Printer Friendly

Effect of oxymatrine, the active component from Radix Sophorae flavescentis (Kushen), on ventricular remodeling in spontaneously hypertensive rats.

ARTICLE INFO

Keywords:

Oxymatrine

Radix Sophorae flavescentis (Kushen)

SHR

Ventricular remodeling

Gene overexpression

Signaling pathway

ABSTRACT

Purpose: To examine the effects of oxymatrine (OMT) on ventricular remodeling in spontaneous hypertension rat (SHR) and the underlying mechanism.

Methods: SHRs were divided into four groups: SHR control, SHR + 40 mg/kg captopril, SHR + 30 mg/kg OMT and SHR + 60 mg/kg OMT. Normotensive age-matched WKY rats were assigned to two groups: WKY control, WKY + 30 mg/kg OMT. The rats were orally administered with the corresponding drugs or drinking water for 21 weeks. Mean arterial blood pressure (MAP) and heart rate (HR) were measured. The left ventricular weight index (LVWI) and heart weight index (HWI) were determined. Myocardium tissue was stained with picric acid/Sirius red for measurement of collagen content measurements. The concentrations of serum norepinephrine and angiotensin 11 (Ang II) in myocardium were determined. Real-time RT-PCR was used to detect the mRNA expressions of transforming growth factor-131 (TGF-131), collagen types I, III and angiotensin converting enzyme (ACE). Western blots were performed to determine bioactivities of extracellular signal regulated kinase (ERK1 /2), c-Jun N-terminal kinase UNK/SAPK), p38 mitogen-activated protein kinases (p38 MAPK) and phospho-specific protein kinase C (PKC).

Results: In the SHR, hypertension, myocardium hypertrophy, more cardiac fibrosis, higher concentrations of serum norepinephrine and myocardium Ang II were observed. OMT treatment lowered the blood pressure, reduced the concentrations of serum norepinephrine and myocardium Ang II, favorably decreased the measured gravimetric parameters, decreased the interstitial and perivascular collagen deposition, attenuated the collagen of type I and III accumulation, downregulated the mRNA expression of ACE and TGF-131, and suppressed the phosphorylation of ERK 1/2, JNK and p38 MAPK in SHRs.

Conclusion: OMT prevents ventricular remodeling in SHR. The mechanisms may be related to inhibiting the gene overexpression of ACE and TGF-131, suppressing the activation of signaling pathways of ERK 1/2, JNK and p38 MAPK.

[c] 2012 Elsevier GmbH. All rights reserved.

Introduction

Congestive heart failure (CHF) is a major cause of morbidity and mortality worldwide, and quality of life among survivors is dramatically reduced as the disease progresses (Juenger et al. 2002). Based on population attributable risks, hypertension which may exacerbate ventricular remodeling (VR) and myocardial dysfunction has the greatest impact, accounting for 39% of CHF events in men and 59% in women (Kannel 2000). The VR process is a complex set of events involving hypertrophy, cardiac fibrosis, alterations of gene expression, and extracellular matrix that result in wall thickening, followed by heart failure (HF) (Kacimi and Gerdes 2003). Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophorae flavescentis (Kushen), a traditional Chinese herb medicine. Its molecular formula is [C.sub.15][H.sub.24][N.sub.2]0 and the structure is shown in Fig. 1. The anti-inflammatory and antioxidative effects of OMT, as well as its role in immunological regulation, have been reported (Cao et al. 2007). Hong-Li et al. showed that OMT could improve myocardial injuries during ischemia (Hong-Li et al. 2008). The effects of OMT on ventricular remodeling with chronic hypertension remain unknown. In the preliminary examination, we found that OMT could inhibit the sympathetic nervous system of rats. Spontaneously hypertensive rats (SHR) represent an attractive model of essential hypertension with a higher activity of sympathetic nervous system. This study examines the effects of long-term treatment of OMT on ventricular remodeling in SHR.

Materials and methods

Drugs and reagents

Oxymatrine with the purity of 98% (Lot Number: ZL10603GZ) was from Nanjing Zelang Medical Technology Co., Ltd. (Jiangsu, China). Captopril tablets (Lot Number: 100621) were the products of Jiangsu Huanghe River Pharmaceutical Co., Ltd. (Jiangsu, China). They were suspended in distilled water before use.

Animals and experimental protocols

Male spontaneously hypertensive rats (SHR) and control Wistar-Kyoto rats (WKY) were purchased from Shanghai Slac laboratory animal Co., Ltd. All animals were maintained in a 12h light/dark cycle room with the temperature at 22-24 [degrees]C and the humidity at 40 [+ or -] 5%. The rats received humane care and had free access to a standard diet and drinking water. The animal experiments were approved by the Animal Care and Use Committee of Shanghai University of Traditional Chinese Medicine and conformed to the Guide for the Care and Use of Laboratory Animals, published by US National Institute of Health (NIH publication No. 85-23, revised in 1996).

Before the treatment was initiated, blood pressure was measured by tail cuff in ten weeks old conscious SHRs to exclude congenital cardiac abnormalities. Eleven weeks old SHRs were randomly divided into four groups of 10 each: SHR control, SHR +40 mg/kg captopril, SHR + 30 mg/kg OMT, and SHR + 60 mg/kg OMT. Normotensive age-matched WKY rats were assigned to two groups of 10 each: WKY control and WKY + 30 mg/kg OMT. All rats were permitted free access to chow and drinking water.

The rats were orally administrated with OMT or captopril at above described doses once a day. And drinking water was administered in the same manner to the WKY control and SHR control. Treatment started when the rats were eleven weeks old and continued for 21 weeks. Body weight was measured weekly. Mean arterial blood pressure (MAP) was measured every three weeks.

Cardiac weight index calculation

Cages were inspected daily in all groups, 21 weeks after treatment, rat body weight (BW) was recorded after fasting for 12 h and then anesthetized with intra-peritoneal injection of urethane (1.0 g/kg). The blood sample was collected from carotid artery and centrifuged (4 [degrees]C, 2325 x g, 10 min) to recover serum which was stored immediately in a--70 [degrees]C freezer until being assayed. Then the heart was taken out, rinsed with cold saline solution, and the left ventricle was separated from the atria, aorta and adipose tissue. The left ventricle weight (LVW) and heart weight (HW) were measured, and then left ventricular weight index (LVW1, mg/g) and heart weight index (HW1, mg/g) were estimated by calculating the ratios of the LVW to the BW and the HW to the BW. The left ventricular tissue was divided into two parts. The upper part was immersed in formalin (10% formaldehyde). The lower part was separated into several sections and rapidly frozen in liquid nitrogen and then stored in a--70 [degrees]C freezer until being assayed.

Histological examination

The fixed part of ventricle in formalin was dehydrated and embedded in paraffin, then cut into 5[micro],m thick slices and heated overnight in a 60 [degrees]C incubator. The sections were stained with Sirius red in aqueous saturated picric acid for examination of perivascular and interstitial fibrosis in myocardium. Each sample slice was photographed (400x magnification) under the microscope (Olympus BX51, japan). All photos were analyzed with the image-Pro Plus 6.3 analyzing software (Media Cybernetics, Bethesda, MD, USA) by computer.

The percentage of collagen area in each field was calculated as the myocardial interstitial collagen volume fraction (ICVF). Perivascular collagen content was represented as the ratio of perivascular collagen area to vessel lumen area (PVCA).

Collagen types I and III accumulation in the interstitial and perivascular space of the left ventricle was assessed by polarized light microscopy and analyzed with Image-Pro Plus 6.3 analyzing software.

ELISA determination

Commercially available enzyme-linked immunosorbent assay (ELISA) kits (Shanghai Xitang Institute of Bioengineering, Shanghai, China) were used to determine serum level of Norepinephrine (NE).

Radioimmunoassay determination

Radioimmunoassay was used to detect angiotensin II (Ang II) of ventricular tissue. The homogenized tissue was centrifuged (4 [degrees]C, 1780 x g, 15 min.) and the supernatant was collected for measurement. Ang II was analyzed with Iodine [[125.sup.I] Ang II kit (purchased from Beijing North Institute of Biological Technology, Beijing, China). Protein concentrations of myocardial homogenates were assayed with the Coomassie Brilliant Blue Kit (Nanjing jiancheng Institute of Bioengineering, Nanjing, China). Tissue Ang 11 concentration was expressed as per milligram protein of ventricular tissue.

Real-time RT-PCR determination

The mRNA expressions of angiotensin converting enzyme (ACE), transforming growth factor-[beta]1 (TGF-[beta]1), collagen types I and Ill were determined by real time RT-PCR. Total RNA was extracted from the tissues by using the Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA yields and purity were assessed by spectrophotometric analysis (NanoDrop 2000, Themo Scientific, USA). Total RNA (1[micro]g/[micro]l) transcription was performed using an in vitro transcription kit according to the manufacturer's instruction (PrimeScript RT Master Mix Perfect Real Tim, TaKaRa). The real-time RT-PCR reactions (25 [micro]l) consisted of 12.5 [micro]l SYBR Green Mix (2x), 2.5[micro]l PCR forward primer (2[micro]M), 2.5[micro]l PCR reverse primer (2 [micro]M), 1[micro]l cDNA, 0.5 [micro]l ROX Reference Dye II and 6 [micro]l double-distilled water. A typical protocol included initial denaturation at 95 [degrees]C for 30 s, followed by 40 cycles with denaturation at 95 [degrees]C for 5 s, annealing at 60 [degrees]C for 34 s, and elongation at 72 [degrees]C for 20s. For each sample, PCR was performed in triplicate. The sequences of primer were as follows:

ACE mRNA sense: 5'-ATGAGGCTATI"GGAGATG ill IG -3',

ACE mRNA anti-sense: 5'-TCCTTGGTGATGCTTCCGT -3';

TGF-[beta]1 mRNA sense: 5'-IGGCGTTACCTIGGTAACC -3',

TGF-[beta]1 mRNA anti-sense: 5'-GGIGTILAGCCCTTTCCAG-3';

Collagen type I mRNA sense: 5'-CCTGCCGATGTCGCTATCC -3',

Collagen type I mRNA anti-sense: 5'-TTGCCITCGCCCCTGAG -3';

Collagen type III mRNA sense: 5'-GCCTCCCAGAACATTACATACC -3".

Collagen type III mRNA anti-sense: 5'- CTGTCTTGCTCCATTCACCAG -3';

GAPDH sense: 5'-TGGCATGGACTGTGGTCATG -3',

GAPDH anti-sense: 5'-TGGGTGTGAACCACGAGAAA -3'.

Real-time RT-PCR and data analyzed were carried out with realplex 7500 (Applied Biosystems, USA).

All values obtained with ACE, TGF-[beta]1, collagen types I and III primers were normalized to the values obtained with the GAPDH primers. The results were expressed as the relative integrated intensity.

Western blotting

Western blots were performed to determine bioactivities of MAP kinases (extracellular signal regulated kinase (ERK1/2), c-Jun N-terminal kinase (JNK/SAPK) and p38 mitogen-activated protein kinases (p38 MAPK) and phospho-specific protein kinase C (PKC). Fifty milligrams of heart samples were homogenized in ice-cold loading buffer (pH6.8). Proteins were separated on 10% SDS-polyacrylamide gel electrophoresis sample buffer. After blocking 12 h with 5% bovine serum albumin (BSA) in TBST (tris-buffered saline (pH 7.6) containing 0.1%Tween 20), membranes were probed overnight at 4 [degerees]C with antibodies recognizing the following anti-genes: phospho-P44/42MAPK (ERK 1/2) [Thr.sup.202]-[Tyr.sup.204] (1:2000), phospho-SAPK/JNK [Thr.sup.183]-[Tyr.sup.185] (1:1000), phospho-p38 MAPK ([Thr.sup.180]-[Tyr.sup.182] ) 1:1000), phosphor-specific protein kinase C [alpha]/[beta]II (PKC[alpha]/[beta]II) [Thr.sup.638/641] ( 1: 1000), phosphor-specific protein kinase C (PKC) (pan) [beta]II [Ser.sup.660] (1:1000), phosphor-specific protein kinase C [delta] (PKC[delta]) [Thr.sup.505] (1:1000). Antibodies were purchased from Cell Signaling Technology, Beverly, MA, USA except anti-GAPDH, which was bought from Abmart, Shanghai, China. Membranes were washed first time 15 min and next three times for each 5 min with TBST before addition of goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:5000 dilution, Santa Cruz). The antibody-antigen complexes were visualized by means of enhanced chemiluminescence. After scanning, results were quantified by NIH Image J program.

Statistical analysis

All values were expressed as mean [+ or -] standard deviation (SD). Statistical analysis was performed by one-way analysis of variance for multiple comparisons, followed by Dunnett's test to evaluate the difference between two groups using SPSS 13.0 software. Values of p <0.05 were considered as a statistically significant difference for all analyses.

Results

Effects on blood pressure and heart rate

As shown in Fig. 2, there was no significant differences of MAP between WKY control group and WKY + 30 mg/kg OMT group. In the control group of SHR, MAP was elevated when compared with that in WM' control group (p < 0.05). OMT significantly reduced MAP (p <0.01), and captopril reduced MAP as well (p <0.05, p < 0.01).

Effects on cardiac weight indexes

As shown in Fig. 3, there was no significant difference of LVVVI and HWI between WKY control group and WKY + 30 mg/kg OMT group. The LVVVI and HWI were significantly greater in SHR control group than in WKY control group (p < 0.01). Treatment with OMT and captopril significantly decreased LVVVI and HWI (p < 0.05, p < 0.01).

Effects on collagen accumulation

As shown in Figs. 4 and 5, under microscope, myocardial interstitial and perivascular collagen fibers appeared red or deep red, myocytes appeared pink or orange in these sections stained with Sirius red. In rat myocardium of WKY control group and WKY +30 mg/kg OMT group, little amount of collagen was found in the interstitial and perivascular space. In SHR control group, there was a large accumulation of collagen in the interstitial and per-vascular space of ventricle. Less collagen deposition was found in SHR plus OMT or captopril group than that in SHR control group (Table 1).

Table 1 Effects of oxymatrine (OMT) on interstitial collagen
volume fraction (CVF) and perivascular collagen area-to-luminal
area ratio (PVCA) of the left ventricle in spon- taneously
hypertensive rats (SHR) ([bar.x] [+ or -] SD, n = 8).

Group                           CVF (%)        PVCA (ratio)

WKY control          6.17 [+ or -] 3.77  0.81 [+ or -] 0.30

WKY + 30 mg/kg OMT   4.27 [+ or -] 2.26  0.61 [+ or -] 0.36

SHR control         23.70 [+ or -] 5.97  9.50 [+ or -] 4.45
                                     ##                  ##

SHR + 40 mg/kg       7.62 [+ or -] 5.92  0.88 [+ or -] 0.34
captopril                            **                  **

SHR + 30 mg/kg OMT   4.05 [+ or -] 2.28  0.62 [+ or -] 0.27
                                     **                  **

SHR + 60 mg/kg OMT   6.16 [+ or -] 3.97  0.82 [+ or -] 0.51
                                     **                  **

## Compared with WKY control group: p <0.01.

** Compared with SHR control group: p <0.01.


As shown in Figs. 6 and 7, under the polarized light microscope, type I collagen fibers appeared red or yellow, type III collagen fibers appeared green. In rat myocardium of WKY control and WKY + 30 mg/kg OMT groups, less amounts of types I and In collagen fibers was found. Collagen distributions of types I and III were significantly increased in SHRs compared with that in WKY rats. These were significantly decreased in OMT or captopril treated groups (Table 2).

Table 2 Effects of oxymatrine (OMT) on collagen types I,
III volume fraction, and the ratio of collagen type I/III
of the left ventricle in spontaneously hypertensive rats
(SHR) and Wistar-Kyoto rats (WKY). Semiquantitative
evaluation is shown ([bar.x] [+ or -] SD, n=8).

Group           Collagen 1 (%)   Collagen III  I/III collagen
                                          (%)           ratio

WKY control      0.19 [+ or -]  0.05 [+ or -]   4.18 [+ or -]
                          0.19           0.04            2.51

WKY + 30 mg/kg   0.28 [+ or -]  0.13 [+ or -]   2.53 [+ or -]
OMT                       0.25           0.11            1.71

SHR control      7.64 [+ or -]  0.46 [+ or -]     31.71 [+ or
                       1.88 ##         0.40 #       -]24.52 #

SHR + 40 mg/kg   0.19 [+ or -]  0.10 [+ or -]   3.49 [+ or -]
captopril              0.12 **           0.07          3.92 *

SHR + 30 mg/kg   0.17 [+ or -]  0.08 [+ or -]   3.82 [+ or -]
OMT                    0.19 **         0.06 *          5.46 *

SHR + 60 mg/kg   0.19 [+ or -]  0.13 [+ or -]   3.08 [+ or -]
OMT                    0.22 **           0.14          4.38 *

# Compared with WKY control group: p < 0.05.

## Compared with WKY control group: p < 0.01.

* Compared with SHR control group: p<0.05.

** Compared with SHR control group: p < 0.01.


The ratio of collagen types I/III in SHR control group was significantly higher than that in WKY control group (p < 0.05). OMT and captopril significantly decreased the ratio of collagen types I/III (Table 2).

Effect on serum norepinephrine concentration

As shown in Fig. 8, there was no significant difference of NE between WKY control group and WKY+ 30 mg/kg OMT group. Serum NE was significantly higher in SHR control group than that in WKY control group (p <0.05). Treatment with OMT at 60 mg/kg and captopril significantly decreased serum NE (p <0.05).

Effect on tissue Ang II concentration

As shown in Fig. 9, Ang II in WKY + OMT 30 mg/kg group was lower than that in WKY control group (p < 0.05). It was significantly higher in SHR control group than that in WKY control group (p < 0.05). OMT and captopril treatment significantly decreased myocardial tissue Ang II concentration (p <0.05).

Effects on ACE, TGE-131, collagen types I and III mRNA expression

As shown in Tables 3 and 4, there was no significant difference of ACE, TGF-p1 and collagen type I mRNA expressions between WKY control group and WKY + 30 mg/kg OMT group. The mRNA expressions of ACE, TGF-131 and collagen type I in SHRs were significantly higher than those in WKY rats (p < 0.05, p < 0.01). Treatment with OMT inhibited ACE, TGF-[beta]1 and collagen type 1 mRNA over expression (p <0.05, p <0.01). Captopril decreased ACE, TGF-131 and collagen type I mRNA expression as well.

Table 3
Effects of oxymatrine (OMT) on mRNA expression of transforming growth
factor beta 1 (TGF-[beta]1)and angiotensin converting enzyme (ACE) in
spontaneously hypertensive rats (SHR) and Wistar--Kyoto rats (WKY)
([bar.x] [+ or -] SD, n = 6).

Group                                  TCF-pl                 ACE

WKY control                0,61 [+ or -] 0.38       1,18 [+ or -]
                                                             0.63

WKY + 30mg/kg OMT          0.70 [+ or -] 0.26   1.18 [+ or -]0.26

SHR control               1.87 [+ or -] 130 *   479 [+ or -] 3.56
                                                                #

SHR+40 mg/kg captopril   0.87 [+ or -] 0.22 *  1.20 [+ or -] 0.19
                                                                *

SHR +30 mg/kg OMT        0.95 [+ or -] 0,22 *   0.75 [+ or -]0.41
                                                               **

SHR + 60 mg/kg OMT      0.47 [+ or -] 0.28 **   1.17 [+ or -]0.78
                                                                *

Note: Values are expressed as the relative integrated intensity,
and normalized to that of the GAPDH.

# Compared with WKY control group: p < 0.05.

* Compared with SHR control group: p < 0.05.

Table 4 Effects of oxymatrine (OMT) on mRNA expression of collagen
types I/III and the ratio of mRNA expression of collagen type I/Ill
in spontaneously hypertensive rats (SHR) and Wistar-Kyoto rats (WKY)
(-.X] [+ or -] SD, n = 6).

Croup                     Collagen 1   Collagen III              I/III

WKY control            1.17 [+ or -]  1.08 [+ or -]      1.16 [+ or -]
                                0.65           0.59               0.38

WKY +30 mg/kg OMT      1.43 [+ or -]  1.61 [+ or -]         0.89 [+ or
                                0.29           0.33             -]0.12

SHR control            5.32 [+ or -]  1.42 [+ or -]  4.35 [+ or -] 233
                             2.41 ##           0.49                 ##

SHR + 40 mg/kg         1.05 [+ or -]  0.87 [+ or -]      1.25 [+ or -]
captopril                    0.26 **           0.33            0.18 **

SHR+ 30 mg/kg OMT  1.55 [+ or -] 037  1.96 [+ or -]      1.24 [+ or -]
                                  **           1.47             0.73 *

SHR+ 60 mg/kg OMT      2.35 [+ or -]  2.00 [+ or -]      1.08 [+ or -]
                              2.30 *           1.68            0.17 **

Note: Values are expressed as the relative integrated intensity, and
normalized to that of the GAPDH.

# Compared with WKY control group: p < 0.05.

* Compared with WKY control group: p<0.05.

** Compared with SHR control group: p<0.05. Compared with SHR control
group: p <0.01.


As shown in Table 4, there was no significant difference of the ratio of collagen types 1/Ill mRNA expression between WKY control group and WKY+ 30 mg/kg OMT group. The ratio of collagen type I/III mRNA expression was significantly higher in SHR control group than that in WKY control group (p <0.01). OMT and captopril significantly decreased the ratio of collagen type I/111 mRNA expression (p < 0.05, p <0.01).

Effects on ERK 1/2,J NK, p38 MAPKs and PKC pathways

As shown in Figs. 10-15, there was no significant difference of the phosphorylation of Erkl/2 Th[r.su.262]-Ty[r.sup.204], JNK Th[r.sup.183]-Ty[r.sup.185] and p38 MAPK Th[r.sup.186]-Ty[r.sup.182] between WKY control group and WM' + 30 mg/kg OMT group. The phosphorylation of Erk1 /2 Th[r.sup.202]-Ty[r.sup.204] JNK Th[r.sup.183]-Ty[r.sup.185] and p38 MAPK Th[r.sup.186]-Ty[r.sup.182] were obviously raised in SHR control group when compared with that in WKY control group (p <0.01), and these alterations were attenuated by OMT treatment significantly (p <0.01).

In the case of PKC pathways, the modest phosphorylation of PKC[alpha]/[beta] II Th[r.sup.638/641], PKC pan [beta] II Se[r.sup.666] and PKC[sigma]Th[r.sup.565] occurred in SHR control group, OMT and captopril did not show obvious effects on them (data were not shown).

Discussion

SHRs have hypertension at an early age and have massive left ventricular hypertrophy with progression to heart failure, which mimics that of human with similar disease (Kacimi and Gerdes 2003). Hypertension is an independent cardiovascular risk factor for any cardiovascular disorder. Thus inhibition of hypertension early may postpone the process of ventricurlar remodeling and heart failure. In the present study, the baseline blood pressure is much higher in SHR than that in WKY. Chronic OMT treatment for 21 weeks at doses of 30 and 60 mg/kg/day was effective in inhibiting the development of hypertension in SHR.

SHRs are characterized by sympathetic hyperactivity (Head 1989). Upregulation of the sympathetic nervous system (SNS) is involved in numerous cardiovascular disease processes and is responsible for alterations in normal myocardial structure and function, including the alterations in contractile properties, and ventricular remodeling. There is evidence that chronic activation of the SNS is a key component of ventricular hypertrophy and the altered signaling pathways that accompany ventricular remodeling results from hypertension (Levick et al. 2010). In an experimental setting, an increased concentration of plasma NE was detected in SHRs (Leenen and Yuan, 1998). This is consistent with our results that serum NE was higher in SHRs and OMT arrested sympathetic nerves to release NE, indicating that the function of OMT in antagonizing myocardial hypertrophy and fibrosis correlates with its decreasing sympathetic hyperactivity.

The renin-angiotensin-aldosterone system (RAAS) has been implicated in the pathogenesis of hypertension and ventricular remodeling based on the generation of Ang II, a key regulator of cardiovascular homeostasis. Ang II, in addition to increasing ventricular load, participated in the development and progression of left ventricular hypertrophy (Varagic etal. 2008). ACE is a metallo-protease with two homologous domains, i.e., two binding sites as active centers containing a zinc atom each (Soubrier et al. 1988). Higher ACE has been recognized at the sites of cardiac injury suggesting a contributory role of the local Ang II synthesis (Sun et al. 2004). That is ACE converts the inactive decapeptide Angl into the biologically active octapeptide Ang ll by removing the dipeptide, His-Leu, from the C-terminal end of the Ang I molecule (Ito et al. 1997).The actions ofACE inhibitors can be explained by attenuation of Angllinduced-VR, which have become an integral component of the treatment of heart failure (Brower et al. 2007). The results of our study showed that OMT significantly attenuated the increased tissue Ang II concentration, mRNA expression of ACE in the ventricular myocardium, confirming a favorable effect of OMT on postpone the process to CHF.

Chronic hypertension induces overall cardiac enlargement, which is, in part, due to ventricular hypertrophy (Kolwicz et al. 2009). Ventricular hypertrophy is a common hallmark of the ventricular remodeling process and is an initial adaptive process to a variety of physiological and pathological conditions associated with increased cardiac work (Kacimi and Gerdes 2003.). The hypertrophic response initially normalizes wall stress and maintains ventricular function. However, hypertension-induced hypertrophy increases the risk for the development of heart failure, decompensated congestive heart failure occurs when the adaptive process fails (Shi et al. 2007). Lu et al. also reported that SHR had showed significant left ventricular hypertrophy at 12 weeks of age when compared with WKY rats (Lu et al. 2003). In our study, the degree of ventricular hypertrophy was displayed by the increase of LVW1, HWI in model rats. Treatment with OMT could obviously attenuate hypertension and ventricular hypertrophy.

Hypertension and other pressure-overload conditions result in pathological ventricular remodeling, which is characterized by nonmyocyte proliferation with increased deposition of collagen, culminating in increased fibrosis disproportionate to heart failure. Bing et al. suggested that the heart failure develops due to the changes of intrinsic properties of the myocarchum and due to connective tissue alterations (Bing et al. 1995). In this context, nonmyocyte proliferation may counteract apoptosis in the hypertensive heart, that is the interstitial collagen deposition could represent replacement fibrosis after cardiomyocyte loss (Kolwicz et al. 2009). Moreover, an increased collagen accumulation in the interstitial space of hypertrophied myocardium has been held responsible for abnormal ventricular wall stiffness and for impaired cardiac pumping capacity (Jalil et al. 1989).

The amount of collagen in the interstitial space of myocardium seems to be a major determinant of the development of cardiac dysfunction in hypertension (Joseph et al. 2002). In agreement with it, the profound perivascular collagen in the left ventricles of SHR suggested deteriorated heart function (Mitasikovii et al. 2008). Hypertension-induced medial thickening of intramyocardial coronary arterioles results in stenosis of the coronary arterioles and consequent myocardial ischemia and dysfunction (Park and Schiffrin 2001), and perivascular accumulation of collagen fibers may also induce a compression on the coronary arterioles, thus impair the vasodilator capacity of intramyocardial coronary arteries and therefore account for the decrease in coronary vasodilator reserve, which is commonly seen in the hypertensive heart (Strauer 1990). In our study, the degree of perivascular collagen was displayed by PVCA calculated via the area ratio of perivascular collagen to vessel lumen.

In the present study, parameters for ventricular remodeling were examined in SHR at an age of 31weeks old, in which an increased interstitial and perivascular collagen had already become obvious. Cardiac fibrosis plays a pivotal role in cardiac dysfunction, and antifibrotic therapy is another useful strategy. The data presented herein clearly demonstrated that OMT prevents the development of cardiac fibrosis in the interstitial and perivascular space in SHRs.

Either reactive or reparative hypertensive cardiac fibrosis is the result of both increased collagen type I and III synthesis by fibroblasts, and the result of unchanged or insufficient collagen degradation (Eghbali and Weber 1990). Increased cardiac collagen type I and type III have been described in the left ventricular of SHR when compared with WKY (Li et al. 2008). Our findings demonstrated that treatment with OMT resulted in the marked attenuation of collagen type I and III accumulation, and the mRNA expression of collagen type I indicating that OMT may improve cardiac fibrosis and thus prevent left VR.

SHRs develop not only prominent cardiac fibrosis but also enhanced expression of VR associated genes, such as TGF-[beta]1. TGF-[beta]1 could increase the production of extracellular matrices and promote the fibrosis of cardiovascular and renal tissues (Ruiz-Ortega et at. 2007) Some studies showed that TGF-[beta]1 induced an increased collagen type I and III synthesis in rats (Lijnen et al. 2000) and hypertensive patients (Scaglione et al. 2007). An association of TGF-[beta]1 over-expression with cardiac fibrosis has been reported in SHR (Shiota et at. 2003). In concordance with the literatures, we observed over-expressed TGF-[beta]1 mRNA in the left ventricular of SHR associated with an increased cardiac fibrosis, and these alterations significantly were suppressed by OMT. The results suggested that the inhibition of cardiac fibrosis by OMT might be at least partially mediated by the inhibition of TGF-[beta]1 expression.

MAPKs are ubiquitously expressed, and their specific functions in the heart have been a focus of intensive study (Bartha et at. 2009). Growing evidence suggests that modulation of the complex network of MAPKs cascades could be a rewarding approach to treatment of ventricular hypertrophy and HF (Luedde et al. 2006). Some models of the role of intracellular signaling pathways in the development of pathological ventricular hypertrophy showed that ERK1/2 likely contributes to the growth of cardio-cyte that causes ventricular hypertrophy (Heineke and Molkentin 2006; Qin et al. 2005). JNK activation leads to reduced gap junction formation and promoted pathological ventricular remodeling (Heineke and Molkentin 2006). Some data by others have shown that ERK1/2 and JNK phosphorylation and activities were increased during hypertension or hypertrophy (Takeishi et al. 2001; Takeishi et at. 2002). Upregulation of p38 MAPK is, at least in part, responsible for the induction of early response genes and cell growth (Touyz etal. 2001). Heineke et al. suggested that p38 MAPK activation promote cardiac fibrosis by influencing procollagen mRNA expression and may also by stimulating collagen synthesis and fibrogenesis (Heineke and Molkentin 2006). In concordance with the literatures, our data showed that the elevated phosphorylation activations of ERK1/2, _INK and p38 MAPK in the SHR were reduced by OMT, indicating that the inhibition of ventricular remodeling caused by OMT may be through attenuating MAP kinase signaling.

PKC is activated by NE through stimulation of Gq and Gs proteins, respectively (Nishizuka 1988). Several reports suggested that PKCcx, fi and 8 were up-regulated from the stage of ventricular hypertrophy extending to congestive HF (Koide et al. 2003; Bowling et at. 1999). However, studies using inhibitors with improved selectivity for PKC have yielded conflicting results regarding its physiological importance in the vasculature (Chrissobolis and Sobey 2002; McNair et al. 2004), and Bal et al. reported that the inhibition of PKC had no effect on constrictions of arteries in SHR (Bal et al. 2009). In our study, the phosphorylation of PKC[alpha]/[beta] II, PKC (pan) [beat] II and PKC 8 did not seem to involve in the process to CHF.

In conclusion, long-term administration of OMT could beneficially lower blood pressure, decrease cardic gravimetric parameters and cardiac fibrosis in the interstitial and perivascular space, reduce serum NA, debase myocardium Ang II, suppress ACE, TGF-[beta]1 and the collagen types 1 mRNA over-expression and then attenuate the onset of hypertension-induced VR. The study suggests that the effect of OMT on suppressing activation of signaling pathways of ERK1/2, INK and p38 MAPK should play an important role in restraining ventricular remodeling induced by spontaneous hypertension.

Conflict of interest

The authors have no conflicts of interest to declare.

Acknowledgements

The project was supported by the foundation of the Ministry of Science and Technology of the People's Republic of China (No. 2009ZX09103-398) and Post-doctor Science Fund of China (No 20100470725). We are grateful to all other staffs in the Department of Pharmacology, Shanghai University of Traditional Chinese Medicine for their assistances in the experiments.

Abbreviations: ACE, angiotensin converting enzyme; Ang II, angiotensin II; BSA, bovine serum albumin; BW, body weight; CHF, congestive heart failure; ELISA, enzyme-linked immunosorbent assay; ERK1/2, extracellular signal regulated kinase; HF, heart failure; HR, heart rate; HWI, heart weight index; HW, heart weight; ICVF, interstitial collagen volume fraction; JNK/SAPK, c-Jun N-terminal kinase; LVW, left ventricle weight; LVWI, left ventricular weight index; MAP, mean arterial blood; OMT. oxymatrine; p38, mitogen-activated protein kinase (p38 MAPK); PKC, protein kinase C; PVCA, perivascular collagen area to vessel lumen area; RAAS. renin-angiotensin-aldosterone system; SHR, spontaneous hypertension rat; SNS, sympathetic nervous system; TBST, Tris-buffered saline; TGF-[beta]1, transforming growth factor-[beta]1; VR, ventricular remodeling; WKY rats, Wistar-Kyoto rats.

* Corresponding author at: Department of Pharmacology, Shanghai University of Traditional Chinese Medicine, 1200 Cailun Road, Shanghai 201203, PR China.

Tel.: + 8621 51322200; fax: +8621 51322200.

E-mail address: cxchen6@126.com (C.X. Chen).

0944-7113/$--see front matter [c] 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2012.10.012

References

Bal, M.S., Paulis, L. Zicha, J., Kunes, J., 2009. Effect of protein kinase C and protein kinase A inhibitors on contraction of isolated femoral arteries of SHR and Wistar rats. Physiological Research 58.793-798 (PubMed: 19093737).

Bartha, E., Solti, I., Kereskai, L, Lantos, J., Plozer, E., Magyar, K., Szabados, E., KSlai, T., Hideg, K., Halmosi, R., Sumegi, B., Toth, K., 2009. PARP inhibition delays transition of hypertensive cardiopathy to heart failure in spontaneously hypertensive rats. Cardiovascular Research 83, 501-510 (PubMed: 19443425).

Bing, 0.H., Brooks, W.W., Robinson, K.G., Slawsky, M.T., Hayes, J.A., Litwin, S.E., Sen, S., Conrad, C.H., 1995. The spontaneously hypertensive rat as a model of the transition from compensated left ventricular hypertrophy to failure. Journal of Molecular and Cellular Cardiology 27,383-396 (PubMed:7760360).

Bowling, N., Walsh, R.A., Song, G., Estridge, T., Sandusky, G.E., Fouts, R.L., Mintze, K., Pickard, T., Roden, R., Bristow, M.R., Sabbah, H.N., Mizrahi, J.L, Gromo, G., King, G.L., Vlahos, C.J., 1999. Increased protein kinase C activity and expression of C[a.sup.2+]-sensitive isoforms in the failing human heart. Circulation 99, 384-391 (PubMed: 9918525).

Brower, G.L. Levick, S.P., Janicki, JS., 2007. Inhibition of matrix metalloproteinase activity by ACE inhibitors prevents left ventricular remodeling in a rat model of heart failure. American Journal of Physiology. Heart and Circulatory Physiology 292, H3057-H3064 (PMID: 17308006).

Cao, CA., Yang, Q.W., Lv, F.L., Cui, J., Fu, H.B., Wang, J.Z., 2007. Reduced cerebral ischemia-reperfusion injury in Toll-like receptor 4 deficient mice. Biochemical and Biophysical Research Communications 353,509-514 (PMID: 17188246).

Chrissobol is, S., Sobey, C.G., 2002. Inhibitory effects of protein kinase Con inwardly rectifying [K.sup.+] and ATP-sensitive [K.sup.+] channel-mediated responses of the basilar artery. Stroke 33, 1692-1697 (PubMed:12053013).

Eghbali, M., Weber, K.T., 1990. Collagen and the myocardium: fibrillar structure, biosynthesis and degradation in relation to hypertrophy and its regression. Molecular and Cellular Biochemistry 96, 1-14 (PubMed:2146489).

Joseph. J., Washington, A., Joseph, L, Koehler, L, Fink. LM., Hauer-Jensen, M., Kennedy, R.H., 2002. Hyperhomocysteinemia leads to adverse cardiac remodeling in hypertensive rats. American Journal of Physiology. Heart and Circulatory Physiology 283, H2567-H2574 (PMID: 12388235).

Juenger, J., Schellberg, D., Kraemer, S., Haunstetter, A., Zugck, C., Herzog, W., Haass, M., 2002. Health related quality of life in patients with congestive heart failure: comparison with other chronic diseases and relation to functional variables. Heart 87, 235-241 (PMID: 11847161).

Kacimi, R., Gerdes, A.M., 2003. Alterations in G protein and MAP kinase signaling pathways during cardiac remodeling in hypertension and heart failure. Hypertension 41,968-977 (PMID: 12642504).

Kannel, W.B., 2000. Incidence and epidemiology of heart failure. Heart Failure Reviews 5, 167-173 (PMID: 16228142).

Koide, Y., Tamura, K., Suzuki. A., Kitamura, K., Yokoyama, K., Hashimoto, T., Hirawa, N., Kihara, M., Ohno, S., Umemura, S., 2003. Differential induction of protein kinase C isoforms at the cardiac hypertrophy stage and congestive heart failure stage in Dahl salt-sensitive rats. Hypertension Research 26, 421-426 (PubMed:12887134).

Kolwicz, S.C., MacDon nel S.M., Renna, B.F., Reger, P.O., Seqqat, R., Rafiq, K., Kendrick, Z.V., Houser, S.R., Sabri, A., Li bonati. J.R., 2009. Left ventricular remodeling with exercise in hypertension. American Journal of Physiology. Heart and Circulatory Physiology 297, H1361-H13G8 (PMID: 19666835).

Leenen, F.H., Yuan, B., 1998. Dietary-sodium-induced cardiac remodeling in spontaneously hypertensive rat versus Wistar-Kyoto rat. Journal of Hypertension 16. 885-892 (PMID: 9663929).

Levick, S.P., Murray, D.B., Janicki, J.S., Brower, G.L., 2010. Sympathetic nervous system modulation of inflammation and remodeling in the hypertensive heart. Hypertension 55. 270-276 (PMID: 20048196).

Li, Z., Zhu, X.Y., Li, M., Bai, Y.L., Hu, J., 2008. Protective effect of ghrelin on left ventricular remodeling in spontaneously hypertensive rats is associated with the peroxisome proliferator-activatal receptor gamma-dependent pathway. Chinese Medical Journal 121. 2299-2304 (PubMed:19080336).

Lijnen, P.J., Petrov, W., Fagard, R.H., 2000. Induction of cardiac fibrosis by transforming growth factor-beta (1). Molecular Genetics and Metabolism 71, 418-435 (PubMed:11001836).

Head, R.J., 1989. Hypernoradrenergic innervation: its relationship to functional and hyperplastic changes in the vasculature of the spontaneously hypertensive rat. Blood Vessels 26, 1-20 (PMID: 2540863).

Heineke, J., Molkentin, J.D., 2006. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nature Reviews Molecular Cell Biology 7. 589-600 (PubMed: 16936699).

Hong-Li, S., Lei, L, Lei, S., Dan, Z., De-Li, D., Guo-Fen, Q., Yan, L. Wen-Feng, C., Bao-Feng, Y., 2008. Cardioprotective effects and underlying mechanisms of oxymatrine against ischemic myocardial injuries of rats. Phytotherapy Research 22, 985-989 (PMID: 18389484).

Ito, K., Zhu, Y.Z., Zhu, Y.C., Gohlke, P., Unger. T., 1997. Contribution of bradykinin to the cardioprotective action of angiotensin converting enzyme inhibition in hypertension and after myocardial infarction. Japanese Journal of Pharmacology 75, 311-318 (PM1D: 9469636).

Jalil, J.E., Doering, C.W., Janicki, J.S., Pick, R., Shroff, S.G., Weber. K.T., 1989. Fibrillar collagen and myocardial stiffness in the intact hypertrophied rat left ventricle. Circulation Research 64, 1041-1050 (PubMed:2524288).

Lu, L., Yao, T., Zhu, Y.Z., Huang, G.Y., Cao, Y.X., Zhu, Y.C., 2003. Chronic all-trans retinoic acid treatment prevents medial thickening of intramyocardial and intrarenal arteries in spontaneously hypertensive rats. American Journal of Physiology. Heart and Circulatory Physiology 285, H1370-H1377 (PubMed:12775563).

Luedde. M., Katus, I-1.A., Frey, N., 2006. Novel molecular targets in the treatment of cardiac hypertrophy. Recent Patents on Cardiovascular Drug Discovery 1. 1-20 (PubMed: 18221071).

McNair, L.L., Salamanca, D.A., Khalil. R.A., 2004. Endothelin-1 promotes [Ca.sup.2+] antagonist-insensitive coronary smooth muscle contraction via activation of epsilon-protein kinase C. Hypertension 43. 897-904 (PubMed: 4981072).

Mitasikova, M., Smidova, S., Macsaliova, A., Knezl. V., Dlugosova, K., Okruhlicova, L, Weismann, P., Tribulova, N., 2008. Aged male and female spontaneously hypertensive rats benefit from n-3 polyunsaturated fatty acids supplementation. Physiological Research 57, S39-S48 (PubMed:18373394).

Nishizuka, Y., 1988. The molecular heterogeneity of protein kinase C and its implications for cellular regulation. Nature 334. 661-665 (PubMed: 3045562).

Park, J.B., Schiffrin, E.L. 2001. Small artery remodeling is the most prevalent (earliest?) form of target organ damage in mild essential hypertension. Journal of Hypertension 19, 921-930 (PubMed:11393676).

Qin, F., Liang, M.C., Liang, C.S., 2005. Progressive left ventricular remodeling, myocyte apoptosis, and protein signaling cascades after myocardial infarction in rabbits. Biochimica et Biophysica Acta 1740, 499-513 (PubMed: 15949720).

Ruiz-Ortega. M., Rodriguez-Vita, J., Sanchez-Lopez, E., Carvajal, G., Egiclo, J., 2007. TGF-beta signaling in vascular fibrosis. Cardiovascular Research 74, 196-206 (PubMec1:17376414).

Scaglione. R., Argano, C., Di Chiara, T., Parrinello, G., Colomba, D., Avellone, G., Donatelli, M., Corrao, S., Licata, G., 2007. Effect of dual blockade of renin-angiotensin system on TGFbeta1 and left ventricular structure and function in hypertensive patients. Journal of Human Hypertension 21. 307-315 (PubMed:17301824).

Shi, Y.X., Chen, Y., Zhu, Y.Z., Huang, G.Y., Moore, P.K., Huang, S.H., Yao, T., Zhu, Y.C., 2007. Chronic sodium hydrosulficle treatment decreases medial thickening of intramyocardial coronary arterioles, interstitial fibrosis, and ROS production in spontaneously hypertensive rats. American Journal of Physiology. Heart and Circulatory Physiology 293,1-12093-H2100 (PubMed: 17630351).

Shiota, N., Rysa, J., Kovanen, P.T., Ruskoaho, H., Kokkonen, J.O., Lindstedt, ICA., 2003. A role for cardiac mast cells in the pathogenesis of hypertensive heart disease. Journal of Hypertension 21, 1935-1944 (PMID: 14508201).

Soubrier, F., Alhenc-Gelas, F., Hubert, C., Allegrini, J., John, M., Tregear, G., Corvol, P., 1988. Two putative active centers in human angiotensin I-converting enzyme revealed by molecular cloning. Proceedings of the National Academy of Sciences of the United States of America 85, 9386-9390 (PMID: 2849100).

Strauer, B.E., 1990. The significance of coronary reserve in clinical heart disease. Journal of the American College of Cardiology 15.775-783 (PubMed:2307786).

Sun. Y., Zhang, J., Lu, L, Bedigian. M.P., Robinson, A.D., Weber, K. T., 2004. Tissue angiotensin II in the regulation of inflamatory and fibrogenic components of repair in the rat heart. Journal of Laboratory and Clinical Medicine 143, 41-51 (PubMed: 14749684).

Takeishi, Y., Huang, Q., Abe, J., Glassman, M., Che, W., Lee, J.D., Kawakatsu, H., Lawrence, E.G., Holt, B.D., Berk, B.C., Walsh, R.A., 2001. SRC and multiple MAP kinase activation in cardiac hypertrophy and congestive heart failure under chronic pressure overload: comparison with acute mechanical stretch. Journal of Molecular and Cellular Cardiology 33, 1637-1648 (PubMed:11549343).

Takeishi, Y., Huang, Q., Abe, J., Che. W., Lee, J.D., Kawakatsu, H., Hoit, B.D., Berk, B.C., Walsh, R.A., 2002. Activation of mitogen-activated protein kinases and p90 ribosomal S6 kinase in failing human hearts with dilated cardiomyopathy. Cardiovascular Research 53, 131-137 (PubMed:11744021).

Touyz, R.M., He, G., El Mabrouk, M., Schiffrin, E.L. 2001. p38 Map kinase regulates vascular smooth muscle cell collagen synthesis by angiotensin II in SHR but not in WM'. Hypertension 37, 574-580 (PMID: 11230337).

Varagic, J., Frohlich, E.D., Susic, D., Alin, J., Matavelli, L, Lopez, B., DIez, J., 2008. AT1 receptor antagonism attenuates target organ effects of salt excess in SHRs without affecting pressure. American Journal of Physiology. Heart and Circulatory Physiology 294, H853-H858 (PMID: 18055516).

Xiao Yan Huang, Chang Xun Chen *

Department of Pharmacology, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, China
COPYRIGHT 2013 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Huang, Xiao Yan; Chen, Chang Xun
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9CHIN
Date:Feb 15, 2013
Words:6812
Previous Article:Effects of the herbal medicine composition "Saiko-ka-ryukotsu-borei-To" on the function of endothelial progenitor cells in hypertensive rats.
Next Article:Reversal of dexamethasone induced insulin resistance in 3T3L1 adipocytes by 3[beta]-taraxerol of Mangifera indica.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters