Printer Friendly

EFFECT OF HIGH TEMPERATURE ON THE ENZYMATIC ACTIVITIES AND TRANSCRIPTIONAL EXPRESSION OF STARCH DEBRANCHING ENZYME (DBE) MUTIPLE ISOFORMS IN DEVELOPING RICE ENDOSPERMS.

Byline: K. S. Wei, W. L. Yang, G. Jilani, W. J. Zhou, G. K. Liu, A. N. Chaudhry, Z. Z. Cao and F. M. Cheng

ABSTRACT

This study investigated the influence of high temperature on the expression patterns of multiple DBE isoform genes (PUL, ISA1, ISA2 and ISA3) at RNA transcriptional level in developing endosperm, as well as its relation to the varying total activity of DBE and starch fine structure. Two rice genotypes with different amylose content and palatability were used for research under two temperature treatments (32degC and 22degC for the mean daily temperature, respectively) at filling stage. The temperature treatments were laid out in a completely randomized design. The data were analyzed using SPSS into one-way ANOVA, and means separation was carried out with the LSD method The result showed that high temperature resulted in the decrease of DP5-9 and DP15-22, and increase of DP10-13 and DP greater than 42 of amylopectin in rice endosperm. For enzyme activity, PUL and ISA showed higher activities at initial stage, but substantially lower at later filling stage relative to low temperature.

For different DBE isoform genes, ISA1 and ISA2 presented up-regulation pattern at high temperature over the whole sampling stage, while ISA3 and PUL showed the opposite case at the later filling stage in comparison of their corresponding low temperature. The DBEs isozyme activities and their transcriptional expression indicated that ISA2 was one of the dominant DBE isoforms highly expressed at later filling stage. The contribution of ISA3 expression to total ISA activity was mostly at earlier filling stage when rice plants were subjected to high temperature. Further investigations are required to elucidate the coordinated action of multiple key enzymes in starch synthesis at high temperature and their relations to amylopectin fine structure and rice quality.

Key words: Rice (Oryza sativa L.), Starch debranching enzyme, Gene expression, Enzyme activity, High temperature

INTRODUCTION

Rice is one of the world's most important crops, particularly in Asia. However, its grain yield and quality often fluctuate due to various environmental stresses (Jia et al., 2008; Quampah et al., 2011). Temperature during reproductive period is one of the crucial factors influencing rice yield and grain quality. In particular, global warming is predicted to increase the frequency and severity of high temperature in tropical and subtropical regions (Qureshi and Ali, 2011) where rice is grown. It will have negative impact on rice productivity by causing yield reduction and grain quality deterioration (Peng et al., 2004; Li et al., 2011; Turner et al., 2011).

It has been well documented that grain quality is dependent on both environment and genotype (Tashiro et al., 1991; Akhter et al., 2008), high chalk occurrence in rice grains is mainly attributable to adverse climatic conditions, especially daily mean temperature or episodes of high temperature at filling stage (Prasad et al., 2006; Chakrabarti et al., 2010). Another conspicuous injury of high temperature stress during reproductive period is the reduction of pollen fertility, grain weight and plant harvests, in addition to the deteriorating palatability (Jiang et al., 2003; Yamakawa et al., 2007; Li et al. 2011).

In the past decades, great effort has been made to recognize the effect of high temperature on grain quality, and it has been demonstrated that the deterioration of grain quality for rice exposed to high temperature is closely related to starch granule accumulation, starch components and its biosynthesis metabolism in filling endosperms (Zakaria et al. 2002). The rice genotypes with low amylose content and superior palatability generally was more sensitive to high temperature episodes in their starch quality than those with high amylase content and inferior palatability (Cheng et al., 2005). High temperature at filling stage could decreases amylose content (AC) in endosperm starches of non- waxy rice plants, as a result of decreased activity of GBSS (Granule bound starch synthase), where Wx gene expression in rice grains is regulated by temperature at the transcriptional and post-transcriptional level (Asaoka et al., 1985; Hirano and Sano, 1998; Larkin and Park, 1999).

Meanwhile, high temperature at filling stage could also increase the amount of long B chains of amylopectin and decrease short B chains (Asaoka et al., 1985), which is more dominantly attributable to the changing activities of soluble starch synthase (SSS), starch branching enzyme (SBE) and starch debranching enzyme (DBE) in filling endosperms, rather than the limitation in sucrose supply from photosynthesis tissues and its cleavage metabolism in non-photosynthesis tissues.

Starch debranching enzyme (DBE) is a key enzyme involving in starch metabolism in rice endosperm (James et al., 2003; Jeon et al., 2010). It can hydrolyze the a-1,6-glucosic linkages of polyglucans and play an important role in the starch metabolism, including starch degradation, carbohydrate mobilization, amylopectin synthesis and the structural organization of stored glucan polymers in starch granules. Burton et al. (2002) suggested that the synthesis of the correct branching pattern of amylopectin synthesis requires the DBE activity and the glucans are elongated and branched to form phytoglycogen in DBE deficient mutants. DBE in rice endosperm could be classified as isoamylase (ISA, EC: 3.2.1.68) and pullulanase (PUL, also called limit- dextrinase or R-enzyme, EC: 3.2.1.142) in term of their amino acid sequences and the substrate specificities catalyzed enzymatically sites.

ISA mainly hydrolyze phytoglycogen and amylopectin, while PUL acts upon pullulan and amylopectin (Zhu et al., 1998; Fujita et al., 2009). Until now, it has been commonly recognized that there are three ISA isoform genes (ISA1, ISA2, ISA3) encoding isoamylase in rice endosperm (Nakamura et al., 1996; Fujita et al., 1999; Zeeman et al., 2010), with only a single PUL gene encoding pullulanase identified in cereal plant (Dinges et al., 2003; Hussain et al., 2003; Li et al., 2009). Interestingly, it was generally accepted that the isozymes of ISA1 and ISA2 are mainly responsible for amylopectin synthesis, while the primary role of PUL and ISA3 appears to be mostly in starch degradation except for their involvements in phytoglycogen and amylopectin synthesis (Jeon et al., 2010; Fujita et al., 2009).

Although extensive studies were conducted on the effect of temperature on activities of the enzymes related to starch synthesis metabolism in rice and other cereals, and also focused on the relationship between the lacks of DBE isozyme genes in some mutants and the underlying mechanisms of starch structure formation at the molecular levels, few researches have been done to illustrate the expression response of different DBE isozyme genes, including ISA1, ISA2, ISA3 and PUL, to ambient high temperature at filing stage and their relations to starch quality of rice grains, with little information on the relationships between the changing activities of different DBE, including pullulanase and isoamylase, in rice filling grain under high temperature and rice genotypes varying in amylose content and palatability.

In this study, two early non-waxy indica rice genotypes, J935 with superior palatability and J353 with inferior palatability, were compared for difference in the expression patterns of PUL and three ISA isoform genes (ISA1, ISA2, ISA3) at RNA transcriptional level in the developing endosperm under different temperatures. Activities of pullulanase and isoamylase in developing endosperm, and starch fine structure in milled grains were also measured with the rice plant grown in the well defined temperature condition. Our aim was to reveal the effect of high temperature on the expression patterns of multiple DBE isoform genes (PUL, ISA1, ISA2 and ISA3) at RNA transcriptional level in developing endosperm, and their relations to varying total activity of DBE and starch fine structure between two rice genotypes.

MATERIALS AND METHODS

Experimental Materials: Two indica rice genotypes with similar growth period and grain weight, namely, J935 and J353, were planted in the experimental field of Zhejiang University, Hangzhou, China. Seeds were sown on 29th March and transplanted on 28th April, 2010. Plants were managed normally in paddy field until late booting stage; then 50 plants with uniform size were selected and transplanted into plastic pots (2 plants per pot) filled with paddy soil. The pots were placed in a greenhouse. At full heading stage, 20-30 panicles with uniformity anthesis day were randomly selected and tagged. The pots were moved into phytotrons (Model PGV-36, CONVIRON, Canada) set at different temperatures. The experimental design was completely randomized, and the treatments were replicated three times. From 5th to 20th day after flowering, the tagged panicles were sampled at a 5-day interval.

Grain samples were prepared for the analysis of DBE enzyme activities and RNA transcriptional expression of their isoform genes in rice endosperm. At maturity, the other labeled panicles were harvested simultaneously for measuring starch fine structure.

Two temperature treatments were imposed, daily mean temperature 32degC (HT, high temperature treatment, ) and 22degC (LT, optimum temperature putatively for good palatability of indica rice), respectively. The diurnal change of daily mean temperature in two phytotrons was designed as shown in Figure 1. The maximum and minimum of daily temperatures were 36oC and 28oC in HT and 26oC and 18oC in LH, respectively. All the climate conditions were identical in two phytotrons except for temperature, the photoperiod was from 5:30 a.m. to 7:00 p.m. with 100 to 120 J m-2 s-1 of light intensity, and the relative humidity was maintained around 75-80%.

Preparation and Assay of Enzyme Activities: Twenty de-hulled rice grains were hand-homogenized at 0-4oC in a mortar and pestle with 5 mL pre-cold extraction buffer containing 50 mmol L-1 imidazole-HCl (pH 7.4), 8 mmol L-1 MgCl2, 50 mmol L-1 2-mercaptoethanol and 12.5% (v/v) glycerol. The homogenate was centrifuged at 4oC with 15 000xg for 15 min,then the supernatant solution was collected for enzyme analysis.

The activities of isoamlase and pullulanase were measured according to the procedure of Nakamura et al. (1996) with some minor modifications. For isoamylase, 50 mL Hepes-NaOH (pH 7.0) buffer containing 2.5 mg amylopectin (Sigma) was added to 50 mL supernatant solution, then the reaction mixture was run for 2 h at 37degC and terminated by adding 50 mL of 1 mol L-1 Na2CO3, DNS (3,5-Dinitrosalicylic acid) method was used to determine maltose concentration. For pullulanase, the reaction buffer was substituted by 50 mL citric acid buffer (pH 5.5) and 5 mg pullulan (Sigma), the follow-up steps was the same as isoamylase except for using maltotriose as DNS standard. All samples were conducted by 3~4 duplications.

RNA Extraction and cDNA Preparation: Total RNA of grain samples was extracted with the RNeasy plant mini kit (Qiagen) according to manufacture's instructions. Twenty grains were ground in liquid- nitrogen after removing hull and embryo. The extracts were treated with RNase-free DNase(Qiagen) to completely remove contaminating genomic DNA, then the purified RNAs were measured with formaldehyde denatured agarose electrophoresis and spectrophotometer scan. First-strand cDNA was prepared by a synthesizing reaction of 3 mg total RNA with RevertAid First Strand cDNA Synthesis Kit (Fermentas Company) and Oligo- dT18 primer.

Real-time Fluorescence Quantitative PCR: Aliquots of the first-stand cDNA mixtures corresponding to 5 ng of total RNA served as the templates for quantitative Real- time PCR analysis with EvaGreenTM qPCR Master Mix reagent Kit (Roche Company, Germany). Reactions were carried out on an iQ icycler (BioRad) according to the manufactures protocols. The gene-specific primer pairs used for quantitative PCR are listed in Table-1. To verify the specificity of each primer set and optimize PCR conditions of the annealing temperature and PCR efficiency, the fluorescence signal specificity of PCR amplification was detected for each primer pairs and their melting curve (from 55degC to 94degC) was examined prior to the experimental measurements. The amplification of Actin gene was performed as a control and a standard curve was checked. Three replications were conducted for each sample.

Measurement of Total Starch, Amylose Content and Fine Structure of Amylopectin: Total starch contents in rice endosperm were determined according to McCleary et al. (1994). Apparent amylose content determined according to Umemoto et al. (1995) through measuring 30 de-hulled rice grains. Triplicate measurements were performed for each sample.

The chain length distributions of amylopectin after debranching with isoamylase were determined as previously described (O'Shea et al., 1998; Fujita et al., 2001). Two replicate measurements were performed for each sample.

Data Analysis: Statistical analysis was performed using a statistical software version SPSS 15.0. Determined values were submitted to one-way ANOVA and means separation was carried out with the LSD method.

RESULTS

Starch Accumulation and Amylopectin Structure: As shown in Figure 2, temperature treatments during grain filling had a considerable influence on the total starch accumulation and apparent amylose content in rice endosperms, with high temperature treatment exhibiting lower accumulation of total starch in rice endosperms than low temperature treatment, irrespective of rice genotypes (Figure 2A). However, there was a marked difference in the response of apparent amylose content to high temperature between two rice genotypes, J935 showed lower apparent amylose content at high temperature than at low temperature, while J353 was just opposite (Figure 2B), which was consistent with previous report from Zhong et al. (2005).

They reported that the influence of high temperature on the ratio of amylose to total starch (RATS) in milled grains was genotype- dependent; the cultivars with low amylose content generally had the reduced RATS under high temperature, while the cultivars with high amylose content increased or kept stable in their RATS under high temperature.

Temperature at filling stage also exerted a remarkable impact on the percentage distribution of different chain-length fractions of amylopectin, thereby affecting the fine structure of starch granules in rice endosperms (Yamakawa et al., 2007). High temperature caused notable decrease of DP5-9 and DP15-22, but significant increase of DP10-13 and DP greater than 42, irrespective of the genotypes with different palatability (Figure 3). However, the effect of high temperature on the chain- length fraction of DP25-36 was genotype-dependent, the chains-length with DP25-29 increased slightly for J353, but decreased obviously for J935 when the plants were exposed to high temperature. These results confirmed that the genotypic difference in their response of starch quality to high temperature was closely related to the amylopectin structure and their chain-length distribution, in addition to the effect of high temperature on their apparent amylose content.

Activities of Pullulanase (PUL) and Isoamylase (ISA): The total activity of DBE in rice endosperms has previously been reported to be the coordinating result of pullulanase (PUL) and isoamylase (ISA) (Nakamura et al., 1996; Jeon et al., 2010). As shown in Figure 4, the PUL activity was much higher at high temperature than that at low temperature during early grain filling, while it was contrast or not the case later (Figure 4A and 4B). Hence, PUL activities of both J935 and J353 at high temperature reached their peak levels at 10 day after flowering, and tended to decline thereafter. At late grain filling stage, the PUL activity was significant higher at low temperature than those at high temperature, and two rice genotypes did not show apparent difference in the response pattern of PUL activity to temperature.

The effect of high temperature on ISA activity was similar to that of PUL, despite a marked difference in the extent of temperature effect and their temporal patterns during filling stage (Figure 4C and 4D). Around 5th after flowering, there was higher ISA activity at high temperature than that at low temperature. Afterward, the ISA activity remained stable or slight decline at high temperature, but gradually increased at low temperature, thereby the remarkable difference in ISA activity was also observed between two temperature treatments at 15th or 20th after flowering, with significant lower ISA activity at high temperature relative to low temperature. For J935, the decreasing ISA activity in high temperature occurred sharply at around 10th day after flowering, corresponding to mostly rapid stage of grain filling.

In contrast, J353 showed small difference between two temperature treatments at 10th and 15th after flowering, but the extent of their difference in ISA activity was subsequently enlarged afterward. This result implied that the effect of high temperature on the temporal patterns of ISA activity may be responsible for two genotypic differences in their chain-length distribution and genotype-dependent to high temperature.

Expression of Different DBE Isozyme Genes: High temperature had an apparent impact on their transcriptional expression of DBE isozyme genes, including three ISA genes (ISA1, ISA2 and ISA3 ) and the sole PUL gene, in developing endosperm, despite of the influencing pattern and extent being dependent on different gene isoforms and rice genotypes (Figure 5 and 6). The expression levels of ISA1 and ISA2 were substantially higher at high temperature than those at low temperature over the whole sampling period, indicting that ISA1 and ISA2 genes obviously exhibited an up- regulation expression pattern at their RNA transcriptional levels when rice plants grew at high temperature (Figure 5A-D). On the other hand, the distinct expression pattern was observed for the responses of ISA3 and PUL to high temperature, with higher levels of transcriptional expression induced at the earlier filling stage and lower expression at the later filling stage relative to low temperature (Figures 5E-F and 6A-B).

Moreover, the expression of ISA1 in J353 was detectable at very low level for both high temperature and low temperature treatment, while the expression level of ISA1 in J935 increased drastically when rice plants were exposed at high temperature treatment (Figure 5A and 5B), implying that the expression level of ISA1 in J935 was more sensitive to high treatment than that in J353.

Table-1: The primers sequence of 4 DBE isoforms involving in starch biosynthesis pathway in rice grains

###Product###Annealing

Gene name###Accession No. Primer pairs a###size/ bp###temperature/degC

Actin###XM_469569###F: 5'-CAGCACATTCCAGCAGATGT###198###58

###R: 5'- TAGGCCGGTTGAAAACTTTG

ISA1###AB093426###F: 5'- TGCTCAGCTACTCCTCCATCATC###132###59

###R: 5'- AGGACCGCACAACTTCAACATA

ISA2###AC132483.2###F: 5'-CAGTGAGTGCTGCCTTGC###106###57

###R: 5'-TTGGGATTAGATTCGGTTG

ISA3###AP005574###F: 5'-ACAGCTTGAGACACTGGGTTGAG###100###58

###R: 5'-GCATCAAGAGGACAACCATCTG

PUL###D50602###F: 5'-AGTGACATTGAGCAAAGGGTTC###168###58

###R: 5'-CACTTCGTGTGGACAGACATTG

Note: a'F = Forward primer, and R = Reverse primer.

From Figure 5, it could be also found that the expression levels of ISA2 and ISA3 generally were much higher than that of ISA1 in rice endosperms, particularly at early filling stage, indicting that the contribution of individual ISA1 expression to total isoamylase activity might be relatively trivial in early filling endosperms, particularly for J353. On the other hand, there were a considerable difference in the temporal-pattern between ISA2 and ISA3 in term of their expressions during filling period. For ISA2, the lowest expression level generally occurred at earlier filling stage and tented to increase thereafter, while the opposite was true for ISA3 at high temperature, irrespective of rice genotypes. Therefore, it could be presumed that ISA2 was one of dominant DBE isoforms highly expressed at later filling stage, while the contribution of ISA3 expression to total ISA activity was mostly at earlier filling stage when rice plants were subjected to high temperature.

DISCUSSION

It has been well reported that higher temperature during grain filling stage results in the decreased starch (Keeling et al., 1993; Umemoto et al., 1995) and as well as starch components and fine structure of amylopectin chain in the endosperms of non-waxy rice (Takeda and Sasaki, 1988; Jiang et al., 2003). Higher environmental temperature could cause the increase long B chains (58 less than DP less than 64) and intermediate B chains (23 less than DP less than 58), and also the decrease of short chains (short B chains and A chains, CL less than 22) in amylopectin distribution (Asaoka et al., 1985; Cheng et al., 2005). However, it was found that the effect of high temperature on AAC (apparent amylose content) was genotype-dependent (Normita et al., 1989; Zhong et al., 2005).

In the current study, we found a distinct reduction of total starch in rice endosperm under high temperature relative to the control (low temperature), but the extent of the difference between the two temperature treatments was not as great as that of apparent amylose content for both genotypes, with much larger difference also displayed in J935 than J353, which was agreement with our previous report (Cheng et al., 2005). The present results also showed that high temperature resulted in the decrease of DP5-9 and DP15-22, but the increase of DP10-13 and DP greater than 42 at high temperature with the short and intermediate (DP less than 58) chains being further focused, However, the effect of high temperature on the chain-length fraction of DP25-36 varied greatly with genotype.

These results confirmed that the genotypic difference in their response of starch quality to high temperature was closely related to the amylopectin structure and their chain-length distribution, in addition to its difference in apparent amylose content.

In the past, the metabolic role of debranching enzymes was initially thought to be the degradation of amylopectin in storage starch during germination, or in transitory starch. However, it had been extensively demonstrated that starch debranching enzymes (DBE) also played essential roles on amylopectin biosynthesis by mutations of deficient isoamylase or pullulanase in many species (Nakamura et al., 1996; Jeon et al., 2010). This is because the DBE can trim and remove the misplaced, loosely branched chains to allow starch biosynthesis normally and the formation of crystalline amylopectin (Kubo et al., 1999; Fujita et al., 2009). According to Nakamura et al. (1996) and Kawagoe et al. (2005), the activity of isoamylase-type DBE was specifically reduced in rice sugary mutants, and the number and size of starch granule were also altered in endosperms.

The ISA deficient mutant in Arabidopsis caused an 80% of decrease in the starch content and the accumulation of water-soluble polysaccharides, In addition, accompanied by a strong modification of amylopectin structure relative to its wild type (Wattebled et al., 2005). Moreover, it was suggested that the role of isoamylase partially overlapped with Pullulanase for the trimming of pre-amylopectin chains during starch synthesis (Fujita et al., 2009).

In our present study, the temporal patterns of both isoamylase-type and pullulanase-type DBEs in grain filling process as affected by high temperature were investigated at their enzymatical activity and RNA transcriptional levels, the results revealed that the effect of high temperature to ISA activity was similar to that of PUL, with the highest activities of PUL and ISA at later filling stage, which was consistent with the results of Umemoto et al. (1995) and Cheng et al. (2005), who concluded that the peak activity of DBE, without taking DBE-type distinction into consideration, was relatively later than those of AGPase and SSS. In addition, Smrcka and Szarek (1986) described that the reduction of starch accumulation in cereal grain at high temperature was attributable to the increased starch degradation and the decreased starch synthesis.

Stahl et al. (2004) clarified that the deficient PUL and ISA activity in barley endosperm could cause a reduction in the small (B-type) granules, and also an alteration of starch content and amylopectin chain-length distribution. Our present results indicted that high temperature resulted in higher activities of PUL and ISA at initial stage, but substantially lower at later filling stage relative to low temperature, implying that the decline of total starch content at high temperature was mostly caused by the decreased starch synthesis, rather than by the increased starch degradation, due to much higher PUL and ISA activities detected for low temperature treatment, although PUL and ISA also played crucial roles in catalyzing starch degradation.

In this study, high temperature was found to influence the expression of DBE genes at their transcriptional levels, despite of the impacting pattern being dependent on different isoforms. For example, higher expression amount and largely up-regulated pattern at high temperature was observed for ISA1 and ISA2 over the whole sampling stage, while the opposite was true for ISA3 and PUL at the later filling stage in comparison of their corresponding low temperature. According to Utsumi et al. (2006), ISA1 could form a homomultimer and heteromultimer complex with ISA2 in developing rice endosperm. Some experiments on the mutants of deficient ISA1 and transgenic plant materials clarified that ISA1 participated in the form of amylopectin chain of DP[?]12, with the increasing distribution of DP[?]12 chains and the decreasing percentage of DP greater than 40 chains in sugary mutants (Kubo et al., 1999; Kubo et al., 2005; Fujita et al., 2009).

In our present study, The response of ISA1 and ISA2 to high temperature were very similar but different from those of ISA3 and PUL, with much higher expressions of ISA1 and ISA2 at high temperature than those at low temperature (Figure 5A-D), implying an coordinate impact pattern between ISA1 and ISA2. On the other hand, it was found that high temperature at filling stage significantly increased the percentage of DP greater than 42 amylopectin chains and apparently decreased the distribution of DP5-9 chains (Figure 3). Therefore, it could be deduced that high expression amount and largely up-regulated pattern of ISA1 and ISA2 at high temperature were responsible for the increasing DP greater than 42 and decreasing DP5-9 distribution when rice plants exposed at high treatment.

However, the effect of high temperature on ISA1 expression was rice genotype dependent, the expression levels of ISA1 drastically increased at high temperature for J935 (Figure 5A), while it was not this case for J353 with slight difference and low level in ISA1 expression between two temperature treatments (Figure 5B), implying that the response of ISA1 expression at high temperature probably was closely related to their difference in grain quality and palatability to high temperature sensitivity among different rice genotypes.

It should be noted that DBE is not the sole enzyme controlling the chain length distribution and fine structure of amylopectin, although it plays a crucial role on the normal amylopectin biosynthesis and formation of crystallizing starch granules, in addition to the degradation of amylopectin (Nakamura et al., 1996; Jeon et al., 2010) . Soluble starch synthases (SSS), starch branching enzymes (SBE) were also responsible for starch biosynthesis and controlling its chain length fine structure of amylopectin (Mizuno et al., 2001; Yandeau- Nelson et al., 2011). Fujita et al. (2006) reported that the degree of change in amylopectin chain-length distribution was significantly correlated with the extent of decrease in SSSI activity in the mutants, which suggested that SSSI affects the starch structure (Fujita et al., 2006).

In Zea mays, the loss of SSIIa increases the amount of amylose and increases the proportion of short glucan side chains in amylopectin and decreases intermediate chain length in amylopectin (Zhang et al., 2004). Satoh (2003) isolated a starch mutant that was deficient in SBE1 from the endosperm mutant and indicated that the genetic modification of amylopectin fine structure is responsible for changes in amylopectin chain-length distribution. James et al. (2003) and Tetlow (2006) concluded that amylose content in cereal was mostly controlled by granule-bound starch synthase (GBSS), whereas amylopectin generally was synthesized by the coordinated actions of soluble starch synthases (SS), branching enzymes (BE), and debranching enzymes (DBE).

Moreover, the different DBE isoforms might interact together or was partially substituted in catalyzing role on starch biosynthesis metabolism also exalted the complexity to recognize the relationship between DBEs metabolism and grain starch quality as affected by high temperature. For this reason, it was difficulty to explain the causal effect of high temperature on starch content and amylopectin structure, including the variations of DP15-23 and DP 25-36 amylopectin, and the genotype- dependent of amylose content between two temperature, by DBEs isozyme activities and their transcriptional expression presented in our current result. Therefore, further investigation is required to elucidate the coordinated actions of multiple DBEs, SBEs and SSSs isoforms at high temperature and their relations to amylopectin structure, so as to take genetic and agronomical efforts for the improvement of grain quality and palatability to resistance or tolerance high temperature.

Acknowledgements: The authors are indebted to National Natural Science Foundation of China (NSFC) for financial support to undertake this research (Grant No. 30871488 and 30671228).

REFERENCES

Akhter, M., S. S. Ali, M. A. Zahid, and M. Ramazan (2008). Use of TGMS lines for two line rice hybrids in Pakistan. J. Anim. Plant Sci. 18(2-3):83-85.

Asaoka, M., K. Okuno, Y. Sugimoto, and H. Fuwa (1985). Effect of environmental temperature at the milky stage on amylose content and fine structure of amylopectin of waxy and non-waxy endosperm starches of rice (Oryza sativa L.). Agri. Biol. Chem. 49:373-379.

Burton, R. A., H. Jenner, L. Carrangis, B. Fahy, G. B. Fincher, C. Hylton, D. A. Laurie, M. Parker, D. Waite, S. Wegen, T. Verhoeven, and K. Denyer (2002). Starch granule initiation and growth are altered in barley mutants that lack isoamylase activity. Plant J. 31:97-112.

Chakrabarti, B., P. K. Aggarwal, S. D. Singh, S. Nagarajan, and H. Pathak (2010). Impact of high temperature on pollen germination and spikelet sterility in rice: comparison between basmati and non-basmati varieties. Crop Pastu. Sci. 61:363-368.

Cheng, F. M., L. J. Zhong, N. C. Zhao, Y. Liu, and G. P. Zhang (2005). Temperature induced changes in the starch components and biosynthetic. Plant Growth Regul. 46:87-95.

Dinges, J. R., C. Colleoni, M. G. James, and A. M. Myers (2003). Mutational analysis of the pullulanase- type debranching enzyme of maize indicates multiple functions in starch metabolism. Plant Cell 15:666-680.

Fujita, N., A. Kubo, P. J. Francisco, M. Nakakita, K. Harada, N. Minaka, and Y. Nakamura (1999). Purification, characterization, and cDNA structure of isoamylase from developing endosperm of rice. Planta 208:283-293.

Fujita, N. H. Hasegawa, and T. Taira (2001). The isolation and characterization of a waxy mutant of diploid wheat (Triticum monococcum L.). Plant Sci. 160:595-602.

Fujita, N., A. Kubo, D. S. Suh, K. S. Wong, J. L. Jane, K. Ozawa, F. Takaiwa, Y. Inaba, and Y. Nakamura (2003). Antisense inhibition of isoamylase alters the structure of amylopectin and the physicochemical properties of starch in rice endosperm. Plant Cell Physiol. 44:607-618.

Fujita, N., Y. Toyosawa, Y. Utsumi, T. Higuchi, I. Hanashiro, A. Ikegami, S. Akuzawa, M. Yoshida, A. Mori, K. Inomata, R. Itoh, A. Miyao, H. Hirochika, H. Satoh, and Y. Nakamura (2009). Characterization of pullulanase (PUL)-deficient mutants of rice (Oryza sativa L.) and the function of PUL on starch biosynthesis in the developing rice endosperm. J. Exp. Bot. 60:1009-1023.

Hirano, H. Y., and Y. Sano (1998). Enhancement of Wx gene expression and the accumulation of amylose in response to cool temperatures during seed development in rice. Plant Cell Physiol. 39:807-812.

Hussain, H., A. Mant, R. Seale, S. Zeeman, E. Hinchliffe, A. Edwards, C. Hylton, S. Bornemann, A.M. Smith, C. Martin, and R. Bustos (2003). Three isoforms of isoamylase contribute different catalytic properties for the debranching of potato glucans. Plant Cell 15:133-149.

James, M.G., K. Denyer, and A.M. Myers (2003). Starch synthesis in the cereal endosperm. Curr. Opin. Plant Biol. 6:215-222.

James, M. G., D. S. Robertson, and A. M. Myers (1995). Characterization of the maize gene sugary1, a determinant of starch composition in kernels. Plant Cell 7:417-429.

Jeon, J. S., N. Ryoo, T. R. Hahn, H. Walia, and Y. Nakamura (2010). Starch biosynthesis in cereal endosperm. Plant Physiol. Biochem. 48:383-392.

Jia, Y., X. E. Yang, Y. Feng, and G. Jilani (2008). Differential response of root morphology to potassium deficient stress among rice genotypes varying in potassium deficiency. J. Zhejiang Univ. Sci. B 9(5):427-434.

Jiang, H., W. Dian, P. Wu (2003). Effect of high temperature on fine structure of amylopectin in rice endosperm by reducing the activity of the starch branching enzyme. Phytochem. 63:53-59.

Keeling, R. F., R. G. Najjar, M. L. Bender and P. P. Tans (1993). What atmospheric oxygen measurements can tell us about the global carbon cycle. Glob. Biogeochem. Cycl. 7:37-67.

Kubo, A., N. Fujita, K. Harada, T. Matsuda, H. Satoh, and Y. Nakamura (1999). The starch- debranching enzymes isoamylase and pullulanase are both involved in amylopectin biosynthesis in rice endosperm. Plant Physiol. 121:399-410.

Kubo, A., S. Rahman, Y. Utsumi, Z. Li, Y. Mukai, M. Yamamoto, M. Ugaki, K. Harada, H. Satoh, C. Konik-Rose, M. Morell, and Y. Nakamura (2005). Complementation of sugary-1 phenotype in rice endosperm with the wheat isoamylase1 gene supports a direct role for isoamylase1 in amylopectin biosynthesis. Plant Physiol. 137:43-56.

Larkin, P. D., and W. D. Park (1999). Transcript accumulation and utilization of alternate and non-consensus splice sites in rice granule-bound starch synthase are temperature-sensitive and controlled by a single-nucleotide polymorphism. Plant Mol. Biol. 40:719-727.

Li, H., Z. Chen, M. Hu, Z. Wang, H. Hua, C. Yin, and H. Zeng (2011). Different effects of night versus day high temperature on rice quality and accumulation profiling of rice grain proteins during grain filling. Plant Cell Rep. 30:1641-1659.

Li, Q. F., G. Y. Zhang, Z. W. Dong, H. X. Yu, M. H. Gu, S. S. Sun, and Q. Q. Liu (2009). Characterization of expression of the OsPUL gene encoding a pullulanase-type debranching enzyme during seed development and germination in rice. Plant Physiol. Biochem. 47:351-358.

Maestri, E., N. Klueva, C. Perrotta, M. Gulli, H. T. Nguyen, and N. Marmiroli (2002). Molecular genetics of heat tolerance and heat shock proteins in cereals. Plant Mol. Biol. 48:667-681.

McCleary, B. V., T. S. Gibson, V. Solah, and D. C. Mugford (1994). Total starch measurement in cereal products: interlaboratory evaluation of a rapid enzymic test procedure. Anal. Tech. Instru. 71:501-505.

Mizuno, K., E. Kobayashi, M. Tachibana, T. Kawasaki, T. Fujimura, K. Funane, M. Kobayashi, and T. Baba (2001). Characterization of an isoform of rice starch branching enzyme, RBE4, in developing seeds. Plant Cell Physiol. 42:349-357.

Nakamura, Y. (2002). Towards a better understanding of the metabolic system for amylopectin biosynthesis in plants: rice endosperm as a model tissue. Plant Cell Physiol. 43:718-725.

Nakamura, Y., T. Umemoto, N. Ogata, Y. Kuboki, M. Yano, and T. Sasaki (1996). Starch debranching enzyme (R-enzyme or pullulanase) from developing rice endosperm: purification, cDNA and chromosomal localization of the gene. Planta 199:209-218.

Nakamura, Y., K. Yuki, and S. Park (1989). Carbohydrate metabolism in the developing endosperm of rice grain. Plant Cell Physiol. 30:833-839.

Normita-de-la, C., I. Kumar, R. P. Kaushik, and G. S. Khush (1989). Effect of temperature during grain development on stability of cooking components in rice Jpn. J. Breed. 39:229-306.

O'Shea, M. G., M. S. Samuel, C. M. Konik, and M. K. Morell (1998). Fluorophore-assisted carbohydrate electrophoresis (FACE) of oligosaccharides: efficiency of labelling and high-resolution separation D-2706-2011. Carbohyd. Res. 307:1-12.

Peng, S., J. Huang, J. E. Sheehy, R. C. Laza, R. M. Visperas, X. Zhong, G. S. Centeno, G. S. Khush, K. G. Cassman (2004). Rice yields decline with higher night temperature from global warming. Proc. Nat. Acad. Sci. 101:9971-9975.

Prasad, P. V. V., K. J. Boote, L. H. Allen, J. E. Sheehy, and J. M. G. Thomas (2006). Species, ecotye and cultivar differences in spikelet fertility and harvest index of rice in response to high temperature stress. Field Crop Res. 95:398-411.

Quampah, A., R. M. Wang, I. H. Shamsi, G. Jilani, Q. Zhang, S. Hua, and H. Xu (2011). Improving water productivity by potassium application in various rice genotypes. Int. J. Agri. Biol. 13:9-17.

Qureshi, N. A., and Z. Ali (2011). Climate change, biodiversity, Pakistan's scenario. J. Anim. Plant Sci. 21(2 Suppl.):358-363.

Rahman, A., K. Wong, J. Jane, A. M. Myers, and M. G. James (1998). Characterization of SU1 isoamylase, a determinant of storage starch structure in maize. Plant Physiol. 117:425-435.

Rejeevan, M. S., D. G. Ranamukhaarachi, S. D. Vernon, and E. R. Unger (2001). Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods 25:443-451.

Smrck, A. V., and S. R. Szarek (1986). Phenotypical temperature adaptation of protein turnover in desert annuals. Plant Physiol. 80:206-210.

Satoh, H., A. Nishi, K. Yamashita, Y. Takemoto, Y. Tanaka, Y. Hosaka, A. Sakurai, N. Fujita, and Y. Nakamura (2003). Starch-branching enzyme I-deficient mutation specifically affects the structure and properties of starch in rice endosperm. Plant Physiol. 133:1111-1121.

Stahl, Y., S. Coates, J. H. Bryce, and P. C. Morris (2004). Antisense downregulation of the barley limit dextrinase inhibitor modulates starch granule size distribution, starch composition and amylopectin structure. Plant J. 39:599-611.

Takeda, K., and T. Sasaki (1988). Temperature response of amylose content in rice varieties on Hokkaido. Jpn. J. Breed. 38:357-362.

Tashiro, T., and F. Warldaw (1991). The effect of high temperature on kernel dimension and the type and occurrence of kernel damage in rice. Aust. J. Agri. Res. 42:485-496.

Tetlow, I. J. (2006). Understanding storage starch biosynthesis in plants: a means to quality improvement. Can. J. Bot. 84:1167-1185

Tian, Z., Q. Qian, Q. Liu, M. Yan, X. Liu, C. Yan, G. Liu, Z. Gao, S. Tang, D. Zeng, Y. Wang, J. Yu, M. Gu, and J. Li (2009). Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities. Proc. Nat. Acad. Sci. 106:21760-21765.

Turner, N. C., N. Molyneux, S. Yang, Y. C. Xiong, and K. Siddique (2011). Climate change in south- west Australia and north-west China: challenges and opportunities for crop production. Crop Pastu. Sci. 62:445-456.

Umemoto, T., Y. Nakamyra, and N. Ishikura (1995). Activity of starch synthase and the amylose content in rice endosperm. Phytochem. 6:1613-1616.

Utsumi, Y., and Y. Nakamura (2006). Structural and enzymatic characterization of the isoamylase1 homo-oligomer and the isoamylase1- isoamylase2 hetero-oligomer from rice endosperm. Planta 225:75-87.

Wattebled, F., Y. Dong, S. Dumez, D. Delvalle, V. Planchot, P. Berbezy, D. Vyas, P. Colonna, M. Chatterjee, S. Ball, and C. D'Hulst (2005). Mutants of Arabidopsis lacking a chloroplastic isoamylase accumulate phytoglycogen and an abnormal form of amylopectin. Plant Physiol. 138:184-195.

Yamakawa, H., T. Hirose, M. Kuroda, and T. Yamaguchi (2007). Comprehensive expression profiling of rice grain filling-related genes under high temperature using DNA microarray. Plant Physiol. 144:258-277.

Yandeau-Nelson, M. D., L. Laurens, Z. Shi, H. Xia, A. M. Smith, and M. J. Guiltinan (2011). Starch- Branching Enzyme IIa Is Required for Proper Diurnal Cycling of Starch in Leaves of Maize. Plant Physiol. 156:479-490.

Zakaria, S., T. Matsuda, and S. Tajima (2002). Effect of high temperature at ripening stage on the reserve accumulation in seed in some rice cultivars. Plant Prod. Sci. 5:160-168.

Zeeman, S. C., J. Kossmann, and A. M. Smith (2010). Starch: its metabolism, evolution, and biotechnological modification in plants. Ann. Rev. Plant Biol. 61:209-234.

Zhang, X. L., C. Colleoni, V. Ratushna, M. Sirghle- Colleoni, M. G. James, and A. M. Myers (2004). Molecular characterization demonstrates that the Zea mays gene sugary2 codes for the starch synthase isoform SSIIa. Plant Mol. Biol. 54:865-879.

Zhong, L. J., F. M. Cheng, X. Wen, Z. X. Sun, and G. P. Zhang (2005). The deterioration of eating and cooking quality caused by high temperature during grain filling in early-season indica rice cultivars. J. Agron. Crop Sci. 191:218-225.

Zhu, Z. P., C. M. Hylton, U. Rossner, and A. M. Smith (1998). Characterization of starch-debranching enzymes in pea embryos. Plant Physiol. 118:581-590.

Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310058, China;., Guizhou Tobacco Science Research Institute, Guiyang 550003, China;, Department of Soil Science, PMAS Arid Agriculture University, Rawalpindi 46300, Pakistan, Corresponding authors E-mail: chengfm@zju.edu.cn
COPYRIGHT 2012 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Wei, K.S.; Yang, W L.; Jilani, G.; Zhou, W.J.; Liu, G.K.; Chaudhry, A.N.; Cao, Z.Z.; Cheng, F.M.
Publication:Journal of Animal and Plant Sciences
Article Type:Report
Geographic Code:9CHIN
Date:Mar 31, 2012
Words:6505
Previous Article:GROWTH PERFORMANCE OF MAJOR CARP, LABEO ROHITA FINGERLINGS ON COMMERCIAL FEEDS.
Next Article:DIVERSIFICATION OF RICE-BASED CROPPING SYSTEMS TO IMPROVE SOIL FERTILITY, SUSTAINABLE PRODUCTIVITY AND ECONOMICS.
Topics:

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters