk for Rabies Importation from North Africa

* Worldwide Occurrence and Impact of Human Trichinellosis, 1986-2009

* Sealpox Virus in Marine Mammal Rehabilitation Facilities, North America, 2007-2009

* Transmission of Guanarito and Pirital Viruses among Wild Rodents, Venezuela

* Hepatitis E Virus in Rats, Los Angeles, California, USA

* Enterovirus Co-infections and Onychomadesis after Hand, Foot, and Mouth Disease, Spain

* Experimental Infection of Horses with Hendra Virus/ Austral ia/Horse/2008/Redlands

* Lineage and Virulence of Streptococcus suis Serotype 2 Isolates from North America

* Isolation of Prion with BSE Properties from Farmed Goat

* Candidate Cell Substrates, Vaccine Production, and Transmissible Spongiform Encephalopathies

* Molecular Epidemiology of Rift Valley Fever Virus

* Novel Multiplexed HIV/ Simian Immunodeficiency Virus Antibody Detection Assay

* Astroviruses in Rabbits

* Host Genetic Variants and Influenza-associated Mortality among Children and Young Adults

* West Nile Virus Infection of Birds, Mexico

* Severe Human Bocavirus Infection, Germany

* Continuing Threat of Influenza (H5N1) Virus Circulation in Egypt

* Hepatitis E Virus Antibodies in Blood Donors, France

* Human Cardioviruses, Meningitis, and Sudden Infant Death Syndrome in Children

* Seroprevalence of Alkhurma and Other Hemorrhagic Fever Viruses, Saudi Arabia

* Knowledge of Avian Influenza (H5N1) among Poultry Workers, Hong Kong, China

* Risk for Human African Trypanosomiasis, Central Africa, 2000-2009

* Animal Diseases Caused by Orbiviruses, Algeria

* Genogroup I and II Picobirnaviruses in Respiratory Tracts of Pigs

* Human Liver Infection by Amphimerus spp. Flukes, Ecuador

DOI: https://doi.org/10.3201/eid2309.160215

This work was funded by grants from the Assistance Publique Hopitaux de Paris, France, and the Pierre et Marie Curie University, Paris, France.

Mr. Benzerara is an engineer and leads translational research, including emerging mechanisms of antimicrobial resistance, at the Hopitaux Universitaires Est Parisiens Paris, France.

References

(1.) Societe de Pathologie Infectieuse de Langue Francaise. Diagnosti c et anti biotherapie des i nfections uri nai res bacteriennes communautaires de l'adulte [cited 2017 Jun 21]. http://www.infectiologie.com/UserFiles/File/spilf/recos/ infections-urinaires-spilf.pdf

(2.) Agence Nationale de Securite du Medicaments. Etude d'utilisation de la nitrofurantoine en France--periode mars 2012-fevrier 2015 [cited 2017 Jun 21]. http://ansm.sante.fr/var/ansm_site/storage/ original/application/d807c8e39321445201911cf314263f07.pdf

(3.) Kaye KS, Gales AC, Dubourg G. Old antibiotics for multi-drugresistant pathogens: from in vitro activity to clinical outcomes. Int J Antimicrob Agents. 2017:49:542-8. http://dx.doi.org/10.1016/ j.ijantimicag.2016.11.020

(4.) Castaneda-Garcia A, Blazquez J, Rodriguez-Rojas A. Molecular mechanisms and clinical impact of acquired and intrinsic fosfomycin resistance. Antibiotics (Basel). 2013; 2:217-36. http://dx.doi.org/10.3390/antibiotics2020217

(5.) Ho PL, Chan J, Lo WU, Lai EL, Cheung YY, Lau TC, et al. Prevalence and molecular epidemiology of plasmid-mediated fosfomycin resistance genes among blood and urinary Escherichia coli isolates. J Med Microbiol. 2013; 62:1707-13. http://dx.doi.org/ 10.1099/jmm.0.062653-0

(6.) Lee SY, Park YJ, Yu JK, Jung S, Kim Y, Jeong SH, et al. Prevalence of acquired fosfomycin resistance among extended-spectrum [beta]-lactamase-producing Escherichia coli and Klebsiella pneumoni ae clinical isolates in Korea and IS26-composite transposon surroundi ng fosA3. J Antimicrob Chemother. 2012; 67:2843-7. http://dx.doi.org/10.1093/jac/dks319

(7.) Wachino J, Yamane K, Suzuki S, Kimura K, Arakawa Y Prevalence of fosfomycin resistance among CTX-M-producing Escherichia coli clinical isolates in Japan and identification of novel plasmid-mediated fosfomycin-modifying enzymes. Antimicrob Agents Chemother. 2010; 54:3061-4. http://dx.doi.org/ 10.1128/AAC.01834-09

(8.) Hou J, Huang X, Deng Y He L, Yang T. Zeng Z, et al. Dissemination of the fosfomycin resistance gene fosA3 with CTX-M [beta]-lactamase genes and rmtB carried on IncFII plasmids among Escherichia coli isolates from pets in China. Antimicrob Agents Chemother. 2012; 56:2135-8. http://dx.doi.org/10.1128/ AAC.05104-11

(9.) Chan J, Lo WU, Chow KH, Lai EL, Law PY, Ho PL, Clonal diversity of Escherichia coli isolates carrying plasmid-mediated fosfomycin resistance gene fosA3 from livestock and other animals. Antimicrob Agents Chemother. 2014; 58:5638-9. http://dx.doi.org/ 10.1128/AAC.02700-14

(10.) Hou J, Yang X, Zeng Z, Lv L, Yang T, Lin D, et al. Detection of the plasmid-encoded fosfomycin resistance gene fosA3 i n Escherichia coli of food-animal origin. J Antimicrob Chemother. 2013; 68:766-70. http://dx.doi.org/10.1093/jac/dks465

(11.) Mendes AC, Rodrigues C, Pires J, Amorim J, Ramos MH, Novais A, et al. Importation of fosfomycin resistance fosA3 gene to Europe. Emerg Infect Dis. 2016; 22:346-8. http://dx.doi.org/10.3201/ eid2202.151301

(12.) Nakamura G, Wachino J, Sato N, Kimura K, Yamada K, Jin W, et al. Practical agar-based disk potentiation test for detection of fosfomycin-nonsusceptible Escherichia coli clinical isolates produci ng gl utathi one S-transferases J Clin Microbiol. 2014; 52:3175-9. http://dx.doi.org/10.1128/JCM.01094-14

(13.) Ma Y Xu X, Guo Q, Wang P, Wang W, Wang M. Characterization of fosA5, a new plasmid-mediated fosfomycin resistance gene in Escherichia coli. Lett Appl Microbiol. 2015; 60:259-64. http://dx.doi.org/10.1111/lam.12366

(14.) Compain F, Poisson A, Le Hello S, Branger C, Weill FX, Arlet G et al. Targeting relaxase genes for classification of the predominant Plasmids in Enterobacteriaceae. Int J Med Microbiol. 2014; 304:236-42. http://dx.doi.Org/10.1016/j.ijmm.2013.09.009

(15.) Al-Tawfiq JA, Laxminarayan R, Mendelson M. How should we respond to the emergence of plasmid-mediated Colistin resistance in humans and animals? Int J Infect Dis. 2017; 54:77-84. http://dx.doi.Org/10.1016/j.ijid.2016.11.415

Yahia Benzerara, Salah Gallah, Baptiste Hommeril, Nathalie Genel, Dominique Decre, Martin Rottman, Guillaume Arlet

Author affiliations: Assistance Publique des Hopitaux de Paris Hopitaux Universitaires Est Parisiens Paris, France (Y. Benzerara, S. Gallah, B. Hommeril, D. Decre, G. Arlet); Universite Pierre et Marie Curie, Sorbonne Universite, Paris (N. Genel, D. Decre, G. Arlet); Assistance Publique des Hopitaux de Paris Hopitaux Universitaires Paris Ile de France Ouest, Hopital Raymond Poincare, Garches, France (M. Rottman); Universite de Versailles Saint-Quentin-en-Yvelines, St-Quentin en Yvelines, France (M. Rottman)

Address for correspondence: Guillaume Arlet, Hopital Tenon--Bacteriology, 4 Rue de la Chine, Paris 75020 France; email: guillaume.arlet@tnn.aphp.fr

Caption: Figure. Inhibition of FosA-mediated fosfomycin resistance by phosphonoformiate. A modified Kirby-Bauer disk diffusion susceptibility assay was performed. In brief, a Mueller-Hinton agar plate was streaked with a 0.5 McFarland suspension of the isolate assayed. Three disks were placed on the agar: a 200-[micro]g fosfomycin disk (upper left), a 100-[micro]g phosphonoformiate disk (lower center), and a disk with both 200-[micro]g fosfomycin and 100-[micro]g phosphonoformiate (upper right). The diameter of the growth inhibition zone around each disk was measured after 18-24 h incubation at 35[degrees]C (+2[degrees]C). FosA-mediated fosfomycin resistance is inhibited by phosphonoformiate and is demonstrated by an increase in the diameter of the growth inhibition zone by >4 mm.
Table 1. Oligonucleotide primers used in our study for detection
of plasmid-mediated fosfomycin-resistance genes *

Target gene   Primer         Sequence,            Temp,      Amplicon
                        5' [right arrow] 3'     C[degrees]   size, bp

fosA           Fwd     ATCTGTGGGTCTGCCTGTCGT        50         271
               Rev      ATGCCCGCATAGGGCTTCT
fosA3          Fwd      CCTGGCATTTTATCAGCAGT        55         221
               Rev     CGGTTATCTTTCCATACCTCAG
fosA4          Fwd      CTGGCGTTTTATCAGCGGTT        60         230
               Rev      CTTCGCTGCGGTTGTCTTT
fosA5          Fwd     TATTAGCGAAGCCGATTTTGCT       55         177
               Rev      CCCCTTATACGGCTGCTCG
fosC2          Fwd      TGGAGGCTACTTGGATTTG         50         209
               Rev      AGGCTACCGCTATGGATTT

Target gene   Reference

fosA             (5)

fosA3            (5)

fosA4         This study

fosA5            (5)

fosC2            (8)

* Fwd, forward; Rev, reverse.

Table 2. Characteristics of clinical fosfomycin-resistant
Escherichia coli isolates considered in our study *

No.          Year       Origin       CTX-M     fosA
isolates   isolated                 variant    type

9            2012        Urine      CTX-M-55    A3
12           2012        Urine      CTX-M-55    A3
36           2013        Blood      CTX-M-55    A3
19           2013        Urine      CTX-M-15    A3
34           2013        Urine      CTX-M-2     A3
24           2013        Urine      CTX-M-15    A3
35           2014        Urine      CTX-M-15    A3
39           2014     Joint fluid   CTX-M-15    A3
42           2015        Urine      CTX-M-14    A3
20           2015        Feces      CTX-M-15    A5

No.            Sequence type        Plasmid-carrying
isolates                                fosAtype

9          ST-559 (ST-10 complex)        FN, 11
12         ST-559 (ST-10 complex)        FN, 11
36               ST-1 (new)                FN
19               ST-2 (new)                FN
34                ST-2015             Nontypeable
24                ST-4508                  FN
35                 ST-69                   FN
39                 ST-69                   FN
42                 ST-457           colE nontypeable
20               ST-3 (new)                N

* AII genetic determinants were different except for isolates 9 and
12 (ST-559) and isolates 35 and 39 (ST-69). The yearly number of
extended spectrum [beta]-lactamase-producing E. coli screened was
1,044 in 2012, 1,142 in 2013, 1,251 in 2014, and 1,381 in 2015. ST,
sequence type.
COPYRIGHT 2017 U.S. National Center for Infectious Diseases
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:DISPATCHES
Author:Benzerara, Yahia; Gallah, Salah; Hommeril, Baptiste; Genel, Nathalie; Decre, Dominique; Rottman, Mar
Publication:Emerging Infectious Diseases
Geographic Code:4EUFR
Date:Sep 1, 2017
Words:2696
Previous Article:Use of blood donor screening to monitor prevalence of HIV and hepatitis B and C viruses, South Africa .
Next Article:Determination of ferret enteric coronavirus genome in laboratory ferrets.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters