Printer Friendly

Effects of Holy Basil (Ocimum sanctum) Extract on the Growth, Immune Response and Disease Resistance against Streptococcus agalactiae of Nile Tilapia (Oreochromis niloticus).

Byline: Dutrudi Panprommin, Wit Kaewpunnin and Danai Insee

Abstract

This study was conducted to investigate the effects of supplementing the diet of Nile tilapia (Oreochromis niloticus) with holy basil (Ocimum sanctum) extract at the concentrations of 0 (control), 100, 200 and 400 mg/kg of feed for 30 days. The treated fish fed the holy basil extract at the 200 mg/kg level showed the significantly (Pless than 0.05) greatest increases in specific growth rate and the greatest improvements in feed conversion ratio. The immune response, phagocytic activity and superoxide anion production were also stimulated the most on day 7 of the feed supplementation. In a streptococcal challenge experiment, the fish fed the holy basil extract at the 100 and 200 mg/kg levels showed 0% cumulative mortality, whereas the control group and the fish fed with extract at the 400 mg/kg level showed 100 and 40% mortality, respectively. The greatest stimulation of the immune response occurred in the fish fed the holy basil extract at the level of 200 mg/kg of diet.

Thus, the analysis of the relative expression levels of three cytokine genes, which included interleukin-1b (IL-1b), interleukin-8 (IL-8) and transforming growth factor-b (TGF-b), were compared between a control group and a fish group fed the holy basil extract at the 200 mg/kg level. The expression of all the genes was significantly (Pless than 0.05) greater in the treated than in the control fish, especially on day 7 of the feed supplementation. These results indicated that the addition of holy basil extract to fish feed at the rate of 200 mg/kg of diet could enhance the growth, immune response and disease resistance against S. agalactiae of Nile tilapia during a 30-day supplementation period.

Keywords: Holy basil; Oreochromis niloticus; Streptococcus agalactiae; Dietary Supplement; Cytokine genes

Introduction

Nile tilapia (Oreochromis niloticus) is one of the economically important freshwater fish in Thailand. This fish species is easy to manage and grows rapidly, reaching a harvest maturity of 1 to 1.5 kg in 8 to 10 months. In 2012, the production and value of this fish was approximately 236,500 tons and 11,162.1 million baht, respectively (Department of Fisheries, 2014). However, the culture of this fish is limited because of disease outbreaks. Streptococcosis is a disease caused by infection with the bacterium Streptococcus agalactiae. The symptoms of this disease, which causes more than 50% fish mortality in 3-7 days (Yanong and Floyd, 2002), are abnormal behavior, including erratic-spiral swimming, combined with the external clinical signs of exophthalmia, darkening body and swollen abdomen (Areechon et al., 2005). Farmers routinely mix antibiotics with their fish feed because antibiotic treatment is an effective method to control streptococcal infection.

However, the overuse of antibiotics may lead to the development of antibiotic-resistant bacteria and the accumulation of antibiotics in fish can be dangerous to consumers. Therefore, the alternative methods including such approaches as feed supplementation with plant extracts are needed to manage streptococcal disease in aquaculture (Cheunbarn and Cheunbarn, 2015).

Holy basil (Ocimum sanctum) is a medicinal plant belonging to the family Lamiaceae. The leaves of holy basil contain water-soluble phenolic compounds and various components, such as eugenol, methyl eugenol and caryophyllene that act as immunostimulants (Bairwa et al., 2012). In aquaculture, the supplementation of feed with holy basil extract was studied in several fish, including Oreochromis mossambicus (Logambal et al., 2000), Epinephelus tauvina (Sivaram et al., 2004), Catla catla (Chitra and Krishnaveni, 2011), Cyprinus carpio (Pavaraj et al., 2011) and Labeo rohita (Das et al., 2013). Moreover, holy basil also affects the resistance to pathogens, such as Vibrio harveyi (Sivaram et al., 2004) and Aeromonas hydrophila (Logambal et al., 2000; Chitra and Krishnaveni, 2011; Pavaraj et al., 2011; Das et al., 2013).

The purposes of the present research were to investigate the effects of the supplementation of fish feed with holy basil extract at different concentrations on Nile tilapia growth, immune response and disease resistance against the bacterial pathogen S. agalactiae. The relative expression levels of cytokine genes, including interleukin-1b (IL-1b), interleukin-8 (IL-8) and transforming growth factor-b (TGF-b), were also determined using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). The holy basil extract in fish feed may be an alternative practice for disease management. The holy basil extract is a natural material that may replace the use of antibiotics in aquaculture. Although antibiotics effectively control diseases, they can remain in the environment and in consumers. Thus, the replacement of antibiotics with the plant extract can potentially reduce the cost of production and increase the sustainability of aquaculture.

Materials and Methods

Plant Extract

Holy basil was purchased from a local market in Phayao Province, Northern Thailand. The leaves were washed and dried at 50-60C for 2 days and then ground to a powder. A 100 g aliquot of the holy basil powder was extracted with 300 mL of absolute ethanol (1: 3) at room temperature for 48 h. The slurry was filtered, and insoluble fraction was removed by centrifugation at 4,800 rpm at 4C for 20 min. The upper phase was transferred and condensed at 35C by rotary evaporator until the solvent had evaporated (Sivaram et al., 2004). The crude extract was stored at 4C until used.

Animals and Experimental Design

Healthy juvenile Nile tilapia with an average weight of 405 g were purchased from a commercial farm in Chiang Mai province, northern Thailand and stocked in 500 L tanks. The fish were acclimatized for 2 weeks and fed a commercial diet (32% protein). After acclimatization, the fish were divided into four experimental groups, which were provided feed supplemented with the holy basil extract at concentrations of 0, 100, 200 and 400 mg/kg of diet. The crude extract was dissolved in absolute ethanol at various concentrations and mixed with the commercial diet. Each experimental group contained 90 fish, which were divided among three tanks and fed one of the experimental diets twice daily for 30 days.

Immune Responses

Aliquots of the blood of nine fish from each experimental group were collected on days 1, 3, 7, 15 and 30 of the feed supplementation period. The fish were randomly sampled and anesthetized with MS-222 (Sigma-Aldrich, Saint Louis, MO, USA) suspension in water. The blood was collected from the caudal vein with a 1 mL plastic syringe rinsed with anticoagulant (10% EDTA). For leukocytes, 1 mL of the collected blood from each fish was suspended in 2 mL of RPMI 1640 medium (PAA Laboratories GmbH, Pasching, Austria) and then separated by density gradient centrifugation. The 3 mL of diluted blood was gently rinsed into 3 mL of Lymphoprep (Axis-Shield, Oslo, Norway) and centrifuged at 2,500 rpm for 30 min at 25C. The leukocyte phase was pipetted, resuspended in 2 mL of PBS and centrifuged twice for 10 min, each time at 1,500 rpm and 25C.

The leukocytes were adjusted to 2 x 107 cells/mL and deposited on a cover slip before they were incubated at room temperature for 2 h. The non-adherent cells were removed, and the cells adhering to the cover slip were washed three times with PBS. Baker's yeast (2 x 107 cells/mL) was added to these leukocytes and the mixture was incubated at room temperature for 1 h. After incubation, the cover slip was washed three times with PBS and stained with the Wright rapid stain set (RVL Supply, Bangkhen, Bangkok, Thailand). The percentage of phagocytic activity (PA) was calculated from the number of phagocytotic cells per 100 leukocytes.

The superoxide anion production was determined using the nitroblue tetrazolium (NBT) test. The adjusted leukocytes were deposited on a cover slip and incubated in a moisture chamber at room temperature for 30 min. After incubation, the cells were washed three times with PBS to remove the non-adherent cells. NBT (0.2%) was added to the adherent leukocytes, which were then incubated in the moisture chamber at room temperature for another 30 min. The cover slip was washed three times with PBS, air dried and placed under a microscope to count the number of deep blue cells per 100 leukocyte cells.

Growth

After the 30-day dietary treatment, the weights of the individual fish from each experimental group were measured to calculate the specific growth rate (SGR). The total amount of diet consumed by each experimental group was weighed to calculate the feed conversion ratio (FCR). The SGR and FCR were calculated according to Ricker (1979) as follows:

SGR = ln (final weight) - ln (initial weight) x 100 / Total duration of the experiment

FCR = Total amount of feed / Weight gain

Disease Resistance

S. agalactiae was isolated from diseased Nile tilapia and obtained from the Department of Aquaculture, Kasetsart University. A suspension of S. agalactiae was prepared in sterile 0.85% NaCl and diluted to 2 x 107 cells/mL. After the 30-day feed supplementation, thirty fish from each experimental group were intraperitoneally injected with 0.1 mL of bacterial suspension containing 2 x 107 cells/mL. The control group was divided into two groups, a positive control was injected with the bacterial suspension and a negative control was injected with the PBS solution. Dead fish were removed and recorded daily for 15 days to calculate the cumulative mortality. Bacteria were isolated from the head kidney to confirm the cause of mortality.

Expression of Cytokine Genes using Semi-quantitative RT-PCR

The head kidney tissues were collected from nine fish that fed on the 200 mg/kg level of holy basil extract and nine untreated control fish on days 1, 3, 7, 15 and 30 of feed supplementation. The tissues were extracted for total RNA using TRIzol reagent (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer's instructions. The tissues were first homogenized in 1 mL of TRIzol reagent using glass gliders. The homogenate was incubated at room temperature for 5 min. Two hundred microlitres of chloroform was added and vigorously shaken for 15 s. Then, the mixture was centrifuged at 12,000 rpm at 4C for 15 min. After the color less upper phase was transferred to a new 1.5 mL microcentrifuge tube, the total RNA was precipitated by adding 500 uL of isopropanol followed by centrifugation. The quantity and quality of the total RNA were determined by measuring the OD at 260 nm and by electrophoresis on 1.0% formaldehyde-agarose gel, respectively.

The first-strand cDNAs were synthesized with 1 ug of total RNA and 1 uL of oligo (dT18) primer using the iScript Select cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions. The reaction was incubated at 65C for 5 min and chilled on ice for 1 min. One microlitre of Moloney murine leukemia virus (MMLV) reverse transcriptase, 4 uL of 5x first-strand buffer and 2 uL of 10 mM dNTPs were added and incubated first at 42C for 90 min and then at 85C for 5 min. The first-strand cDNAs were stored at -20C until used.

The expression levels of three cytokine genes, including IL-1b, IL-8 and TGF-b, were determined using b-actin as an internal control. Primers were designed from expressed sequence tags (ESTs) sequences obtained from a head kidney library (Wangkahart et al., 2008) (Table 1).

A standard PCR reaction was performed in a 25 uL reaction containing 0.5 uL of cDNA template, 0.2 mM of each dNTP, 1x Taq buffer, 1 U of Taq DNA polymerase and 1 uM of forward and reverse primers. The cycling conditions included an initial denaturation at 95C for 5 min, denaturation of 95C for 30 s and annealing at 55C for 30 s, with an extension at 72C for 30 s followed by 72C for 5 min. The MgCl2 concentration and cycle numbers were optimized for the analysis of relative gene expression. The optimal concentration between 1 to 4 mM MgCl2 and the cycle numbers, including 22, 25, 28, 32 and 35, were examined using the standard PCR conditions.

Ten microlitres of each PCR product was electrophoresed on a 1.5% agarose gel, stained with ethidium bromide and visualized with UV light. The intensity of the resulting bands was measured with a gel documentation system (SynGene, Frederick, MD, USA) and subsequently analyzed with GeneTools software. The percentage of the relative expression of each cytokine gene was calculated from the ratio between the relative expression of the gene and that of b-actin.

Data Analysis

Data were presented as means standard deviation. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by a post hoc test (Duncan's new multiple range test). Significance was set at Pless than 0.05.

Results

Immune Responses

Compared with the control group, the phagocytic activity in all the experimental groups whose diets were supplemented with the holy basil extract was significantly (Pless than 0.05) increased during the 30-day supplementation (Fig. 1A). The fish treated with any concentration of the extract showed the highest phagocytic activity on day 7, especially at the 200 mg/kg level. However, the feeding of holy basil extract at the highest test concentration of 400 mg/kg of diet resulted in a significant (Pless than 0.05) decline in phagocytic activity.

All the dietary concentrations of holy basil extract stimulated the nitrobluetetrazolium staining of cells when compared with the cells of the control group (Fig. 1B). The effect was strongest and significant (Pless than 0.05) after 7 days of supplementation, especially at the concentration of 200 mg/kg of diet. However, the fish fed the holy basil extract at 100 rather than 200 mg/kg of diet showed a significantly (Pless than 0.05) lower NBT.

Growth

The fish fed the holy basil extract at a concentration of 200 mg/kg of feed showed an enhanced specific growth rate when compared with that of the control fish and that of the experimental groups fed the extract at the rate of 100 or 400 mg/kg of diet; however, only the difference between the 100 and 200 mg/kg concentrations was statistically significant (Pless than 0.05) (Table 2). Moreover, the holy basil extract also influenced the feed conversion ratio (FCR). The experimental groups that included the fish fed any concentration of the holy basil extract showed a significantly (Pless than 0.05) better FCR than that of the control fish (Table 2).

Table 1: Gene-specific primers used for semi-quantitative RT-PCR

Gene###Accession number###Primer sequence 5' to 3'###Product length (bp)

IL-1b###FF279762###F: GTCACTGACAGCCAAAAGAG###339

###R: GACAGACATGAGAGTGCTGA

IL-8###FF279523###F: CTGTCATGGTCTGCATCTC###256

###R: GAGGAAGTGGTCTTCTGCT

TGF-b###FF280142###F: CATAAGCCAACGGGTTAC###359

###R: CCCCATGTCCACATTATC

b-actin###FF280738###F: CGTGACCTCACAGACTACCT###409

###R: CTGTGATCTCCTTCTGCATC

Table 2: Specific growth rate and feed conversion ratio of fish fed four different concentrations of holy basil extract (control, 100, 200 and 400 mg/kg of diet) for 30 days

Concentration of the###Average weight###Specific growth###Feed Conversion

extract (mg/kg diet)###gain (g)###rate (%)###Ratio

0###18.28 2.28ab###1.18 0.12ab###1.02 0.14b

100###17.04 1.73b###1.12 0.11b###0.64 0.07a

200###25.78 6.40a###1.58 0.31a###0.55 0.12a

400###19.18 4.00ab###1.23 0.23ab###0.68 0.15a

Disease Resistance

Oral administration of the holy basil extract to the fish at the concentrations of 100 and 200 mg/kg of diet enhanced their disease resistance against S. agalactiae and led to 0% mortality (Fig. 2). The positive control (injected with bacterial suspension) and the fish fed the holy basil extract at the 400 mg/kg level showed 100 and 40% mortality, respectively, at day 15. The negative control (injected with PBS) also showed 0% mortality.

Table 3: Optimal MgCl2 concentrations and cycle numbers for amplifying the expression level of cytokine genes

Gene###MgCl2 concentration (mM)###cycle number

IL-1b###4###28

IL-8###2###28

TGF-b###1.5###28

b-actin###1.5###28

Expression Levels of Cytokine Genes

The optimal MgCl2 concentration for each primer was determined using a range of concentrations (1-4 mM). The concentrations that gave the highest yields were chosen (Table 3). The optimal cycle numbers were determined similarly, and for each gene, the cycle number that generated the highest yield before the product reached the plateau phase was chosen (Table 3).

The relative expression levels of the IL-1b, IL-8 and TGF-b cytokine genes were determined by normalization with the expression of b-actin. The expression patterns of all the cytokine genes were similar (Fig. 3). After feeding the holy basil extract at 200 mg/kg of diet for 30 days, the expression of all the cytokine genes was significantly (Pless than 0.05) increased compared with that of the control group. The expression of the genes was stimulated to a significantly (Pless than 0.05) higher degree in the treated than in the untreated fish. The transcription levels gradually increased until reaching their highest on day 7; then, the levels decreased by day 15 and 30.

Discussion

The previous studies of the effects of supplementing fish diets with plant extract mostly examined nonspecific immune responses, such as phagocytic activity and respiratory burst activity. The results of these studies showed that these parameters could be improved using extracts from several plants, such as Spirulina platensis (Watanuki et al., 2006), Curcuma longa (Swagatika et al., 2008) and Echinacea purpurea (Mohamad and Abasali, 2010). Additionally, the use of Holy basil extract as a feed supplement was especially effective in stimulating these immune responses (Logambal et al., 2000; Sivaram et al., 2004). In the present study, the holy basil extract at concentrations of 100 and 200 mg/kg of diet induced significant increases in the levels of phagocytic activity and superoxide anion production, and these increases were highest on day 7 of supplementation.

However, increasing the concentration to 400 mg/kg of diet did not further increase the immune responses, as well as the results from Sivaram et al. (2004). Although eugenol, that is an important component in holy basil can stimulate immunity, but at the high concentrations can affect the toxicity to fish (Dolezelova et al., 2011).

The feeding of holy basil extract effected growth of Nile tilapia. The specific growth rate (SGR) of the fish fed the holy basil extract at 200 mg/kg of diet was higher than that of the other groups but differed significantly only from that of the 100 mg/kg treatment group. Sivaram et al. (2004) suggested that greasy grouper fed of holy basil at the concentration of 200 mg/kg of diet also increased the highest SGR. The feed conversion ratio (FCR) is a measure of the efficiency of food use. The holy basil extract resulted in the treated fish could improve their (lower) FCRs at all the treatment concentrations.

The oral administration of holy basil extract for 30 days could enhance disease resistance against S. agalactiae in Nile tilapia. An extract of holy basil can play an important role in immunostimulant functions (Bairwa et al., 2012) and antibacterial activity (Singh et al., 2005; Aggarwal and Goyal, 2012). In the present study, fish fed any of the test concentrations of the holy basil extract showed stimulation of the immune system and reduced cumulative mortality. Feeding of holy basil at the concentration of 100 and 200 mg/kg of diet also significantly reduced the mortality from V. harveyi than control in greasy grouper (Sivaram et al., 2004). Moreover, dietary holy basil extract of 0.2% showed significantly higher protection relative percentage survival of Labeo rohita against A. hydrophila infection than control (Das et al., 2013).

The relative expression levels of cytokine genes, including IL-1b, IL-8 and TGF-b, were investigated using the semiquantitative RT-PCR technique. The optimal MgCl2 concentration and cycle number for maximizing the yields of the amplified PCR products were determined. In the present study, the expression of three cytokine genes of the fish fed holy basil extract was increased significantly above that of the control group. IL-1b and IL-8 are two important proinflammatory cytokines and reliable markers of inflammatory responses (Corripio-Miyar et al., 2007). IL-1b, one form of IL-1, is induced in fish by extracts of plants, such as Spirulina platensis (Watanuki et al., 2006) and Curcuma longa (Panprommin et al., 2011). IL-8 is another member of the chemokine family, which is produced by many cell types and plays an important defensive role against inflammation and infection (Laing and Secombes, 2004) in the innate immune system.

Several plants also induce increased expression levels of the IL-8 gene. For example, the root of Panax ginseng (Sonada et al., 1998) and the rhizomes of Curcuma longa (Panprommin et al., 2011) stimulate the expression of IL-8 in human monocytic cell lines and the head kidney of Nile tilapia, respectively. TGF-b, another type of cytokine, plays a role in immunity and can be stimulated by plant extracts, as shown in the present study.

In conclusion, supplementation with 200 mg of holy basil extract per kg of diet could significantly enhance the growth and immune system function of Nile tilapia and protect the fish against S. agalactiae infection. In addition, the relative expression levels of three cytokine genes were also stimulated. However, the sources and harvest season of the holy basil plant are the major factors that will affect the quality of the extract.

Acknowledgements

This study was funded by a grant (number R020056208005) from University of Phayao and partially supported by the Center of Excellence on Agricultural Biotechnology, Science and Technology Postgraduate Education and Research Development Office, Office of Higher Education Commission, Ministry of Education (AG-BIO/PERDO-CHE). We also thank Central Laboratory, University of Phayao for equipment.

References

Aggarwal, S.G. and S. Goyal, 2012. Comparative analysis of antimicrobial activity of essential oil of Ocimum kilimandscharium. Asian J. Pharm. Clin. Res., 5: 53-55

Areechon, N., M. Endo, D. Jantawan, P. Srisapoome and N. Pirarat, 2005. Streptococcal infection in tilapia culture of Thailand. In: Proceedings of the JSPS-NRCT International Symposium Joint Seminar 2005: Productivity Techniques and Effective Utilization of Aquatic Animal Resources into the New Century, pp: 166-174. Bangkok, Thailand

Bairwa, M.K., J.K. Jakhar, Y. Satyanarayana and A.D. Reddy, 2012. Animal and plant originated immunostimulants used in aquaculture. J. Nat. Prod. Plant Resour., 2: 397-400

Chitra, G. and N. Krishnaveni, 2011. Immunostimulatory effect of Ocimum sanctum leaf extract on the Indian major carp, Catla catla. Plant Archives, 11: 213-214

Cheunbarn, T. and S. Cheunbarn, 2015. Cultivation of algae in vegetable and fruit canning industrial wastewater treatment effluent for tilapia (Oreochromis niloticus) feed supplement. Int. J. Agric. Biol., 17: 653-657

Corripio-Miyar, Y., S. Bird, K. Tsamopoulos and C.J. Secombes, 2007. Cloning and expression analysis of two pro-inflammatory cytokines, IL-1 beta and IL-8, in haddock (Melanogrammus aeglefinus). Mol. Immunol., 44: 1361-1373

Das, R., R.P. Raman, H. Saha and R. Singh, 2013. Effect of Ocimum sanctum Linn. (Tulsi) extract on the immunity and survival of Labeo rohita (Hamilton) infected with Aeromonas hydrophila. Aquac. Res., 1-11

Department of Fisheries, 2014. Fisheries Statistics of Thailand, 2012. Information Technology Center. No. 9/2014

Dolezelova, P., S. Macova, L. Plhalova, V. Pistekova and Z. Svobodova, 2011. The acute toxicity of clove oil to fish Danio rerio and Poecilia reticulate. Acta Vet. Brno, 80: 305-308

Laing, K.J. and C.J. Secombes, 2004. Chemokines. Dev. Comp. Immunol., 28: 443-460

Logambal, S.M., S. Venkatalakshmi and R.D. Michael, 2000. Immunostimulatory effect of leaf extract of Ocimum sanctum Linn. in Oreochromis mossambicus (Peters). Hydrobiologia, 430: 113-120

Mohamad, S. and H. Abasali, 2010. Effect of plant extracts supplemented diets on immunity and resistance to Aeromonas hydrophila in common carp (Cyprinus carpio). Res. J. Anim. Sci., 4: 26-34

Panprommin, D., K. Vanichkul, N. Panprommin and N. Areechon, 2011. Effects of turmeric (Curcuma longa Linn.) extract on the expression of cytokine genes in Nile tilapia (Oreochromis niloticus Linn.). In: Proceedings of 49th Kasetsart University Annual Conference: Fisheries, pp: 416-425. Bangkok, Thailand

Pavaraj, M., V. Balasubramanian, S. Baskaran and P. Ramasamy, 2011. Development of immunity by extract of medicinal plant Ocimum sanctum on common carp Cyprinus carpio (L.). Res. J. Immunol., 4: 12-18

Ricker, W.E., 1979. Growth rates and models. In: Fish Physiology, Vol 8, pp: 677-743. W.S. Hoar and P.J. Brett, (eds.). Academic Press, New York, USA

Singh, S., M. Malhotra and D.K. Majumdar, 2005. Antibacterial activity of Ocimum sanctum L. fixed oil. Ind. J. Exp. Biol., 43: 835-837

Sivaram, V., M.M. Babu, G. Immanuel, S. Murugadass, T. Citarasu and M.P. Marian, 2004. Growth and immune response of juvenile greasy groupers (Epinephelus tauvina) fed with herbal antibacterial active principle supplemented diets against Vibrio harveyi infections. Aquaculture, 237: 9-20

Sonada, Y., T. Kasahara, N. Mukaida, N. Shimizu, M. Tomoda and T. Takeda, 1998. Stimulation of interleukin-8 production by acidic polysaccharides from the root of Panax ginseng. Immunopharmacology, 38: 287-294

Swagatika, S., B.K. Das, B.K. Mishra, J. Pradhan, S.K. Samal and N. Sarangi, 2008. Effect of dietary Curcuma longa on enzymatic and immunological profiles of rohu, Labeo rohita (Ham.), infected with Aeromonas hydrophila. Aquac. Res., 39: 1720-1730

Wangkahart, E., N. Areechon and P. Srisapoome, 2008. Gene expression analyses in head kidney and spleen of Nile tilapia (Oreochromis niloticus) infected with Streptococcus agalactiae by expressed sequence tags (ESTs) technique. In: The 5th World Fisheries Congress. Yokohama, Japan

Watanuki, H., K. Ota, A.C. Malina, A.R. Tassakka, T. Kato and M. Sakai, 2006. Immunostimulant effects of dietary Spirulina platensis on carp, Cyprinus carpio. Aquaculture, 258: 157-163

Yanong, R.P.E. and R.F. Floyd, 2002. Streptococcal Infections of Fish. IFAS Extension. University of Florida, USA
COPYRIGHT 2016 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Panprommin, Dutrudi; Kaewpunnin, Wit; Insee, Danai
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9THAI
Date:Aug 31, 2016
Words:4472
Previous Article:Purification and Biochemical Characterization of a Pathogenesis Related Endochitinase Arachis hypogaea.
Next Article:Identification and S-metolachlor-safening Effects of Compounds Extracted from Ligusticum chuanxiong on Rice.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |