Printer Friendly

EVALUACION MOLECULAR DE LA RESISTENCIA DE VARIEDADES DE PAPA A Phytophthora infestans EN REPUBLICA DOMINICANA.

Molecular assessment of potato varieties resistance to Phytophthora infestans in the Dominican Republic

INTRODUCCION

La papa pertenece a las solanaceas, una gran familia de plantas con mas de 3000 especies que incluye diversos cultivos de importancia economica; el cultivo ocupa el tercer lugar de importancia en la alimentacion humana a nivel mundial (Visser, 2009; Nelson et al., 2010).

En Republica Dominicana, la papa (Solanum tuberosum L.) tiene gran impacto en las economias rurales (mayormente en el municipio Constanza y la provincia San Jose de Ocoa), y constituye un alimento que contribuye a mejorar los niveles nutricionales de la poblacion, aporta proteinas de alta calidad biologica, buen balance y proporcion de aminoacidos esenciales y una adecuada relacion entre calorias de origen proteico a calorias totales (Rodriguez y Santos, 2002).

Para el ano 2017, la produccion nacional alcanzo 185.542 Mg y se importaron 29.106 Mg de este tuberculo principalmente en forma de semillas, papas frescas, cocidas, preparadas y congeladas. Dichas importaciones se explican por la poca disponibilidad de genotipos comerciales en los campos de siembra, pues en el pais apenas se cultivan tres variedades de papa (Maranca, Granola y Atlantica) debido en parte a la baja adaptabilidad del cultivo y a las enfermedades. Los costos de produccion de la papa corresponden a gastos en plaguicidas en un 26 %, lo que ocasiona danos por contaminacion al ambiente y toxicidad a los seres humanos (MAPRE, 2018).

Las especies del genero Solanum estan ampliamente distribuidas en America. Alrededor de 190 especies silvestres de tuberculos se pueden cruzar directamente con la papa comun conformando un recurso util para la creacion de nuevos cultivares comestibles ya que poseen una amplia gama de resistencia a diversos patogenos (Visser et al., 2009).

Las plagas y enfermedades son los principales problemas para el cultivo de papa en todo el mundo, sobre todo en las parcelas de los agricultores de escasos recursos, en los paises menos desarrollados, donde la certificacion de cultivos y la proteccion quimica generalmente no son accesibles, asi como tambien en la agricultura organica en los paises industrializados. Se estima que las plagas y enfermedades del cultivo de papa causan 30 % de perdidas antes de la cosecha y 20 % en postcosecha en los paises en desarrollo, en comparacion con 5 y 10 % en paises desarrollados (Gabriel et al., 2016).

La biologia molecular ofrece nuevas herramientas para estudiar, manipular o modificar procesos metabolicos, incluyendo la respuesta tales como la defensa de las plantas de papa frente a patogenos e identificacion de estos (Bonierbale et al., 2004; Alvarez et al., 2017). La mayoria de los rasgos importantes en los cultivos tales como produccion, calidad y resistencia a enfermedades son controlados por genes que pueden asociarse a marcadores moleculares (Mosquera et al., 2008; Ballesteros et al., 2010). En los ultimos anos, gracias al desarrollo de las tecnicas moleculares se ha ampliado el conocimiento de la resistencia genetica en papa (Gebhardt et al., 2004). Con la informacion aportada a partir de tales estudios se han podido generar mapas funcionales que contienen las regiones cromosomicas para estos loci (Mosquera et al., 2008).

El cultivo de la papa es afectado por varios patogenos, incluyendo virus, bacterias, nematodos, hongos, destacando el oomiceto Phytophthora infestans, agente causal del tizon tardio, la enfermedad mas severa que se ha registrado en el mundo. El valor de las perdidas de la produccion global anual y los costos de proteccion del cultivo se estiman en 5 billones de dolares (Mosquera et al., 2008), permaneciendo como una amenaza constante a la seguridad alimentaria de los paises (Haverkort y Verhagen, 2008; Fisher et al., 2012).

Para el control del tizon tardio los agricultores utilizan agroquimicos aun desconociendo su modo de accion. La constante emergencia de patovares resistentes posiblemente resulta de la alta tasa de mutaciones de este patogeno (Randall et al., 2014). En el mejoramiento para resistencia se ha investigado la eficacia de la acumulacion de genes R en cultivares deseables (Tan et al., 2010). Sin embargo, los genes R a ser acumulados deben ser seleccionados cuidadosamente basados en el conocimiento de las variaciones en las poblaciones del patogeno (Vleeshouwers et al., 2011). Se han identificado varios genes R efectivos contra patovares de P. infestans (Rodewald y Trognitz, 2013). Con la identificacion de genes de virulencia codificando por efectores RXLR, los mejoradores han descubierto la manera en que el patogeno evade la deteccion (Vleeshouwers et al., 2011), informacion critica para el desarrollo de estrategias de mejoramiento y durabilidad de los genes R. La variabilidad genetica de las poblaciones de P. infestans hace que este patogeno sea de dificil control, favorecido por la creciente globalizacion del comercio y los cambios climaticos (Bartfort, 2013). Parece poco probable que la resistencia genetica por si sola pueda controlar la enfermedad causada por P. infestans, por tanto, simultaneamente se debe recurrir al diseno racional de fungicidas con blancos objetivos identificados mediante un conocimiento profundo de la biologia del patogeno. Otras medidas incluyen el control cultural (densidad que favorezca la aireacion, manejo de semilla certificada y riego controlado).

Los centros de investigacion y de mejoramiento de cultivos han introducido en sus rutinas la seleccion asistida por marcadores (Mosquera et al., 2008). La seleccion asistida por marcadores MAS (del ingles marker-assisted selection) ofrece numerosas ventajas, con un enfoque que permite hacer mucho mas eficiente las estrategias de seleccion en los programas de mejora de los cultivos. Los marcadores moleculares se han convertido en poderosas herramientas para hacer posible la determinacion de las caracteristicas geneticas de las plantas y seleccionar por el genotipo, en lugar del fenotipo (Arens et al., 2010; Foolad y Panthee, 2012).

Se han utilizado marcadores SCAR (del ingles, sequence characterized amplified region) o regiones amplificadas caracterizadas y secuenciadas, para evaluar asociaciones con la resistencia al patogeno en papas diploides y tetraploides. Ballesteros et al. (2010) evaluaron el grupo S. phureja que tiene notables caracteristicas culinarias y nutricionales, e igualmente ha sido identificado como una fuente de resistencia a la gota o tizon tardio, lo cual situa a este grupo en una posicion de interes como recurso genetico con fines de mejoramiento. Ballesteros et al. (2010) caracterizaron genotipicamente 88 accesiones de S. phureja con marcadores moleculares tipo SCAR, el gen R1 de resistencia a P. infestans, el gen candidato StAOS2 y un marcador tipo CAPS ligado a un loci para resistencia a P. infestans en Solanum tuberosum.

Por su parte, Juyo et al. (2011) evaluaron el polimorfismo de dichos materiales y si los alelos polimorficos permitian diferenciar genotipos resistentes de susceptibles, y compararon el tamano de los fragmentos obtenidos con los esperados asociados con resistencia de acuerdo a informes previos. El analisis se realizo considerando los fragmentos CosA210 y 250, R11400 y 1800, BA47I2500, GP179570 y Prp1300, 600 y 900. Este estudio mostro que hay repuesta diferencial a los marcadores entre las subsp. tuberosum y subsp. andigena.

Otro estudio molecular fue realizado por investigadores del laboratorio de Biologia Molecular y Bioinformatica de la Fundacion PROINPA de Bolivia (Gabriel et al., 2016), asociando marcadores moleculares con la resistencia a enfermedades, caracteres morfologicos y agronomicos en familias diploides de papa. Caracterizaron quince familias de papa (824 genotipos) provenientes de cruzas inter- especificas entre especies de Solanum stenotomum, S. goniocalyx y S. phureja, con el objetivo de asociar seis marcadores moleculares (GP94, HC, Nl25, Gro 1-4, RYSC3 y CIP60) con genes mayores de resistencia a tizon tardio (Phytophthora infestans), verruga (Synchytrium endobioticum), nematodo-quiste (Globodera pallida y G. rostochiensis) y los virus PVY y PVX (Gabriel et al., 2016).

La presente investigacion tuvo como objetivo detectar asociaciones de resistencia a P. infestans en accesiones de S. tuberosum cultivadas en Republica Dominicana mediante la deteccion de polimorfismos utilizando marcadores moleculares SCAR.

MATERIALES Y METODOS

La investigacion se desarrollo en los laboratorios de Biologia Molecular del Centro de Biotecnologia Vegetal (CEBIVE) ubicado en Santo Domingo, Republica Dominicana, adscrito al Instituto de Innovacion en Biotecnologia e Industria (IIBI).

Se tomaron seis muestras de tuberculos de papa en 15 fincas de las dos localidades donde se cultiva mayormente en el pais: 12 del municipio Constanza (provincia La Vega) y tres de la provincia San Jose de Ocoa (Cuadro 1). Tambien se colectaron siete materiales diferentes en tiendas comerciales (paquetes de supermercados), los cuales, por sus caracteristicas fenotipicas, no se cultivan en el pais, como la papa 'morada'y 'Petite Gourmet' (Cuadro 1). De este muestreo tambien fueron establecidas seis plantulas por materiales en la coleccion in vitro.

Produccion in vitro de explantes de papa para la obtencion de ADN. Los tuberculos colectados fueron colocados de manera que se produjera el proceso de brotacion, con luz artificial baja (5-10 [micron]mol x [m.sup.-2] x [s.sup.-1]) para inducir germinacion (romper la dormancia). Luego se colocaron los tuberculos sin cortar en tarros de 7,6 L que contenian sustrato Sunshine mix #4 (mezcla de musgo, perlita, vermiculita y agentes humectantes) en un cobertizo con malla para sombra al 70 %.

Cuando los tuberculos generaron una planta completa fueron tomados los ultimos tres entrenudos mas el brote apical para la extraccion de los meristemos. Los meristemos fueron extraidos en camara de flujo laminar, con un proceso de desinfeccion en el que se lavaron con agua corriente y jabon liquido neutro (pH 7), luego se sumergieron en alcohol 95 % por 30 s y posteriormente en una solucion de hipoclorito de sodio (3,5 % i.a.) por 15 min, seguido de tres lavados con agua esterilizada.

Se extrajeron brotes meristematicos con al menos dos hojas, con apoyo de una lupa estereoscopica; los mismos se colocaron en tubos de ensayo con medio de cultivo Murashige y Skoog (MS) (1962) suplementado con acido giberelico 0,001 mg x [L.sup.-1] y se incubaron en luz artificial (16 h luz y 8 h de oscuridad).

Una vez regeneradas las vitro plantas, se subcultivaron en medio de cultivo MS suplementado con mio-inositol 100 mg x [L.sup.-1], acido nicotinico 0,5 mg x [L.sup.-1], piridoxina-HCL 0,5 mg x [L.sup.-1], tiamina-HCL 0,1 mg x [L.sup.-1], glicina 2 mg x [L.sup.-1], sin reguladores de crecimiento. Los explantes diferenciados se cortaron en trozos de 1 cm que contenian una hoja y su yema. Luego se colocaron inclinados en frascos de 200 mL con MS suplementado con kinetina 0,01 mg x [L.sup.-1] y acido giberelico 0,1 mg x [L.sup.-1]. Al generar una planta completa se subcultivaron cada 12 dias para aumentar la cantidad de plantas. De las plantas obtenidas a partir de los tuberculos brotados (Cuadro 1), se tomaron muestras de hojas (de 20-25 dias de edad, aproximadamente) para realizar la extraccion de ADN. Del total de muestras seleccionadas el 54 % correspondio a la variedad Granola (que es la mas cultivada actualmente en el pais, por su valor comercial).

Adicionalmente se utilizaron dos muestras de ADN identificadas como LPC290 y CPC336 (Cuadro 1), las cuales fueron donadas por el Centro Internacional de la Papa (CIP, Lima, Peru), para el analisis. CPC336 ya ha sido caracterizada por el CIP y mostro resistencia, por lo tanto, la utilizamos como control positivo; mientras que LPC290 presenta susceptibilidad y proviene de un material genetico aun en desarrollo (lineas F6), con segregacion para algunos marcadores aqui utilizados (L. Portal, Centro Internacional de la Papa, CIP. Comunicacion personal).

Extraccion de ADN. Se utilizo la metodologia propuesta por Dellaporta et al. (1983) modificada por CIAT (1995). Se colocaron 0,2 g del tejido homogeneizado con nitrogeno liquido en un tubo de microcentrifuga de 2 mL y se agregaron 940 [micron]L del buffer de extraccion precalentado (100 mM de Tris HCL pH 8,0, 50 mM de EDTA pH 8,0, 500 mM de NaCl, SDS 1,25 %. Se adiciono bisulfito de sodio 0,38 g100 mg x [L.sup.-1] y se incubo a 65 [grados]C por 45 min (con agitacion cada 5 min); luego se le agregaron 400 [micron]L de acetato de potasio 5 M y se colocaron en hielo durante 30 min. Los microtubos se centrifugaron a 5900 g y 4 [grados]C por 10 min; se transfirio el sobrenadante a un tubo nuevo y se agregaron 400 [micron]L de acetato de potasio 5 M. La mezcla se centrifugo por 4 min a 4 [grados]C y se dividio el sobrenadante en dos microtubos de 1,5 mL. Se agrego igual volumen de isopropanol a cada muestra y 1/10 X de acetato de sodio 3M pH 5,2. Se incubo durante 40 min a -20 [grados]C. Luego se centrifugaron los microtubos a 15.616 g por 7 min a 4 [grados]C. El precipitado se lavo con 400 [micron]L de EtOH 70 % por 3 min. El ADN se seco en un desecador al vacio durante 45 [grados]C por 15 min. Finalmente se anadieron 99 [micron]L de tampon TE y 1 uL de RNAsaA (10 mg x [mL.sup.-1]) y se resuspendio toda la noche a 4 [grados]C. Los microtubos se incubaron a 37 [grados]C por 30 min. Se corrio un gel de agarosa al 0,8 % para verificar la calidad del ADN tinendo con una solucion 1X de bromuro de etidio 10 mg x [mL.sup.-1]. El ADN se cuantifico en un Nanodrop (Shimatzu BioSpec Nano) (Cuadro 1). Luego se diluyo a una mezcla de trabaj o de 100 ng x [micron][L.sup.-1].

Amplificacion por PCR. La reaccion de amplificacion de PCR consistio en 2 [micron]L de ADN diluido a 25 ngqL-1; 1X de buffer PCR (200 mM Tris HCl pH 8,4 y 500 mM de KCl); 0,3 [micron]M de cada cebador (Applied Biosystem), 0,2 [micron]M de cada dNTP, 3 mM de Mg[Cl.sub.2], 0,5 U de Taq ADN polimerasa (Invitrogen 5U x [micron][L.sup.-1]) y agua libre de nucleasas para completar el volumen final de 10 [micron]L. Las reacciones se sirvieron en placas de 96 pozos, selladas con tiras de polipropileno, y se amplificaron utilizando un termociclador Applied Biosystem modelo Veriti fast. El programa de PCR fue el siguiente: temperatura de desnaturalizacion 94 [grados]C por 5 min, seguido por 35 ciclos de 94 [grados]C por 45 s, 45 s a la temperatura de hibridacion de cada marcador (Cuadro 2), 45 s a 72 [grados]C y un ciclo de extension de 7 min a 72 [grados]C. Las amplificaciones se repitieron cuatro veces para confirmar los resultados.

Los productos de amplificacion por PCR se colocaron en geles de agarosa al 2 %, adicionando 1 [micron]L de buffer carga (azul de bromofenol, xilencianol, naranja G, sucrosa, TBE 10X y H2O bidestilada libre de nucleasas), se corrieron en una camara de electroforesis horizontal (Mini Fotodyne), con buffer TBE 1X (0,89 M de Tris-base, 0,89 M de acido borico y 0,5 M de EDTA, pH 8,0) a 200 voltios durante 2 h aproximadamente. Los geles se tineron con una solucion 1X de bromuro de etidio 10 mg x [mL.sup.-1]. Las bandas se visualizaron bajo luz UV y fueron registradas digitalmente con un procesador Samsung Galaxy A6, modelo SM-T280. Con los datos de amplificacion obtenidos para cada marcador se hicieron graficos, identificando la presencia de bandas en cada muestra en particular, y se compararon con un marcador alelico de 100 pb).

RESULTADOS Y DISCUSION

En la Figura 1 se muestran los resultados obtenidos en las amplificaciones del ADN genomico de las 22 muestras seleccionadas con cada uno de los marcadores moleculares SCAR utilizados para estudiar la presencia o ausencia de resistencia en los materiales de papa al tizon tardio de la papa (Phytophthora infestans).

Marcador PrP1. Se constato que las 22 muestras, mas el LPC290 y el CPC336, presentaron un fragmento monomorfico entre los 200-300 pb; posiblemente correspondiente al fragmento Pr[P1.sub.250] asociado con la resistencia (Figura 1A). Las muestras (2, 16 y 20) tuvieron un fragmento ubicado aproximadamente a los Pr[P1.sub.210] mientras que a los Pr[P1.sub.580] se presento un fragmento para las muestras 5-8, 12-15, 17, 18, 21, LPC290 y el CPC336. Para este marcador molecular se obtuvieron un fragmento monomorfico y dos polimorficos, el primero (Pr[P1.sub.250]) asociado con la resistencia a P. infestans. Juyo et al. (2011) obtuvieron un amplicon cercano a Pr[P1.sub.300]; por su parte Ballesteros et al. (2010) encontraron el fragmento de 250 pb en el 84% de las muestras estudiadas. El fragmento Prp1600 senalado por Juyo et al. (2011) es similar a Pr[P1.sub.580]; tambien Ballesteros et al. (2010) encontraron un alelo de 550 pb. Juyo et al. (2011) obtuvieron otro amplicon a Prp1900. El fragmento [P1.sub.210] se observo en Maranca, Vitelotte y Green Giant Fresh, pero no en Granola, mientras que PrP1580 estuvo muy asociado a esta ultima variedad. En este caso el marcador estuvo presente en todas las variedades estudiadas y en el CPC336 usado como control positivo de la resistencia.

Marcador CosA: Se observo la amplificacion de dos fragmentos, el primero, de aproximadamente 250 pb, presento polimorfismo en las muestras (2-4, 6-8, 10, 11 y 12-22) y fue el fragmento asociado con la resistencia (Figura 1B). Adicionalmente la muestra 8 y el CPC336 presentaron una banda de 210 pb aproximadamente, tambien polimorfica para las muestras estudiadas. Este fragmento asociado con la resistencia a P. infestans, estuvo presente solo en esa muestra perteneciente a la variedad Granola. En otras investigaciones con este marcador (Juyo et al., 2011) se obtuvo la amplificacion de dos fragmentos caracteristicos, el primero de 250 pb, el cual fue monomorfico y el segundo de 210 pb, polimorfico, entre los materiales estudiados. Ballesteros et al. (2010) encontraron un fragmento monomorfico de 280 pb para las accesiones que evaluaron y no observaron el fragmento de 210 pb asociado con la resistencia.

Marcador RGA2: Presento dos fragmentos monomorficos para todos los cultivares, CPC336 y LPC290, correspondientes a RGA[2.sub.500] y RGA[2.sub.635], este ultimo asociado con la resistencia (Beketova et al., 2006) (Figura 1C). Adicionalmente se observo un alelo de 1200 pb (RGA[2.sub.1200]) en algunos cultivares, que se considera polimorfico para este estudio, no asociado con ninguna variedad en particular.

Marcador R1: Se obtuvieron cinco fragmentos de pesos moleculares correspondientes a 350, 370, 510, 690 y 1400 pb (Figura 1D). El ultimo fragmento, [R1.sub.1400], esta asociado con la resistencia y se presento solo en el CPC336 control positivo proporcionado por el CIP-Peru. En el trabajo de Juyo et al. (2011) se obtuvieron cinco fragmentos de diferente peso molecular, identificados como [R1.sub.250], [R1.sub.500], [R1.sub.800], [R1.sub.1000] y [R1.sub.1800] junt[grados] con el fragmento de 1400 pb, los cuales fueron polimorficos para los individuos estudiados. Ballesteros et al. (2010) encontraron este fragmento solo en un 19 % de las accesiones estudiadas. El marcador R1 amplifica un fragmento caracteristico del gen R1 de resistencia.

Marcador GP179: El fragmento [GP179.sub.570], asociado con la resistencia a tizon tardio (Gebhardt et al., 2004) se presento en todos los materiales evaluados como unico fragmento (Figura 1E). Por su parte, Juyo et al. (2011), ademas de fragmentos de 570 pb, reporto en su estudio fragmentos de 100 y 1000 pb.

Marcador BA47f2: No se obtuvo amplificacion para este. En otros estudios para este marcador el fragmento asociado con resistencia a P. infestans, corresponde a 650 pb (Gebhardt et al., 2004) o 500 pb (Juyo et al., 2011). Sin embargo, hay que resaltar que en este ultimo estudio se detecto una ausencia caracteristica del fragmento en algunos de los individuos denominados como resistentes o altamente resistentes al tizon tardio, tal como ocurrio en nuestro trabajo, lo cual sugiere que dichos materiales geneticos no contienen esta secuencia en sus cromosomas.

Los resultados obtenidos con las amplificaciones del ADN genomico de las 22 muestras con cada uno de los marcadores presentaron fragmentos polimorficos para el total de los cultivares (Figura 1). Esos datos correspondieron a alelos relacionados a la resistencia a P. infestans, con la excepcion del marcador GP179 con un fragmento monomorfico de 570 pb. Los resultados para este marcador guardan algunas similitudes con los encontrados por Ballesteros et al. (2010). Juyo et al. (2011) afirma que los marcadores moleculares CosA, BA47f2, GP179 y PrP1 se encuentran frecuentemente asociados al gen de resistencia R1.

En el caso del marcador PrP1, los alelos resultantes guardaron cierta relacion con las variedades estudiadas. Por otra parte, el marcador R1, fragmento caracteristico del gen R1 de resistencia, solo estuvo presente en el control positivo CPC336 para resistencia (procedente del CIP, Peru). Es de hacer notar que el alelo asociado con la resistencia, perteneciente al marcador CosA, solo se encontro en la muestra de la variedad Granola y en CIP336.

En sintesis, en el presente estudio se presentaron fragmentos polimorficos para el total de los cultivares de papa estudiados dependiendo especificamente del marcador molecular SCAR seleccionado para evaluar la presencia o ausencia de genes de resistencia al tizon tardio (P. infestans), con la excepcion del marcador GP179 que presento un fragmento monomorfico de 570 pb y el marcador BA47f2 que no amplifico.

CONCLUSION

Se identificaron varios alelos relacionados con la resistencia a P. infestans en materiales de papa conservados in vitro en el Centro de Biotecnologia Vegetal (CEBIVE)-IIBI. Una vez ratificados estos resultados a traves de pruebas biologicas in vivo de inoculacion con el patogeno, se espera que estos cultivares puedan ser usados en programas de mejoramiento genetico de la papa en el pais.

AGRADECIMIENTO

Al Fondo Nacional de Innovacion y Desarrollo Cientifico y Tecnologico del Ministerio de Educacion Superior, Ciencia y Tecnologia (MESCyT) de la Republica Dominicana por el financiamiento a este trabajo. A los productores de papa del municipio de Constanza, la provincia San Jose de Ocoa, al Ing. Jose Cuevas por su colaboracion durante la etapa de muestreo y al Ing. Persio Rodriguez por sus informaciones oportunas.

LITERATURA CITADA

(1.) Alvarez-Yepes, D., P. Gutierrez-Sanchez y M. Marin-Montoya. 2017. Secuenciacion del genoma del potato yellow vein virus (pyvv) y desarrollo de una prueba molecular para su deteccion. Bioagro 29(1): 3-14.

(2.) Arens, P., C. Mansilla, D. Deinum, L. Cavellini, A. Moretti, S. Rolland et al. 2010. Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing. Theor. Appl. Genet. 120: 655-664.

(3.) Ballesteros, D., G. Gomez, M. Delgado, M. Alvarez, D. Juyo, D. Cuellar y T. Mosquera. 2010. Posible presencia de un gen R1 en germoplasma de Solanum tuberosum Grupo Phureja. Agron. Col. 28: 137-146.

(4.) Bartfort, E. 2013. Crop pests advancing with global warming. Nature. doi:10.1038/nature. 2013.13644.

(5.) Beketova, M., Drobyazina P. y E. Khavkin. 2006. The R1 gene for late blight resistance in early and late maturing potato cultivars. Russian Journal of Plant Physiology 53: 384-389.

(6.) Bonierbale, M., W. Amoros, J. Espinoza, E. Mihovilovich, W. Roca y R. Gomez. 2004. Recursos geneticos de la papa: don del pasado, legado para el futuro. Suplemento Revista Latinoamericana de la Papa. pp. 3-14.

(7.) CIAT. 1995. Protocolos para marcadores moleculares. Unidad de Biotecnologia, Publicacion N[grados] 258. Centro Internacional de Agricultura Tropical. Cali, Colombia. 82 p.

(8.) Dellaporta, S., J. Wood y J. Hick. 1983. A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1: 19-21.

(9.) Diaz, M., D. Fajardo, J. Moreno, C. Garcia y V. Nunez. 2003. Identificacion de genes R1 y R2 que confieren resistencia a Phytophthora infestans en genotipos colombianos de papa. Rev. Col. Biotecnol. 5: 40-50.

(10.) Fisher, M., D. Henk, C. Briggs, J. Brownstein, L. Madoff y S. McCraw. 2012. Emerging fungal threats to animal, plant and ecosystem health. Nature 484: 186-194.

(11.) Foolad, M. y D. Panthee. 2012. Marker-assissted selection in tomato breeding. Crit. Rev. Plant Sci. 31: 93-123

(12.) Gabriel, J., S. Veramendi, L. Pinto, Pariente, L. y A. Angulo. 2016. Asociaciones de marcadores moleculares con la resistencia a enfermedades, caracteres morfologicos y agronomicos en familias diploides de papa (Solanum tuberosum L.). Rev. Col. Biotecnol. 18: 17-32.

(13.) Gebhardt, C., A. Ballvora, B. Walkemeier, Oberhagemann, P. y K. Schuler. 2004. Assessing genetic potential in germplasm collections of crop plants by marker-trait association: a case study for potatoes with quantitative variation of resistance late blight and maturity type. Mol. Breed. 13: 93-102.

(14.) Jiang, R., J. Li, Z. Tian, J. Du, M. Armstrong, K. Baker et al. 2018. Potato late blight field resistance from QTL dPI09cis conferred by the NB NB-LRR gene R8. J. Exp. Bot. 69: 1545-1555.

(15.) Haverkort, A. y A. Verhagen. 2008. Climate change and its repercussions for the potato supply chain. Potato Research 51: 223.

(16.) Juyo, D., H. Genera y T. Mosquera. 2011. Evaluacion de marcadores moleculares asociados con resistencia a gota (Phytophthora infestans L.) en papas diploides y tetraploides. Rev. Col. Biotecnol. 13: 51-62.

(17.) MAPRE. (Ministerio Administrativo de la Presidencia) 2018. https://mapre.gob.do/ ministerios-republica-dominicana/agricultura/ (consulta del 09/08/2018).

(18.) Mosquera, T., C. Fernandez, L. Martinez, Acuna, A. y D. Cuellar. 2008. Genetica de la resistencia de la papa (Solanum tuberosum) a patogenos. Agronomia Colombiana 26: 7-15.

(19.) Murashige T. y F. Skoog. 1962. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiologia Plantarum 15: 473-494.

(20.) Nelson, G., M. Rosegrant, A. Palazzo, I. Gray, C. Ingersoll, R. Robertson et al. 2010. Food security, farming, and climate change to 2050: Scenarios, results, policy options. IFPRI Research Monograph. doi: 10.2499/9780896291867.

(21.) Randall, E., V. Young, H. Sierotzki, G. Scalliet, R. Birch, E. Cooke et al. 2014. Sequence diversity in the large subunit of RNA polymerase I contributes to Mefenoxam insensitivity in Phytophthora infestans. Molecular Plant Pathology 15: 664-676.

(22.) Rodewald J. y B. Trognitz. 2013. Solanum resistance genes against Phytophthora infestans and their corresponding avirulence genes. Molecular Plant Pathology 14: 740-757.

(23.) Rodriguez, R. y M. Santos. 2002. Experiencias en la multiplicacion de semilla de papa a partir de vitro plantulas. Instituto Dominicano de Investigaciones Agropecuarias y Forestales (IDIAF). Boletin Tecnico del Programa Nacional de Raices y Tuberculos (PR&T) y Programa Regional Cooperativo de Papa (Precodepa). 6 p.

(24.) Tan, M., R. Hutten, R. Visser y H. van Eck. 2010. The effect of pyramiding Phytophthora infestans resistance genes R pi.mcdi and R Pi_ber in potato. Theor. Appl. Gen. 121: 117-125.

(25.) Visser, R., C. Bachem, J. de Boer, G. Bryan, S. Chakrabarti, R. Feingold et al. 2009. Sequencing the potato genome: Outline and first results to come from the elucidation of the sequence of the world's third most important food crop. Amer. J. Potato Res. 86: 417-429.

(26.) Vleeshouwers, V., S. Raffaele, J. Vossen, N. Champouret, R. Oliva, M. Segretin et al. 2011. Understanding and exploiting late blight resistance in the age of effectors. Ann. Rev. Phytopathology 49: 507-531.

Atharva V. Rosa [1], Iris Perez-Almeida [2], Julio Mejia [1], Guarina Delmonte [1] e Ineko Hodai [1]

Recibido: Agosto 9, 2018 Aceptado: Febrero 18, 2019

[1] Instituto de Innovacion en Biotecnologia e Industria (IIBI), P.O. Box 329-2, Santo Domingo. Rep. Dominicana.

e-mail: atharva23@hotmail.com; mbreaj@yahoo.es; guarinad@hotmail.com; inekohodai@hotmail.com

[2] Facultad de Ingenierias, Universidad Ecotec, km. 13,5 via Samborondon, Guayas, Ecuador.

e-mail: iperez@ecotec.edu.ec (autor de correspondencia)

Leyenda: Figura 1. Productos de amplificacion PCR obtenidos con los marcadores moleculares tipo SCAR. A. Imagenes de corridas electroforeticas del cebador PrP1 (250 pb). B. Imagenes de corridas electroforeticas del cebador CosA (210 pb). C. Imagenes de corridas electroforeticas del cebador RGA2 (635 pb). D. Imagenes de corridas electroforeticas del cebador R1 (1400 pb). E. Imagenes de corridas electroforeticas del cebador GP179 (570 pb). Marcador alelico (100 pb). Tincion con bromuro de etidio. MA: marcador alelico, LPC290: linea 290 del Centro Internacional de la Papa (CIP, Lima, Peru); CPC336=control positivo y CN: control negativo
Cuadro 1. Descripcion de las muestras seleccionadas, lugares
de muestreo, calidad y concentracion del ADN utilizado en el
presente estudio

Muestra    Denominacion                     Lugar
No.        comercial                     de muestreo

1          F1M4-Granola                       MC
2          F2M3 (2) -Maranca                  MC
3          F3M6-Granola                       MC
4          F4M1-Granola                       MC
5          F5M4-Granola                       MC
6          F6M5(2)- Granola                   MC
7          F9M1(2)-Atlantica                  MC
8          F10M3(2)- Granola                  MC
9          F11M2-Granola                      MC
10         F12M4-Granola                      MC
11         F13M5-Granola                      MC
12         F14M2(2)-Granola                   MC
13         F15M6 -Almenote                    TC
14         F16M5-Petite Gourmet               TC
15         F17M2(2)-Papas Jumbo               TC
16         F18M6-Vitelotte                   PSJO
17         F19M1-Granola                     PSJO
18         F20M1-Granola                     PSJO
19         F21M6(2)-Vitelotte                 TC
20         F22M3(2)-Green Giant Fresh         TC
21         F23M2-LiderFresh                   TC
22         F24M1-DoleFresh                    TC
23         LPC290                            CIP
24         CPC336                            CIP

Muestra    Denominacion                  [R.sub.260:280]
No.        comercial

1          F1M4-Granola                        1,95
2          F2M3 (2) -Maranca                   1,91
3          F3M6-Granola                        1,89
4          F4M1-Granola                        1,89
5          F5M4-Granola                        1,93
6          F6M5(2)- Granola                    1,94
7          F9M1(2)-Atlantica                   1,92
8          F10M3(2)- Granola                   1,95
9          F11M2-Granola                       1,93
10         F12M4-Granola                       1,95
11         F13M5-Granola                       1,94
12         F14M2(2)-Granola                    1,91
13         F15M6 -Almenote                     1,95
14         F16M5-Petite Gourmet                1,95
15         F17M2(2)-Papas Jumbo                1,95
16         F18M6-Vitelotte                     1,93
17         F19M1-Granola                       1,89
18         F20M1-Granola                       1,93
19         F21M6(2)-Vitelotte                  1,93
20         F22M3(2)-Green Giant Fresh          1,83
21         F23M2-LiderFresh                    1,85
22         F24M1-DoleFresh                     1,91
23         LPC290                              2.00
24         CPC336                              1.90

Muestra    Denominacion                  [R.sub.260:230]
No.        comercial

1          F1M4-Granola                        2,05
2          F2M3 (2) -Maranca                   1,7
3          F3M6-Granola                        2,05
4          F4M1-Granola                        1,93
5          F5M4-Granola                        1,92
6          F6M5(2)- Granola                    2,04
7          F9M1(2)-Atlantica                   1,99
8          F10M3(2)- Granola                   1,85
9          F11M2-Granola                       2,08
10         F12M4-Granola                       2,09
11         F13M5-Granola                       1,88
12         F14M2(2)-Granola                    2,04
13         F15M6 -Almenote                     2,02
14         F16M5-Petite Gourmet                2,11
15         F17M2(2)-Papas Jumbo                2,18
16         F18M6-Vitelotte                     1,71
17         F19M1-Granola                       1,98
18         F20M1-Granola                       2,11
19         F21M6(2)-Vitelotte                  1,34
20         F22M3(2)-Green Giant Fresh          1,66
21         F23M2-LiderFresh                    1,58
22         F24M1-DoleFresh                     1,82
23         LPC290                              2.57
24         CPC336                              2.41

Muestra    Denominacion                  [DO.sub.320]
No.        comercial

1          F1M4-Granola                      0,003
2          F2M3 (2) -Maranca                -0,019
3          F3M6-Granola                     -0,054
4          F4M1-Granola                     -0,155
5          F5M4-Granola                     -0,166
6          F6M5(2)- Granola                 -0,292
7          F9M1(2)-Atlantica                -0,094
8          F10M3(2)- Granola                -0,246
9          F11M2-Granola                    -0,055
10         F12M4-Granola                    -0,262
11         F13M5-Granola                    -0,189
12         F14M2(2)-Granola                 -0,111
13         F15M6 -Almenote                  -0,045
14         F16M5-Petite Gourmet             -0,295
15         F17M2(2)-Papas Jumbo              0,024
16         F18M6-Vitelotte                  -0,293
17         F19M1-Granola                    -0,062
18         F20M1-Granola                    -0,169
19         F21M6(2)-Vitelotte               -0,366
20         F22M3(2)-Green Giant Fresh       -0,052
21         F23M2-LiderFresh                 -0,012
22         F24M1-DoleFresh                  -0,239
23         LPC290                            0,014
24         CPC336                            0,038

Muestra    Denominacion                   Concentracion de
No.        comercial                         ADN (ng x
                                         [micron]L.sup.-1])

1          F1M4-Granola                        557,69
2          F2M3 (2) -Maranca                   164,06
3          F3M6-Granola                        390,22
4          F4M1-Granola                        333,005
5          F5M4-Granola                        206,61
6          F6M5(2)- Granola                    320,725
7          F9M1(2)-Atlantica                   376,51
8          F10M3(2)- Granola                   160,195
9          F11M2-Granola                       450,99
10         F12M4-Granola                       370,93
11         F13M5-Granola                       237,76
12         F14M2(2)-Granola                    339,625
13         F15M6 -Almenote                     346,55
14         F16M5-Petite Gourmet                404,88
15         F17M2(2)-Papas Jumbo                261,305
16         F18M6-Vitelotte                     209,785
17         F19M1-Granola                       243,855
18         F20M1-Granola                       467,66
19         F21M6(2)-Vitelotte                  83,685
20         F22M3(2)-Green Giant Fresh          280,945
21         F23M2-LiderFresh                    143,08
22         F24M1-DoleFresh                     377,56
23         LPC290                             1.504,29
24         CPC336                              645,21

R: absorbancia en nm; DO: densidad optica; F: finca; M:
muestras; LPC: linea de prueba CIP, CPC: control positivo
CIP; CIP: Centro Internacional de la Papa (Lima, Peru). MC:
municipio Constanza, TC: Tienda Comercial, PSJO: Provincia
San Jose de Ocoa

Cuadro 2. Listado de marcadores SCAR (sequence characterized
amplified region) utilizados con sus secuencias de
oligonucleotidos, tamanos esperados de los fragmentos
amplificados, temperatura de hibridacion utilizada en la
reaccion en cadena de la polimerasa (PCR), cromosoma de
ubicacion de la secuencia y la respectiva referencia

Marcador     Secuencias de oligonucleotidos
molecular

PrP1-F       5'-GTGACATGAGCACATAAGTC-3'
PrP1-R       5'-GCAACTTCACTTCTGCCATC-3'
CosA-F       5'-CTCATTCAAAATCAGTTTTGATC-3'
CosA-R       5'-GAATGTTGAATCTTTTTGTGAAGG-3'
RGA2-F       5'-GGCAAGCTCAGAATCAATTATCCACCCCAACTTTTAAAT-3'
RGA2-R       5'-CAAGTATTGGGAGGACTGAAAGGTGTTGGGCATC-3'
R1-F         5'-CACTCGTGACATATCCTCACCTA-3'
R1-R         5'-CAACCCTGGCATGCCACG-3'
GP179-F      5'-GGTTTTAGTGATTGTGCTGC-3'
GP179-R      5'-AATTTCAGACGAGTAGGCACT-3'
BA47f2-F     5' GGCCGCTCTAGAACTAGTGGATC 3'
BA47f2-R     5' AGTCTTAAAAATTCGACTCTAA 3'

Marcador         Tamano            Tm
molecular      fragmento      ([grados]C)    Cromosoma
             esperado (pb)

PrP1-F            250              64            IX
PrP1-R
CosA-F            210              62            V
CosA-R
RGA2-F            635              57           VIII
RGA2-R
R1-F              1400             64            V
R1-R
GP179-F           570              64            V
GP179-R
BA47f2-F          650              55           VIII
BA47f2-R

Marcador
molecular       Referencia

PrP1-F        Ballesteros et
PrP1-R           al., 2010
CosA-F         Juyo et al.,
CosA-R             2011
RGA2-F       Beketova et al.,
RGA2-R             2006
R1-F          Ballesteros et
R1-R             al., 2010
GP179-F        Diaz et al.,
GP179-R            2003
BA47f2-F     Juyo et al, 2011
BA47f2-R

F: forward, R: reverse, pb: pares de bases, Tm: temperatura
de hibridacion
COPYRIGHT 2019 Universidad Centroccidental Lisandro Alvarado
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rosa, Atharva V.; Perez-Almeida, Iris; Mejia, Julio; Delmonte, Guarina; Hodai, Ineko
Publication:BIOAGRO
Date:Aug 1, 2019
Words:5819
Previous Article:PORTAINJERTOS DE DURAZNO EN DEFICIT HIDRICO Y SU CARACTERIZACION CON BASE A VARIABLES FISIOLOGICAS Y ANATOMICAS.
Next Article:CARACTERISTICAS DE FRUTOS DE DURAZNEROS PROVENIENTES DE 'EL PENON DE GABANTE', ESTADO ARAGUA, VENEZUELA.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters