Printer Friendly

Effects of the combination of glucose, chromium picolinate, and Vitamin C on lipid metabolism in steers.

INTRODUCTION

The amount of adipose tissue in muscle depends primarily on the number and size of the constituent adipocytes. Although proliferation and differentiation of pre-adipocytes takes place and is almost completed in the perirenal and subcutaneous adipose tissues of cattle by the first year of age, intramuscular adipose tissue is actively proliferated and differentiated in beef steers until 14months-of-age. Cianzio et al. (1985) reported that the number of adipocytes in the longissimus muscle increased during 13 to 19-months-of-age and correlated with beef marbling. Previous scientific literature indicated a substantial role for glucose, chromium picolinate (CrP), and vitamin C (Vit C) in intramuscular fat deposition (Smith et al., 1984; Toriisin et al., 1995).

Smith and Crouse (1984) reported that intramuscular fat deposition increased with a higher supply of glucose.

In addition, chromium (Cr) is known as an essential nutrient for humans and animals (Mertz et al., 1993). The main physiologic role of Cr is to increase insulin action or sensitivity in peripheral tissues (Anderson, 1998). In general, dietary Cr supplementation increases cellular uptake of glucose (Mooradian et al., 1997). Although, domestic animals are not considered to require dietary Vit C because they can synthesize a sufficient amount in the liver (McDowell, 1989), a dietary supplement of L-ascorbic acid2-phosphate during the late fattening stage produced a higher marbling score in Japanese Black cattle (Ohashi et al., 2000). Vit C also enhanced bovine preadipocyte proliferation and differentiation in vitro and improved insulin secretion in broiler chickens (Toriisin et al., 1995; Sahin et al., 2003).

To our knowledge, the effect of the combination of CrP, Vit C, and glucose on lipid metabolism in steers is unknown. Therefore, this study was designed to evaluate the physiological responses of CrP, Vit C, and glucose on lipid metabolism in Korean native steers.

MATERIALS AND METHOD

Animals, diets, experimental design, and procedures

A total of 12 Korean native steers, 12-months-of- age, and weighing 516 kg [+ or -] 2.8 kg were used in this study.

A jugular vein catheter was inserted into each animal four days before the start of the experiment. Steers were fed 10 kg DM of basal diet (90% concentrate and 10% alfalfa hay) twice daily. The steers were randomly assigned to four treatment groups: (3 animals per treatment) i) basal control diet, ii) basal diet+250 g glucose, iii) treatment 2+13.5 g CrP and iv) treatment 3+2.52 g Vit C. Glucose and Vit C (ascorbic acid; Sigma, Germany) were infused for five days through an indwelling catheter fitted in the jugular vein and CrP was provided orally in encapsulated form for five days.

CrP was fed along with the basal diet at 07:00 h and infusion of glucose and Vit C was carried out at 10:00 h. Maximum efficiency of absorption of Cr from CrP was 2.8%. Since Cr is quickly lost through urine, its toxicity was not a problem in this study. However, direct infusion of Cr into the vascular system can cause toxicity, thus in this study, coated CrP was supplemented to reduce toxic effects and improve absorption.

Glucose and Vit C were infused through the jugular vein catheter within 45 min using a 50-ml syringe. At days 1 and 3 blood samples were collected and at day 5 muscle tissue was taken by biopsy.

All experimental procedures were in accordance with the "Guidelines for the Care and Use of Experimental Animals of Seoul National University", formulated according to the "Declaration of Helsinki" and "Guiding Principles in the Care and Use of Animals".

Blood sample collection and analysis

Blood samples were collected for serum glucose and insulin assay at -30, -20, -10, 0, 15, 30, 45, 60, 90, 120, and 180 min from the administration of glucose, CrP, Vit C, or saline solution on days 1 and 6 of the experiment.

Blood samples were collected from an indwelling catheter fitted in the jugular vein using a 20-ml syringe and transferred to BD vacutainers (Becton Dickenson Co., Franklin Lakes, NJ, USA). The blood was centrifuged at 3,000 rpm for 15 min at 4[degrees]C to harvest serum, which was stored at -20[degrees]C for latter analysis. Serum glucose, triglyceride (TG), non-esterified fatty acids (NEFA), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) were estimated using commercial kits from Wako Pure Chemical Industries (Osaka, Japan). The concentration of serum insulin was measured with specific bovine insulin enzyme-linked immunosorbent assay (ELISA) kits (Mercodia Co., Sweden).

Longissimus muscle tissue sampling

Longissimus muscle tissue samples were collected to analyze the expression of genes related to intramuscular fat deposition. At day 5 skeletal muscle tissues samples were obtained from the longissimus dorsi at a 6-cm depth near the thirteenth rib by biopsy after local anesthesia using a spring-loaded biopsy instrument (Biotech, Republic of Slovakia) as described by Cheah et al. (1997). The collected muscle tissue was snap-frozen in liquid nitrogen and stored at -80[degrees]C until analyzed.

Real-time polymerase chain reaction (PCR) analysis

Total RNA was isolated from muscle tissue using TRIzol[R] Reagent (Invitrogen Life Technologies, USA) in accordance with the manufacturer's instruction. First-strand complementary DNA (cDNA) was synthesized from total RNA (3 [micro]g) using Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Fermentas) with oligo (dT)15 (Promega) primer in a 20 [micro]l reaction mixture. Real-time PCR was carried out in 20 [micro]l of reaction solution containing 10 SYBR Green (Bio-Rad), 0.4 left primer, 0.4 [micro]l right primer (each of the relevant bovine-specific primers; Table 1), 2.29 [micro]g cDNA, others were double distilled water. Reactions were initiated at 95[degrees]C for 3 min, followed by 40 cycles of PCR at 95[degrees]C for 30 s, 55[degrees]C for 30 s, and 72[degrees]C for 30 s. The threshold cycles (Ct) for the internal control and genes of interest were determined and relative RNA levels were calculated by the [DELTA][DELTA]Ct method where [DELTA][DELTA]Ct is the ACt of the gene in treatment minus the [DELTA]Ct of the gene in control. [DELTA]Ct is the Ct of the gene of interest minus the Ct of internal control. The [DELTA][DELTA]Ct values were used to calculate [2.sup.-[[DELTA][DELTA]Ct]]. [beta]-Actin was used as an internal control. All results were obtained from at least three independent experiments.

Statistical analysis

Statistical evaluation was made using analysis of variance (ANOVA) and the SAS program. Mean values among treatments were compared by S-N-K Test (Steel et al., 1980).

RESULTS

Effects on serum glucose concentration

Serum glucose levels are presented in Table 2. On days 1 and 3, blood glucose concentrations were similar in control and treated steers. At day 1, jugular infusion significantly affected (p<0.05) the blood glucose concentration in steers at 30, 45, 60, and 90 min post-infusion. On day 3, blood glucose concentration was significantly different (p<0.05) among control and treated steers at 15, 30, 45, and 60 min post-infusion. On days 1 and 3, the steers in treated groups had higher (p<0.05) blood glucose than those in the control group (Table 2).

Effects on serum insulin concentration

Serum insulin levels are presented in Table 3. On days 1 and 3, basal concentrations of serum insulin were similar in control and treated steers. Glucose infusion significantly increased (p<0.01) serum insulin at 15 min post-infusion. A similar pattern of serum insulin was observed after glucose infusion on day 3. On days 1 and 3, steers in treated groups had higher (p<0.05) insulin levels than those in the control group (Table 3). No difference in serum insulin levels was observed in steers in treatment groups 1, 2, and 3 although insulin levels in steers in treatment group 3 were numerically higher than in other treatment groups.

Effects on serum HDL-C, LDL-C, TG, and NEFA concentrations

Serum HDL-C, LDL-C, TG, and NEFA levels are presented in Table 4. Serum basal and post-infusion (at 90 min) HDL-C, LDL-C, and TG concentrations in steers were not affected by treatments on days 1 and 3. Basal concentration of serum NEFA was similar in control and treated steers on day 1 and 3; however, the concentration was significantly different (p<0.05) in control and treated steers at 90 min post-infusion. Steers on treatment 3 had similar serum NEFA concentrations as controls and significantly higher levels than animals in treatment groups 1 and 2.

Effects on gene expression related adipogenesis in longissimus muscle tissue

Longissimus muscle tissue gene expression related to adipogenesis is presented in Table 5. The expression of peroxisome proliferator-activated receptor-[gamma] (PPAR[gamma])2, stearoyl-CoA desaturase-1 (SCD), and fatty acid synthase (FAS) in the longissimus muscle of steers on treatment 2 was higher than those on other treatments. The expression of adipocyte protein 2 (aP2) was similar in all experimental steers.

DISCUSSION

Serum insulin concentration is related to serum glucose concentration in cattle. Under normal physiological conditions, the insulin concentration increases in serum with increasing levels of glucose that generally follows meal patterns. In the present study, a jugular infusion of glucose caused a surge in insulin secretion on day 1 of treatment. A similar pattern of serum insulin in steers was observed on infusion day 3. Although no significant differences were observed in serum insulin levels in steers on treatments 1, 2, and 3, the serum insulin level of steers on treatment 3 was numerically higher than that of the other treatments (Table 2). These results provide evidence that Vit C and CrP may be important factors that increase insulin secretion. The same results were reported by Sahin et al. (2003) in broiler chickens. The mechanism for glucose-induced insulin secretion from pancreatic p cells involves at least two signaling pathways, potassium ([K.sup.+])-ATP channel-dependent and independent. In the former, pancreatic p cells sense glucose concentration through its metabolism, which increases the ATP/ADP ratio. This increase closes the ATP-sensitive [K.sup.+]-ATP channel causing plasma membrane depolarization and activation of voltage-dependent calcium ([Ca.sup.2+]) channels thereby increasing [Ca.sup.2+] entry and stimulating insulin release. The [K.sup.+]-ATP channel-independent pathway involves the opening of [K.sup.+]-ATP channels with diazoxide and restores [Ca.sup.2+] influx by depolarizing the membrane with a high accumulation of extracellular [K.sup.+]. Under these conditions glucose still caused a concentration-dependent increase of insulin release.

Previous literature has revealed that Vit C supports insulin secretion from pancreatic islets (Wells et al., 1995). The release of insulin from pancreatic islets in response to D-glucose is dependent on the normal availability of ascorbic acid which involves voltage-dependent [Ca.sup.2+] channels which increase cellular [Ca.sup.2+] entry (Parsey et al., 1993). However, the effect of CrP on insulin secretion is not clear and requires further experimentation. Insulin plays a pivotal role in the uptake of glucose by the cells (Stryer et al., 1995). Skeletal and muscle cells are the main consumers of glucose in the body (Pethick et al., 1984). Contrarily, adipose tissue in the ruminant accounts for only minor (1%) glucose disposal of the total amount of glucose utilization (Pethick et al., 1984). Smith and Crouse (1984) demonstrated that glucose provides 50-75% of the acetyl units for adipogenesis in intramuscular fat deposition but only 1 to 10% of the acetyl units for adipogenesis in subcutaneous fat. Thus, increased blood glucose could increase intramuscular fat deposition, without markedly affecting subcutaneous fat deposition.

Several transcription factors that are important players in adipogenesis were analyzed by real-time PCR using longissimus muscle tissues. PPARs are a subclass of the nuclear hormone receptor super family and are therefore ligand-activated transcription factors (Berger et al., 2002). PPAR[gamma] is expressed at a high level in adipose tissue and is considered a master regulator of adipogenesis (Tontonoz et al., 1994). PPAR8, also called PPAR[beta], is expressed in numerous tissues but more abundantly in lipid metabolizing tissues, such as muscle, intestine, or white adipose (Amri et al., 1995; Poirier et al., 2001). In such tissues, PPAR[delta] regulates the expression of genes implicated in fatty acid uptake and metabolism (Bastie et al., 1999). A variety of substances have been suggested to be natural ligands for PPAR[gamma], including fatty acids and eicosanoids, components of oxidized low-density lipoproteins, and oxidized alkyl phospholipids including lysophosphatidic acid and nitrolinoleic acid (Nagy et al., 1998; Desvergne et al., 1999; McIntyre et al., 2003). The prostaglandin J2 derivative, 15-deoxy-12,14-PGJ2, does not naturally exist at sufficient concentrations to activate PPAR[gamma] in mammalian cells and affects cellular pathways other than PPAR[gamma] (Straus et al., 2000; Bell-Parikh et al., 2003).

Stearoyl-CoA desaturase (SCD) is the rate-limiting enzyme in the cellular synthesis of unsaturated fatty acids from saturated fatty acids (Ntambi, 1999). In addition, the unsaturated fatty acids can function as ligands for PPAR[alpha] and PPAR[gamma] (Kliewer et al., 1997). Therefore, SCD can increase cellular content of ligands for PPAR and induce its expression. Adipocyte fatty acid-binding protein or aP2, a-FABP or FABP4, is a marker of preadipocyte differentiation into adipocytes and is transcriptionally regulated by PPAR[gamma] (Bernlohr et al., 1985; MacDougald et al., 1995). FAS, which includes the enzymes of the fatty acid synthesis elongation cycle, is present in a single polypeptide chain, multifunctional enzyme complex in eukaryotes also involved in adipocyte differentiation at different stages. Those adipocyte specific genes regulate free fatty acid accumulation, thereby leading to the characteristic phenotype of the mature adipocyte.

In the present study, the expression of PPAR[gamma]2, SCD, and FAS in the longissimus muscle of steers receiving treatment 2 was higher than in other treatments, whereas the expression of aP2 in treatment 2 was not higher than control. The difference may not have appeared significant among treatments due to the fact that the study was conducted for only a few days. Low expression of aP2 in the treatment 2 group may be caused by insufficient natural ligands for PPAR[gamma]2 in the longissimus muscle. CrP also did not significantly induced SCD, and thus the synthesis ligands for PPAR[gamma]2 were of a smaller magnitude. As a result, only adipocyte number and size were increased; however, fatty acid deposition was not significantly increased.

In treatment 3, the addition of Vit C decreased PPAR[gamma]2, SCD, FAS, and aP2 gene expression in contrast to control, which implies that Vit C could not enhance the accumulation of intramuscular fat in Korean native steers. These findings are contradictory to the findings of Toriisin et al. (1995). In the present study, an increase in adipocyte differentiation with CrP supplementation probably reduced the serum NEFA level with no effect on serum HDL-C, LDL-C, and TG concentrations. A lower serum NEFA concentration is an established indicator of a lipogenic activity and/or reduced lipolysis.

http://dx.doi.org/10.5713/ajas.2011.11073

REFERENCES

Amri, E. Z., F. Bonino, G. Ailhaud, N. A. Abumrad and P. A. Grimaldi. 1995. Cloning of a protein that mediates transcriptional effects of fatty acids in preadipocytes: homology to peroxisome proliferator-activated receptors. J. Biol. Chem. 270:2367-2371.

Anderson, R. A. 1998. Chromium, glucose intolerance and diabetes. J. Am. Coll. Nutr. 17:548-555.

Bastie, C., D. Holst, D. Gaillard, C. Jehl-Pietri adn P. A. Grimaldi. 1999. Expression of peroxisome proliferator-activated receptor PPARdelta promotes induction of PPARgamma and adipocyte differentiation in 3T3C2 fibroblasts. J. Biol. Chem. 274: 21920-21925.

Bell-Parikh, L.C., T. Ide, J. A. Lawson, P. McNamara, M. Reilly and G. A. FitzGerald. 2003. Biosynthesis of 15-deoxy-delta12,14-PGJ2 and the ligation ofPPARgamma. J. Clin. Invest. 112945-955.

Berger, J. and D. E. Moller. 2002. The mechanism of action of PPARs Annu. Rev. Med. 53:409-435.

Bernlohr, D. A., M. A. Bolanowski, T. J. J. Kelly and M. D. Lane. 1985 Evidence for an increase in transcription of specific mRNAs during differentiation of 3T3-L1 preadipocytes. J. Biol. Chem. 260:5563-5567.

Cheah, K. S., A. M. Cheah and A. Just. 1997. A simple and rapid biopsy technique for obtaining fat and muscle samples from live animals for predicting meat quality. Dan. Veterinaertidsskr. 80:775-777.

Cianzio, D. S., D. G. Topel, G. B. Whitehurst, D. C. Beitz and H. L. Self. 1985. Adipose tissue growth and cellularity: changes in bovine adipocyte size and number. J. Anim Sci. 60:970-976.

Desvergne, B. and W. Wahli. 1999b. Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr. Rev. 20:649-688.

Ntambi, J. M. 1999. Regulation of stearoyl-CoA desaturase by polyunsaturated fatty acids and cholesterol. J. Lipid Res. 40:1549-1588.

Hood, R, L. and C. E. Allen. 1973. Cellularity of bovine adipose tissue. J. Lipid Res. 14:605-610.

Kliewer, S. A., S. S. Sundseth, S. A. Jones, P. J. Brown, G. B. Wisely, C. S. Koble, P. Devchand, W. Wahli, T. M. Willson, J. M. Lenhard and J. M. Lehmann. 1997. Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors a and [gamma]. Proc. Natl. Acad. Sci. USA. 94:4318-4323.

MacDougald, O. A. and M. D. Lane. 1995. Transcriptional regulation of gene expression during adipocyte differentiation. Annu. Rev. Biochem. 64:345-373.

McDowell, L. R. 1989. Vitamins in animal nutrition. Academic press, New York.

McIntyre, T. M., A. V. Pontsler, A. R. Silva, A. St Hilaire, Y. Xu, J. C. Hinshaw, G. A. Zimmerman, K. Hama, J. Aoki, H. Arai and G. D. Prestwich. 2003. Identification of an intracellular receptor for lysophosphatidic acid (LPA): LPA is a transcellular PPARgamma agonist. Proc. Natl. Acad. Sci. USA 100:131-136.

Mertz, W. 1993. Chromium in human nutrition: a review. J. Nutr. 123:626-633.

Mooradian, A. D. and J. E. Morley. 1997. Micronutrient status in diabetes mellitus. Am. J. Clin. Nutr. 45:877-895.

Mowat, D. N. 1997. Organic Chromium in Animal Nutrition. Chromium Books, Guelph, ON, Canada.

Nagy, L., P. Tontonoz, J. G. Alvarez, H. Chen and R. M. Evans. 1998. Oxidized LDL regulates macrophage gene expression through ligand activation of PPARgamma. Cell. 93:229-240.

Ohashi, H., H. Takizawa and M. Matsui. 2000. Effect of vitamin C on the quality of Wagyu beef. Research bulletin of aichi agriculture research center. 32:207-214. (In Japanese)

Pethick, D. W. 1984. Energy metabolism of skeletal muscle, in: Ruminant Physiology (Ed. J. M. Gawthorne, S. K. Baker, J. B. Mac, D. B. Kintosh Purser). Concepts and Consequences. Symposium held at University of Western Australia, 7-10 May 1984, Nedlands, Australia, 1984. pp. 277-287.

Poirier, H., I. Niot, M. C. Monnot, O. Braissant, C. Meunier Durmort, P. Costet, T. Pineau, W. Wahli, T. M. Willson and P. Besnard. 2001. Differential involvement of peroxisome-proliferator-activated receptors alpha and delta in fibrate and fatty-acid-mediated inductions of the gene encoding liver fatty-acid-binding protein in the liver and the small intestine. Biochem. J. 355:481-488.

Parsey, R. V. and D. R. Matteson. 1993. Ascorbic acid modulation of calcium channels in pancreatic p cells. J. Gen. Physiol. 102(3):503-523.

Sahin, K., N. Sahin and O. Kucuk. 2003. Effects of chromium, and ascorbic acid supplementation on growth, carcass traits, serum metabolites, and antioxidant status of broiler chickens reared at a high ambient temperature (32[degrees]C). Nutr. Res. 23:225-238.

Smith, S. B. and J. D. Crouse. 1984. Relative contributions of acetate, lactate and glucose to lipogenesis in bovine intramuscular and subcutaneous adipose tissue. J. Nutr. 114:798-800.

Steel, R. G. D. and J. H. Torrie. 1980. Principles and Procedures of Statistics. McGraw-Hill Book Co., NY, USA.

Straus, D. S., G. Pascual, M. Li, J. S. Welch, M. Ricote, C. H. Hsiang, L. L. Sengchanthalangsy, G. Ghosh and C. K. Glass. 2000. 15-deoxydelta 12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway. Proc. Natl. Acad. Sci. USA 97:4844-4849.

Stryer, Lupert. 1995. Biochemistry. New York: W. H. Freeman and Co., 1995. 773

Tontonoz, P., E. Hu, R. A. Graves, A. I. Budavari and B. M. Spiegelman. 1994. PPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev. 8:1224-1234.

Toriisin, I., Matsuda, K et al. 1995. Society of beef cattle science. 59:25-29.

Wells, W. W., C. Z. Dou, L. N. Dybas, C. H. Jung, H. L. Kalbach and D. P. Xu. 1995. Ascorbic acid is essential for the release of insulin from scorbutic guinea pig pancreatic islets. Proc. Natl. Acad. Sci. USA. 92(25):11869-11873.

Hong-Gu Lee (1a), Jin-Long Yin (a), Cheng-Xiong Xu (2), Zhong-Shan Hong (3), Zhe-Hu Lee, Yong-Cheng Jin (1), Chang-Weon Choi (4), Do-Hyeung Lee (5), Kyoung Hoon Kim (6) and Yun-Jaie Choi **

Department of Animal Science and Technology and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul 151-742, Korea

* This study was supported by the Brain Korea 21 program and "Cooperative Research Program for Agricultural Science & Technology Development", RDA, Republic of Korea.

** Corresponding Author : Yun Jaie Choi. Department of Agricultural Biotechnology, School of Agricultural Biotechnology, Seoul National University, Seoul 151-742, Korea. Tel: +82-2-880-4807, Fax: +82-2-875-7340, E-mail: cyjcow@snu.ac.kr

(1) Department of Animal Science, Pusan National University, Miryang, Gyeongnam 627-706, Korea.

(2) Department of Molecular Oncology, H Lee Moffitt Cancer Center, Tampa, Florida 33612, United States of America.

(3) Department of Animal Science and Technology, Tianjin Agricultural University, China.

(4) Department of Animal Resources, Daegu University, Gyeongsan, Gyeongbuk 712-714, Korea.

(5) GRRC, Hankyong University, Anseong 456-749, Korea.

(6) National Livestock Research Institute, RDA, Suwon, 441-706, Korea.

(a) These authors contributed equally to this work.

Received March 21, 2011; Accepted June 3, 2011
Table 1. Marker genes used in real-time polymerase chain reaction

                                                     Product size
Gene                Primer nucleotide sequence       (base pair)

[beta]-actin    Forward 5' CGCACCACTGGCATTGTCAT3'        227
                Reverse 5' TCCAAGGCGACGTAGCAGAG3'

PPAR [[gamma]   Forward 5' CGCACTGGAATTAGATGACAG3'       214
.sub.2]         Reverse 5' CACAATCTGTCTGAGGTCTGT3'

Glut 4          Forward 5' TTTCTTCTATTCGCGGTCCT3'        130
                Reverse 5' CCTGCTCCAGAAGAGAAGGT3'

SCD             Forward 5' CCTGGTGTCCTGTTGTTGT3'         244
                Reverse 5' GGTAGTTGTGGAAGCCCTC3'

aP2             Forward 5' CTGGCATGGCCAAACCCA3'          186
                Reverse 5' GTACTTGTACCAGAGCACC3'

FAS             Forward 5' TGATGGCCTACACTCAGAGC3'        129
                Reverse 5' GGGCCTCCAGCACTCTACTA3'

PPAR-[gamma] = Peroxisome proliferator-activated receptor-[gamma];
Glut 4 = Glucose transporter type 4; SCD = Stearoyl-coenzyme A
desaturase; aP2: adipocyte fatty-acid-binding protein; FAS =
Fatty acid synthase.

Table 2. Effects of glucose administration with vitamin C (Vit C)
and chromium picolinate (CrP) supplementation on serum glucose
levels at days 1 and 3 in Korean native steers (mg/dl)

Items                                   Treatments (1)

                           Control           T1              T2

Day 1   Total AUC (3)   12,125.50 (b)   25,057.07 (a)   23,434.43 (a)
        Incre AUC (4)   -1,887.73 (b)   11,545.73 (a)   8,950.33 (a)

Day 3   Total AUC (3)   12,646.40 (b)   21,870.27 (a)   23,710.27 (a)
        Incre AUC (4)   -203.57 (b)     10,518.10 (a)   10,026.60 (a)

Items                   Treatments (1)   SEM (2)    p value

                              T3

Day 1   Total AUC (3)   26,461.30 (a)    1,865.46   0.0079
        Incre AUC (4)   14,613.13 (a)    2,044.17   0.0053

Day 3   Total AUC (3)   25,518.77 (a)    1,822.86   0.0187
        Incre AUC (4)   14,302.37 (a)    1,818.88   0.0081

(1) All values represent the mean of triplicates. (2) Standard
error of the mean. (3) Area was calculated for 180 min (between 0
and 180) periods. (4) Area was calculated for the basal AUC for 180
min.

(a, b) Means in the same row with different superscripts differ
(p<0.05).

Control = Group treated with saline.

T1 = Group treated with glucose. T2 = Group treated with glucose
and CrP. T3 = Group treated with glucose, CrP, and Vit C.

AUC = Area under the curve.

Table 3. Effects of glucose administration with Vit C and CrP
supplementation on serum insulin levels on days 1 and 3 in Korean
native steers ([micro]g/L)

                                       Treatments (1)

Items                     Control           T1              T2

Day 1   AVG                1.12 (b)        6.95 (a)        7.16 (a)
        Incre (3)         -0.54 (b)        4.16 (a)        4.71 (a)
        Total AUC (4)    198.43 (b)      129.51 (a)    1,307.20 (a)
        Incre AUC (5)   -101.87 (b)      780.55 (a)      865.80 (a)

Day 3   AVG                1.08 (b)        6.03 (a)        6.19 (a)
        Incre3            -0.48 (b)        4.28 (a)        4.10 (a)
        Total AUC4       185.57 (b)    1,061.57 (a)    1,180.10 (a)
        Incre AUC5       -95.33 (b)      746.77 (a)      811.87 (a)

                        Treatments (1)

Items                         T3          SEM (2)     p value

Day 1   AVG                  6.49 (a)        0.822    0.0032
        Incre (3)            5.11 (a)        0.702    0.0001
        Total AUC (4)    1,212.73 (a)      156.183    0.0051
        Incre AUC (5)      964.10 (a)      131.018    0.0001

Day 3   AVG                  5.65 (a)        0.662    0.0005
        Incre3               4.47 (a)        0.665    0.0006
        Total AUC4       1,123.03 (a)    1,126.992    0.0004
        Incre AUC5         911.37 (a)      127.599    0.0004

(1) All values represent the mean of triplicates. (2) Standard
error of the mean. (3) AVG was corrected for the basal average
for 180 min. (4) Area was calculated for 180 min (between 0 and
180) periods. (5) Area was corrected for basal AUC for 180 min.

(a, b) Means in the same row with different superscripts differ
(p<0.05).

Control = Group treated with saline.

T1 = Group treated with glucose. T2 = Group treated with glucose
and CrP. T3 = Group treated with glucose, CrP, and Vit C.

Table 4. Effects of glucose administration with Vit C and CrP
supplementation on serum parameters at days 1 and 3 in Korean
native steers (mg/dl)

                                  Treatments (1)

Items                    Control        T1           T2

Day 1   HDL     0 min    153.30       171.30       186.13
               90 min    155.10       162.90       193.20

        LDL     0 min     34.67        36.00        37.67
               90 min     34.67        33.67        39.00

        TG      0 min     14.67        18.67        18.67
               90 min     14.67        13.33        12.67

        NEFA    0 min      0.31         0.19         0.16
               90 min      0.25 (a)     0.09 (b)     0.06 (b)

Day 3   HDL     0 min    145.40       153.10       175.83
               90 min    148.60       162.47       174.03

        LDL     0 min     29.67        31.00        33.00
               90 min     30.33        33.33        32.67

        TG      0 min     14.67        14.67        21.67
               90 min     15.00        14.00        13.33

        NEFA    0 min      0.52         0.16         0.18
               90 min      0.19 (a)     0.10 (b)     0.09 (b)

                        Treatments
                            (1)

Items                        T3        SEM (2)      p value

Day 1   HDL     0 min    122.90         9.792        0.1632
               90 min    125.2          9.343        0.0939

        LDL     0 min     24.67         2.434        0.3494
               90 min     25.00         2.258        0.2609

        TG      0 min     13.33         1.263        0.3573
               90 min     11.67         0.883        0.7086

        NEFA    0 min      0.38         0.053        0.0831
               90 min      0.19 (a)     0.028        0.0075

Day 3   HDL     0 min    119.47         9.156        0.2132
               90 min    122.90         9.065        0.2832

        LDL     0 min     24.67         2.109        0.6611
               90 min     25.00         2.244        0.6767

        TG      0 min     18.00         1.577        0.5002
               90 min     16.67         0.871        0.6030

        NEFA    0 min      0.27         0.082        0.4271
               90 min      0.16 (a)     0.016        0.0135

(1) All values represent the mean of triplicates. (2) Standard
error of the mean.

(a, b) Means in the same row with different superscripts differ
(p<0.05).

Control = Group treated with saline.

T1 = Group treated with glucose. T2 = Group treated with glucose
and CrP. T3 = Group treated with glucose, CrP, and Vit C.

HDL = High-density lipoprotein; LDL = Low-density lipoprotein;
TG = Triglyceride; NEFA = Non-esterified fatty acid.

Table 5. Relative fold induction of genes
in muscle tissue (Mean fold change *)

                             Treatments (1)

                     Control                 T1

PPAR[gamma]2   1.02 [+ or -] 0.209   0.60 [+ or -] 0.177
SCD            1.00 [+ or -] 0.000   0.57 [+ or -] 0.347
FAS            1.00 [+ or -] 0.000   1.04 [+ or -] 0.898
aP2            1.02 [+ or -] 0.209   0.85 [+ or -] 0.518

                             Treatments (1)

                       T2                    T3

PPAR[gamma]2   1.30 [+ or -] 0.412   0.60 [+ or -] 0.062
SCD            1.40 [+ or -] 0.176   0.88 [+ or -] 0.348
FAS            1.50 [+ or -] 0.189   0.76 [+ or -] 0.385
aP2            0.93 [+ or -] 0.178   0.77 [+ or -] 0.462

(1) All values represent the mean of triplicates.
T1 = Glucose, T2 = Glucose+CrP, T3 = Glucose+CrP+Vit C.

PPAR-[gamma]2 = Peroxisome proliferator-activated
receptor-[gamma]; SCD = Stearoyl-coenzyme A desaturase; FAS =
Fatty acid synthase; aP2 = adipocyte fatty-acid- binding protein.

* Relative fold induction was calculated using the
[DELTA][DELTA]Ct method.
COPYRIGHT 2011 Asian - Australasian Association of Animal Production Societies
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lee, Hong-Gu; Yin, Jin-Long; Xu, Cheng-Xiong; Hong, Zhong-Shan; Lee, Zhe-Hu; Jin, Yong-Cheng; Choi,
Publication:Asian - Australasian Journal of Animal Sciences
Article Type:Report
Geographic Code:9SOUT
Date:Nov 17, 2011
Words:4741
Previous Article:Sialoglycoproteins of mammalian erythrocyte membranes: a comparative study.
Next Article:Dietary tea catechin inclusion changes plasma biochemical parameters, hormone concentrations and glutathione redox status in goats.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |