Printer Friendly

EFFECT OF CENTELLA ASIATICA POWDER (CAP) AND MANGOSTEEN PEEL POWDER (MPP) ON RUMEN FERMENTATION AND MICROBIAL POPULATION IN SWAMP BUFFALOES.

Byline: T. Norrapoke, M. Wanapat, S. Wanapat and S. Foiklang _: ABSTRCT

ABSTRCT

Keywords: Centella asiatica powder, mangosteen peel powder, rumen fermentation, methane production, real-timePCR, swamp buffaloes, rice straw.INTRODUCTION

Enteric methanogenesis represents an energy loss to the ruminants by as much as 12% of the gross energy (GE) intake (Johnson and Johnson, 1995) due to, fermentation process, and is a major contributor to the global greenhouse gas (GHG) emissions. Cattle continue to be highlighted as the main contributors to the global enteric methane budget (Thorpe, 2009). Reducing methane production can be highly beneficial indicating efficient use of energy and feed by the animal (Beauchemin and McGinn, 2006). However, most successful mitigation options will be those that are persistent, resulting in profitable milk or meat production (Grainger et al., 2008). Various approaches have been reported in mitigating rumen methane emission but their practical use have not yet been clearly shown (Hook et al., 2009).Asiatic Pennywort (Centella asiatica (L.) urban) is a stoloniferous perennial herb, commonly growing in humid areas in several tropical countries. It is used as a remedy for many diseases in the folk medicine of several countries (Mamedov, 2005). The chemical composition of asiatic pennywort consists of several groups; Triterpenoid saponins and Aglycones. It also contains other groups, including amino acids, flavonoids, alkaloids and volatile oils. However, Devkota et al. (2010) reported that the asiatic pennywort containing triterpene reduced the bacterial growth and inflammation. This herb may result in the degradation of carbohydrates (starch and sugar) in the rumen. Moreover, Dhar et al. (1968) found that alcoholic extract of entire plant showed antiprotozoal activity against Entamoeba histolytica. The essential oil from C.asiatica grown in South Africa contains 11 monoterpenoid hydrocarbons (20.2%), 9 oxygenated monoterpenoid (5.5%), 14 sesquiterpenoid hydrocarbons (68.8%), 5 oxygenated sesquiterpenoid (3.9%) and 1 sulphide sesquiterpenoid (0.8%). The predominant constitutes were b-caryophyllene (19.1%), bicyclogermacrene (11.2%), germacrene B (6.3%) and myrcene (6.6%) (Oyedeji and Afolayan, 2005).Although a number of studies have reported on using plant secondary compounds on reducing rumen methanogenesis, but the results have been variable (Pilajun and Wanapat, 2011). Puchala et al., (2005) reported that feeding plants containing condensed tannin to ruminants reduces methane emission. Supplementation of pellets containing condensed tannins and saponins (mangosteen peel powder and soapberry fruit) influenced rumen ecology by reducing methanogen population and consequent methane emission (Poungchompu et al.,2009). In another investigation, Guo et al. (2008) reported that tannins reduced the methane emission by inhibiting protozoa as well as presumably lowering the methanogenic activity of protozoal-associated methanogens. Other investigation reported that supplementation of plant containing condensed tannin and saponin (mangosteen peel powder), although reduced protozoal population but had no effect on methane production (Ngamsaeng and Wanapat, 2006). However, information on the use of Centella asiatica and/or tropical plant (mangosteen peel powder or MPP) in ruminants has been limited. Therefore, objective of this study was to evaluate the effect of Centella asiatica powder (CAP) and Mangosteen peel powder (MPP) supplementation on microbial population, rumen VFA concentration and their diversity in the rumen of swamp buffalo.

MATERIALS AND METHODS

Animals, diets, experimental design, and animal management: Four, rumen-fistulated swamp buffalo (B. bubalis) bulls, age 4-year-old, weighing 350 30 kg BW were used in this experiment. All animals were housed in individual pens. Concentrate was fed at 3 g/kg BW twice a day (at 07:00 h and at 16:30 h). Rice straw, water and mineral salt block were offered ad libitum. The experiment was a 4x4 Latin square design. Bulls were randomly assigned to four dietary treatments: without supplementation (Control), supplementation with Centella asiatica powder (CAP) at 25 g/kg of total DMI, with Mangosteen peel powder (MPP) at 25 g/kg of total DMI, and with Centella asiatica powder (CAP) at 25 g/kg and Mangosteen peel powder (MPP) at 25 g/kg of total DMI. Feed ingredients and chemical composition are presented in Table 1. The experiment was conducted for four periods; each experimental period lasted for 21 days. First 14 days were used as adaptation period in which, all animals were fed with their respective diets followed by a 7-day collection period. During the collection period, bulls were kept in metabolism crates for the daily feces and urine collection.

Data collection, sampling procedures, and statistical analysis: Roughage and concentrate were sampled for feeds analysis daily during the collection period. Feed and fecal samples were collected each day during a 7-day collection period. Composited samples were dried at60C in a forced-air oven for 48 h and ground to 1-mm screen using Cyclotech Mill (Tecator, Sweden) to determine DM, OM, CP according to AOAC (1990), NDF and ADF according to Van Soest et al. (1991). During the final day of collection period, rumen fluid and blood samples were collected at 0, 2, 4, and 6-h post- feeding. Rumen fluid pH was immediately measured for pH (HANNA Instrument HI 8424 microcomputer, Singapore), and then divided into four aliquots. A subsample was mixed with 5 ml of 1 M H2SO4 to stop fermentation process of microbial activity and centrifuged at 16,000 x g for 15 minute. About 20-30 ml of supernatant were collected and frozen at 20 C until analyzed in the laboratory and to determine NH3-N analysis using Kjeldahl methods (AOAC, 1990); whereas, rumen volatile fatty acid (VFA) were determined using high-pressure liquid chromatography (HPLC, Instruments by Water and Novapak model 600E; water mode l484 UV detector; column novapak C18; column size 3.9 mm A- 300 mm; mobile phase10 mM H2PO4 [pH 2.5]) according to the method of Samuel et al. (1997). Remaining aliquots were determined for direct count of protozoa, and fungal zoospores according to the methods described by Galyean (1989) using a haemocytometer (Boeco, Singapore), and three groups of bacteria (cellulolytic, proteolytic, and amylolytic bacteria) were determined using roll-tube technique (Hungate, 1969).A 10 ml blood sample was drawn from the jugular vein, plasma was harvested by centrifugation at5,000A-g for 10 min and store at -20C until further analysis. Plasma urea nitrogen (BUN) was determined according to the method of Crocker (1967).

Rumen microbial population analysis: Community DNA was extracted from 0.5 g of rumen fluid and digesta by the repeated bead beating plus column (RBB+C) method (Yu and Morrison, 2004), which was shown to significantly increased in DNA yields. The quality and quantity of these DNA samples were also determined by agarose gel electrophoresis and spectrophotometry.To establish a quantitative assay, the target 16s rDNA of each species was amplified using specific primers; the purified DNA was quantified by spectrophotometer with multiple dilutions. The target DNA was quantified by using serial ten-fold dilutions from 103 to 109 DNA copies of the previously quantified DNA standards. Real-time PCR amplification and detection were performed in a Chromo 4 system (Bio- Rad, USA). All primer set sequences (forward and reverse primers) are shown in Table 6.

Statistical analysis: Data were analyzed according to a4x4 Latin square design using Proc GLM/Proc Mix(SAS, 1996). Data were analyzed using the model Yijk=+Mi+Aj+Pk+eijk where Yijk is the observation from animal j, receiving diet i, in period k; , the overall mean; Mi, effect of treatment (i=1 to 4); Aj, the effect of animal (j=1 to 4); Pk, the effect of period (k=1 to 4); and eijk, the residual effect. Treatment means were statistically compared by Duncan's New Multiple Range Test (Steel et al., 1997). Differences among means with Pless than 0.05 were accepted as representing statistically significant differences.RESULTS

Feed intake and nutrient digestibility: Feed intake and nutrient digestibility were affected by the CAP and/or MPP supplementation (Table 2). Total feed intake, intake of rice straw and digestibility of DM, OM, and CP were not affected (Pgreater than 0.05) by feed supplementation. However, fiber digestibility (NDF, ADF) was increased (Pless than 0.05) after supplementation. CAMP supplementation resulted in higher NDF and ADF digestibility as compared to the control treatment (Pless than 0.05).

Rumen fermentation and blood metabolites: Table 3

supplementation on blood urea nitrogen (BUN), pH and temperature in swamp buffalo which were not statistically different among treatments (Pgreater than 0.05). Whereas, NH3-N was increased (Pless than 0.05) by CAMP supplemented when compared to control group.Total rumen VFA concentration and butyric acid were not influenced by dietary treatments (Pgreater than 0.05; Table3). The concentration of acetic acid was decreased whereas propionic acid was increased (Pless than 0.05) by thesupplementation compared to control group. Furthermore, CH4 was decreased (Pless than 0.05) as result of supplemented group compared to the control group.

Table 1. Feed ingredient and chemical compositions of concentrate, Centella asiatica powder, mangosteen peel powder and rice straw

Experimental diets

###Con-###CAP MPP RS

Item###Centrate

###Cassava chip###64.9

Rice bran###13.6

Brewer's grain###5.9

Palm kernel meal###8.3

Urea###3

Molasses###1.5

Salt###0.5

Sulfur###0.3

Tallow###1

Mineral mix###1

Chemical composition

Dry matter, %###91.2###88.5 93.1###90.5

dry matter

Organic matter###92.5###80.7 96.3###88.9

Crude protein###14.1###12.4 15.3###2.7

Neutral detergent fiber###28.9###33.0 60.6###84.1

Acid detergent fiber###11.5###25.3 55.9###44.9

Condensed tannin###-###12.1 17.7###-

Table 2. Effect of Centella asiatica powder and mangosteen peel powder supplementation on voluntary feed intake

###and nutrient digestibility

Items###Control###CAP###MPP###CAMP###SEM###P-Values

Total DM intake,

###Kg###5.8###5.9###5.8###5.8###0.11###0.84

###%BW###1.7###1.7###1.7###1.7###0.23###0.50

###g kg-1BW0.75###71.8###73.2###73.9###72.4###1.21###0.65

Rice straw intake,

###Kg###4.8###4.9###4.8###4.8###0.10###0.83

###%BW###1.4###1.4###1.4###1.4###0.03###0.50

###g kg-1BW0.75###58.8###60.2###61.0###59.4###1.21###0.63

Apparent digestibility, %

###Dry matter###60.3###63.8###63.6###65.3###1.76###0.33

###Organic matter###64.5###67.7###67.0###68.7###1.61###0.37

###Crude protein###67.1###68.9###65.7###67.6###3.53###0.93

###Neutral detergent fiber###42.3a###49.2b###50.2bc###53.2c###1.12###0.001

###Acid detergent fiber###40.3a###46.6b###47.8b###51.1c###0.48###less than 0.0001

As shown in Table4, the protozoal population was decreased (Pless than 0.05) in the supplemented group compared to the control group. Supplementation with CAMP resulted in a higher zoospore population when compared to the control treatment. Populations of total bacteria and amylolytic bacteria were not affected by treatment supplementation (Pgreater than 0.05). Supplementation with MPP resulted in a higher population of cellulolytic bacteria compared to the control, CAP and CAMP treatments (Pless than 0.05). In contrast, the CAMP fed buffaloes resulted in a higher population of proteolytic bacteria compared with the control treatments (Pless than 0.05). Results of microbial population estimated by real-time PCR are presented in Table 4. It was found that F. succinogenes was increased (Pless than 0.05) in the CAP and CAMP supplementation compared with the control group. In contrast, CAMP supplementations reduced populations of protozoa (Pless than 0.05) compared to control group. Dietary supplementation did not affect on total bacteria, R. flavefaciens, or R. albus abundances (Pgreater than 0.05).

Nitrogen utilization and efficiency of microbial protein synthesis: Nitrogen intake was higher in buffalo supplemented with CAMP when compared with control (Pless than 0.05). Nitrogen absorption and retention were not different among treatments (Pgreater than 0.05). Microbial protein synthesis in terms of both quantity and efficiency were not affected by either CAP or MPP supplementation (Pgreater than 0.05; Table 5).

Table 3. Effect of Centella asiatica powder and mangosteen peel powder supplementation on blood urea nitrogen,

###ruminal pH, temperature, NH3-N concentration and volatile fatty acids (VFA)

Items###Control###CAP###MPP###CAMP###SEM###P-Values

Ruminal pH###6.5###6.5###6.6###6.6###0.03###0.87

Temperature###38.5###38.6###38.6###38.6###0.09###0.98

NH3-N, mg/dl###8.8a###9.5b###9.8b###9.9c###0.29###0.004

BUN, mg /dl###8.3###8.6###8.2###8.4###0.40###0.88

Total VFA, mmol/l###128.4###122.3###123.8###130.1###3.24###0.36

mol/100mol total VFA

Acetic acid###68.2a###64.1b###66.2ab###62.2b###1.10###0.04

Propionic acid###22.0a###26.1b###25.5b###28.6b###1.02###0.02

Butyric acid###9.8###9.8###8.3###9.1###0.65###0.41

CH4 productionA###28.6a###25.6b###26.1ab###23.8b###0.73###0.02

Table 4. Effect of Centella asiatica powder and mangosteen peel powder supplementation on microbial population

Items###Control###CAP###MPP###CAMP###SEM###P-Values

Direct count technique, cell/ml

Protozoa, A-105###3.6a###2.4ab###2.3ab###1.4b###0.42###0.05

Fungal zoospore, A-106###5.4###5.4###5.4###5.5###0.03###0.23

Grouping of bacteria, CFU/ ml

Total viable bacteria, x 108###5.5###4.5###62.3###5.7###0.67###0.40

Cellulolytic bacteria, x 108###3.5a###3.7a###6.2b###4.2a###0.57###0.05

Proteolytic bacteria, x 107###4.3a###5.3ab###4.9ab###6.6b###0.56###0.05

Amylolytic bacteria, x 107###6.3###8.2###8.1###6.4###1.07###0.48

Real-time PCR technique,

Copies/ml of rumen content

###Total bacteria, A-109###3.88###4.07###3.45###3.76###0.38###0.72

###Protozoa, A-106###2.67a###2.19ab###2.20ab###1.92b###0.17###0.05

###F.succinogenes, A-106###2.61a###2.94b###2.77ab###2.91b###0.08###0.07

###R.flavefaciens, A-106###1.96###2.04###2.12###2.06###0.16###0.91

###R.albus, A-106###1.73###1.84###1.90###1.73###0.05###0.12

Table 5. Effect of Centella asiatica powder and mangosteen peel powder supplementation on nitrogen balance

###and microbial protein synthesis

Items###Control###CAP###MPP###CAMP###SEM###P-Values

Nitrogen balance, g/d

Nitrogen intake###46.6a###49.5ab###48.9a###52.2b###0.82###0.02

Fecal nitrogen###23.4###23.7###25.0###25.2###1.96###0.87

Urinal nitrogen###10.6###11.2###10.4###11.4###1.31###0.93

Nitrogen absorbed###23.2###25.8###23.9###26.9###1.46###0.34

Nitrogen retained###12.7###14.6###13.6###15.6###2.48###0.86

Microbial protein synthesis

PD excreted, mmol/d###25.5###27.2###26.1###27.2###0.64###0.26

PD absroped, mmol/d###77.6###90.9###85.5###92.6###5.29###0.28

Microbial nitrogen supply, gN/d###56.4###66.1###62.2###67.3###3.85###0.28

EMPS, gN/kg OMDR###25.8###29.6###29.1###30.8###2.08###0.44

Table 6. PCR primer sets for real-time PCR

Target species###Primer sequence###

Total bacteriaA###5-CGGCAACGAGCGCAACCC-3###

###5 CCATTGTAGCACG TGTGTA GCC-3

ProtozoaC###5'-GCTTTCGWTGGTAGTGT TT-3'###

###5'-ACTTGCCCTCYAATCGTWCT-3'###

F.succinogenesA###5-GTTCGGAATTACTGGGCGTAAA-3

###5-CGCCTGCCCCTGAACTATC-3

R.flavafaciensA###5-###

###CGAACGGAGATAATTTGAGTTTACTT###

###AGG-3###

###5-###

###CGGTCTCTGTATGTTATGAGGTATTA###

###CC-3###

R.albusB###5-CCCTAAAAGCAGTCTTAGTTCG-3###

###5-CCTCCTTGCGGTTAGAACA-3###

DISCUSSION

Feed intake and nutrient digestibility: Although feed intake was not affected by feed supplementation, fiber digestion was changed by either CAMP or control supplementation. Beauchemin et al. (2007) reported that adding 2% quebracho tannin extract to the diet had no effect on either DM or NDF digestibility in cattle. However, other authors have found that feeding high levels of dietary saponins and/or tannins decreased apparent digestibility (Poungchompu et al., 2009). The present study may suggest that selective suppression of cellulolytic bacteria by saponins and tannins did occur as reported by McSweeney et al. (2001a). Moreover, this variable effect could be due to the type and concentration of saponins and tannins containing in the plants. The mangosteen peel powder used in this study contained17.7%, and 12.3% DM of condensed tannins and saponins, respectively, and was similar to the study of Kanpukdee and Wanapat (2008).

Rumen fermentation and blood metabolites: There were no effects of Centella asiatica powder and mangosteen peel powder supplementation on ruminal pH and temperature (Pgreater than 0.05). However, ruminal pH and temperature were in the normal range at 6.5-6.6 and 38.5-38.6oC, respectively. Ruminal NH3-N and BUN values, as influenced by supplementation group, were in normalranges, in which these values were reported for optimal microbial digestion of fiber and protein (Wanapat, 1990). According to numerous reports, the optimal level of ruminal ammonia nitrogen concentration for efficientdigestion is from 5.0 to 25.0 mg/dl (Preston and Leng,1990) and 15 to 30 mg/dl (Wanapat and Pimpa, 1999). Changes in the dietary factors will alter NH3 concentration in the rumen (Arskov, 1982). Preston (1996) suggested that the quantity of ammonia absorbed from the rumen was reflected in circulating BUN. Earlier studies (Poungchompu et al., 2009; Pilajun and Wanapa,2011) found that NH3-N concentration in the rumen of swamp buffalo were affected by MPP supplementation, which was similar to the data found in the present study. Moreover, Pilajun and Wanapat (2011) stated that 8% supplementation of coconut oil mixed with MPP decreased NH3-N concentration by depressing of protein degradation. Bach et al. (2005) reported that an elevated concentration of blood ureanitrogen could affect from ruminal ammonianitrogen concentration because up to50% of ammonianitrogen produced from rumen fermentation was absorbed into the blood via the rumen wall and influenced on ureanitrogen concentration. Although concentration of ammonianitrogen is directly affected by protein degradation, it also can fluctuate by assimilation of rumen microbes (Atasoglu et al., 1998).Although contradictory findings can be found in the literature, it has been reported that rumen NH3-N concentration was not affected by any of the followings: dietary condensed tannin intake (Perez-Maldonado and Norton, 1996), Mangosteen peel powder (Kanpukdee and Wanapat, 2008), and soapberry fruit-mangosteen peel pellet (Poungchompu et al., 2009). However, addition of ethanol extract from soapnut (Sapindus mukorossi) onto in vitro rumen fermentation of feed in buffalo rumen liquor decreased NH3-N concentration (Kamra et al.,2006). Moreover, Grobner et al. (1982) found a reductionof ammonia concentration when saponins were included at 60 mg/kg in the incubation medium. Condensed tannin in the diet has beneficial effects which are mediated by protein-tannin complexation, decreasing availability of feed protein for ruminal degradation and ammonia nitrogen release (Makkar, 2003).There were no significant differences (Pgreater than 0.05) on TVFAs production and proportions of butyric acid among treatments. The concentration of propionic acid was signicantly increased, while proportion of acetic acid was decreased by supplementation with saponin rich tropical fruit (Poungchompu et al., 2009). This finding agrees with previous in vitro study (Norapoke et al., unpublished) in which CAP and MPP supplementation decreased ruminal acetic acid proportion, whilst increased propionic acid proportion. It is likely that in studies with defaunation resulted in increased propionate concentration (like the present experiment), the defaunating agent inhibited bacteria and protozoa that are not involved in propionate production, thus indirectly promoted the growth of species such as S. ruminantium that are central to propionic acid production in the rumen. However, Macheboeuf et al. (2008) reported that dose- response effects of different essential oil on methane inhibition and VFA production. However, Ngamsaeng et al. (2006) found no significant effects of MPP feeding level on either total VFA or individual VFA concentration. Moreover, cattle fed on forage-based diet supplemented with quebracho tannin extract did not exhibit a changed proportion of propionic acid, although acetic acid percentage was linearly decreased (Beauchemin et al., 2007). As reported by Arskov (1987) that propionate was an essential glucogenic compound and synthezed via gluconeogenesis in the liver of the ruminants. The expected shift in the VFA profile from acetate to propionate was associated with an increased fiber digestion.Calculated methane production by using volatile fatty acid as a variable and was different among treatments. Moreover, Moss et al. (2000) reported that prediction of methane production by using proportion of volatile fatty acid could elucidate the changing of hydrogen itinerary in rumen ecology. Supplementation with CAMP reduced estimated CH4 production which is in agreement with our previous in vitro study (Norapoke et al. unpublished) and other study (Kongmun et al.,2009). The results were also in agreement withBeauchemin et al. (2007) who also failed to reduce enteric methane emission from growing cattle by feeding the dietary DM as quebracho tannin extract. In addition, methane emission was decreased by mangosteen peel and soapberry fruit pellet supplementation (Poungchompu et al., 2009) in a dairy heifer diet. McAllister et al. (2005) reported that condensed tannins extracted from different plants vary greatly in their capacity to bind carbohydrates and proteins. Thus, it is possible that MPP tannin is a less effective methane suppressant than other condensed tannin sources. Nevertheless, the methane suppressing- effects of saponins were presumably a direct action against rumen microbes involved in methane formation including methanogens and protozoa (Sliwinski et al.,2002b). Tavendale et al. (2005) suggested two mechanisms whereby condensed tannins reduced methane emission from ruminants: indirectly through a reduction in fiber digestion, which decreases hydrogen production, and directly through an inhibition of the growth of methanogens. Previous studies have reported that feeding condensed tannin-containing plants to ruminants reduced methane emission (Puchala et al.,2005). Moreover, Guo et al. (2008) concluded that saponins appeared to reduce methane production by inhibiting protozoa and presumably lowering methanogenic activity of protozoal-associated methanogens. The lack of methane reduction in the present study could be due to either plant species and/orthe quantity that the animals received; likewise, thecalculated methane production may not be accurate due to the tannins and saponins having a direct toxic effect on methanogens as mention before.

Rumen microorganism population: Ruminal protozoa count was reduced when CAMP was supplemented at 50 g/kg of dry matter intake. The general mode of action of tannins and saponins on microorganisms is their interaction with the sterol moiety, which is present in the membrane of protozoa (Ando et al., 2003). In addition, ruminal protozoa counts were reduced through the addition of either CAP or MPP in agreement with earlier in vivo study (Kongmun et al., 2009). On the other hand, Poungchompu et al. (2009) found that populations of protozoa and fungi were dramatically decreased when dairy heifers were fed with plants containing condensed tannins and saponins. Moreover, the ethanol extract of soapnut (Sapindus mukorossi) seed pulp completely inhibited in vitro methane emission along with a significant reduction in protozoa count (Agarwal et al.,2006). The sensitivity of protozoa towards plant secondary compounds may be explained by the presence of sterols in cell membranes (Newbold et al., 1997). However, as suggested by Williams and Coleman (1992), the effect of defaunation on propionate concentration is likely not to be a direct effect of decreasing protozoal counts, but an indirect effect of the defaunating agent on ruminal bacteria.The population of fungal zoospores was not affected by CAP, MPP or CAMP supplementation. In contrast, the number of fungal zoospores was decreased by soapberry fruit-mangosteen peel pellet supplementation in dairy heifers (Poungchompu et al.,2009). Protozoa and methanogens interact with each other, including extracellular adhesion and intracellular symbiosis (Ushida and Jouany, 1996), whether inside or outside of protozoa. Methanogens serve as scavengers removing the hydrogen produced by protozoa and ruminal fungi have been related to fiber digestion (Bauchop, 1979) which leads to hydrogen production for methanogenesis. Thus, reduction of the protozoal population could be a cause of the decreasing fungal population due to the lack of an electron sink.A previous in vitro study (Norapoke et al., unpublished) found that numbers of total bacteria were increased by MPP supplementation. However, that was not shown in the present study. This could be due to the differences in methodology used to determine total bacteria population. The roll-tube technique used in this study was able to investigate only bacteria that can grow in in vitro. Proteolytic bacteria was increased by CAMP supplementation which may be related to the increase of NH3-N concentration in the rumen. Hungate (1966) reported that microbes in the rumen, especially bacteria, are the primary influence on feed digestion of host ruminants. Although either CAP or CAMP supplementation by themselves did not affect on cellulolytic bacteria, a combination of CAP and MPP could improve digestibility of swamp buffalo. However, McSweeney et al. (2001a) found that cellulolytic bacteria in the rumen of sheep was depressed by the condensed tannins presented in calliandra (Calliandra calothyrsus). A reduction in the cellulolytic bacteria population could be explained by direct inhibition of the micro-organisms through tannin interactions with the cell wall and secreted catabolic enzymes (Jones et al., 1994), and/or by reduced substrate availability due to complexing of tannin with nutrients. The absence of any effect in this study may be due to adaptation of the microbes by alteration in the feeds (Makkar, 2003). Similar to in vitro studies, the results have also demonstrated that some rumen bacteria have developed mechanisms to prevent these specific interactions (tannin tolerance) (Jones et al., 1994). As the results showed, the population of protozoa was lowest in CAMP supplementation, while total bacteria, R.flavefaciens and R.albus were not affected. Similarly to Poungchompu et al. (2009) who reported that MPP and soapberry fruit remarkably reduced rumen protozoas. Moreover, plants containing tannins could reduce protozoas as reported by Bhatta et al. (2009). In addition, this study agreed with Chen and Weimer (2001) who reported that the most predominant species of cellulolytic bacteria in the rumen was F. succinogenes.

N utilization and efficiency of microbial protein synthesis: Effect of CAP and MPP in swamp buffaloes on N utilization is shown differently among treatments in terms of N intake, while no differences were found on N urine, N feces, N absorption, N retention and total N excretion (Table 5). Although microbial populations were changed by feed supplementation, nitrogen balance and microbial protein synthesis were not different among treatments. McSweeney et al. (2001a) also reported that supplementation with the tropical forage calliandra which is rich in condensed tannins did not change microbial protein synthesis in the rumen of sheep. Similar results were reported by McNeill et al. (1998) who found that microbial flow from the rumen was not inhibited by tannins in Leucaena leucocephala (7.3% condensed tannin). However, Makkar et al. (1995d) has shown in vitro that tannins can either reduce or increase the efficiency of microbial protein synthesis. It may be the reason that the in vivo situation can not mimick or the effects are too small to be detected in animal studies. In addition, the absence of an effect of feed addition on microbial protein synthesis may have resulted from higher recycling of plasma PD than in cattle (Pimpa et al., 2003) which is one of the nitrogen conservation systems of ruminants.

Conclusions: Supplementation of CAMP resulted in increased propionic acid concentration. The protozoal population was dramatically decreased with dietary supplementation, while fungal zoospore numbers and proteolytic bacteria were also increased when CAMP was supplemented. CAP and MPP have specic effect on rumen fermentation however; combination of the sources significantly further improved rumen fermentation by enhancing on microbial fermentation, population and nutrient digestibilities while mitigating rumen methane emission in the rumen of swamp buffalo when fed with rice straw.

Acknowledgements: The authors would like to express their most sincere thanks to the Tropical Feed Resources Research and Development Center (TROFREC), Department of Animal Science, Faculty of Agriculture, Agricultural Development Research Center-Northeast, Khon Kean University, Thailand, for their kind financial support, experimental animals, laboratory and the use of research facilities. The Ph.D scholarship provided to the first author under the Thailand Research Fund (TRF) through the Royal Golden Jubilee PhD Program is sincerely appreciated. In addition, thanks are extended to the Agricultural Biotechnology Research Center, KhonKaen University for the permission to perform real-timePCR analysis and for technical support.

REFERENCES

Agarwal, N., D.N. Kamra, L.C. Chaudhary and A.K.Patra (2006). Effect of Sapindus mukorossi extracts on in vitro methanogenesis and fermentation characteristics in buffalo rumen liquor. J. Appl. Anim. Res. 30: 14.Ando, A., T. Nishida, M. Ishida, K. Hosoda and E.Bayaru (2003). Effect of peppermint feeding on the digestibility, ruminal fermentation and protozoa. Livest. Prod. Sci. 82: 245-248.AOAC (1990). Official Method of Analysis, 15th edn.Animal Feeds: Association of OfficialAnalytical Chemists, Virginia, USA. p. 118. Atasoglu, C., C.N. Valdes, D.C. Walker, J. Newbold andR.J. Wallace (1998). De novo synthesis of amino acids by the ruminal bacteria Prevotella bryantii B14, Selenomonas ruminantium HD4, and Streptococcus bovis ES1. Appl. Environ. Microbiol. 64: 2836-2843.Bach, A., S. Calsamiglia and M.D. Stern (2005).Nitrogen metabolism in the rumen. J. Dairy Sci.88: E9-E21.Bauchop, T. (1979). Rumen anaerobic fungi of cattle and sheep. Appl. Environ. Microbiol. 38: 148-158.Beauchemin, K.A. and S.M McGinn (2006). Methane emissions from beef cattle: effect of fumaric acid, essential oil, and canola oil. J. Anim. Sci.84: 1489-1496.Beauchemin, K.A., S.M. McGinn, T.F. Martinez and T.A. McAllister (2007). Use of condensed tannin extract from quebracho trees to reduce methane emissions from cattle. J. Anim. Sci. 85:1990-1996.Bhatta, R., Y. Uyeno, K. Tajima, A. Takenaka, Y.Yabumoto, I. Nonaka, O. Enishi and M. Kurihara (2009). Difference in the nature of tannins on in vitro ruminal methane and volatile fatty acid production and on methanogenic archaea and protozoal populations. J. Dairy Sci.92: 5512-5522.Chen, J. and J.P. Weimer (2001). Competition among three predominant ruminal cellulolytic bacteria in the absence or presence of non-cellulolytic bacteria. Microb 147: 21-30.Crocker, C.L. (1967). Rapid determination of urea nitrogen in serum or plasma without deproteinization. Am. J. Med. Tech. 33: 361-365.Denman, S.E. and C.S. McSweeney (2006). Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 58: 572582.Devkota, A., S. Dall'Acqua, S. Comai, G. Innocenti and P.K. Jha (2010). Centella asiatica (L.) urban from Nepal: Quali-quantitative analysis of samples from several sites and selection of high terpene containing populations of cultivation. Biochem. Sys. Eco.38: 12-22.Dhar, M.L., M.M. Dhar, B.N. Dhavan, B.N. Mehrotra and C. Ray (1968). Screening of indian medicinal plants for biological activity, Indian. J. Exper. Biol. 6: 232.Galyean, M. (1989). Laboratory Procedure in Animal Nutrition Research. Department of Animal and Life Science. New Mexico State University, U.S.A.Grainger, C., M.J. Auldist, T. Clarke, K.A. Beauchemin, S.M. McGinn, M.C. Hannah, R.J. Eckard and L.B. Lowe (2008). Use of monensin controlled- release capsules to reduce methane emissions and improve milk production of dairy cows offered pasture supplemented with grain. J. Dairy Sci. 91: 11591165.Grobner, M.A., D.E. Johnson, S.R. Goodall and D.A.Benz (1982). Sarsaponin effects on in vitro continuous flow fermentation of a high grain diet. J. Anim. Sci. 55: 491497.Guo, Y.Q., J.X. Liu, Y. Lu, W.Y. Zhu, S.E. Denman and C.S. McSweeney (2008). Effect of tea saponin on methanogenesis, microbial community structure and expression of mcrA gene, in cultures of rumen micro-organisms. Lett. Appl. Microbiol. 47: 421-426.Hook, S.E., K.S. Northwood, A.D. Wright and B.W.McBride (2009). Long-term monensin supplementation does not significantly affect the quantity or diversity of methanogens in the rumen of the lactating dairy cow. Appl. Environ. Microbiol. 75: 374-380.Hungate, R. E. (1966). The rumen and its microbes.Academic Press. New York and London. 533 p. Hungate, R.E. (1969). A Roll Tube Method forCultivation of Strict Anaerobes, In: Methods in Microbiology. Eds., Norris, I. R., and E. W. Ribbons. Academic Press, New York, 3: 117132.Johnson, K.A. and D.E. Johnson (1995). Methane emissions from cattle. J. Anim. Sci. 73: 24832492.Jones, G.A., T.A. McAllister, K.J. Cheng and A.D. Muir (1994). Effect of sainfoin (Onobrychis viciifolia Scop) on growth and proteolysis by 4 strains of rumen bacteria: resistance of Prevotella (Bacteroides) ruminicola B14. Appl. Environ. Microbiol. 60: 1374-1378.Kamra, D.N., N. Agarwal and L.C. Chaudhary (2006).Inhibition of ruminal methanogenesis by tropical plants containing secondary compounds. Int. Cong. Ser 1293: 156163.Kanpukdee, S. and M. Wanapat (2008). Effects of mangosteen (Garcinia mangostana) peel and sunflower and coconut oil supplementation on rumen fermentation, milk yield and milk composition in lactating dairy cows. Livest. Res. Rur. Devel. V. 20 supplement. From http://www.cipav.org.co/lrrd/lrrd20/supplement/ such2.htm.Koike, S. and Y. Kobayashi (2001). Development and use of competitive PCR assays for the rumen cellulolytic bacteri: Fibrobacter succinogenes, Ruminococus albus and Ruminococcus flavefaciens. FEMS Microbiol. Lett. 204: 361-366.Kongmun, P., M. Wanapat, N. Nontaso, T. Nishida and W. Angthong (2009). Effect of phytochemical and coconut oil supplementation on rumen ecology and methane production in ruminants. In: Proceedings of FAO/IAEA International Symposium on Sustainable Improvement of Animal Production and Health, 811 June 2009, Vienna, Austria, pp. 246247.Macheboeuf, D., D.P. Morgavi, Y. Papon, J.L. Mousset and M. Arturo-Schaan (2008). Dose-response effects of essential oils on in vitro fermentation activity of the rumen microbial population. Anim. Feed Sci. Technol. 145: 335-350.Makkar, H.P.S. (2003). Effects and fate of tannins in ruminant animals, adaptation to tannins, and strategies to overcome detrimental effects of feeding tannin rich feeds. Small Rum. Res. 49:241256.Makkar, H.P.S., N. Borowy, K. Becker and R. Degen (1995d). Some problems in fiber determination in tannin-rich forages. Anim. Feed Sci. Technol.55: 6776.Mamedov, N. (2005). Adaptogenic, geriatric, stimulant and antidepressant plants of Russian Far East. J. Cell. Molacul. Biol. 4: 71-75.McAllister, T.A., T. Martinez, H.D. Bae, A.D. Muir, L.J.Yanke and G.A. Gones (2005). Characterization of condensed tannins purified from legume forages: Chromophore production, protein precipitation and inhibitory effects on cellulose digestion. J. Chem Ecol. 31: 20492068.McNeill, D.M., N. Osborne, M. Komolong and D.Nankervis (1998). Condensed tannins in the Leucaena genus and their nutritional significance for ruminants. In: Shelton, H. M., Gutteridge, R. C., Mullin, B. F., Bray, R. A. (Eds.), Leucaena-Adaptation, Quality and Farming Systems. ACIAR Proceedings. 86: 205-214.McSweeney, C.S., B. Palmer, R. Bunch and D.O. Krause (2001a). Effect of the tropical forage calliandra on microbial protein synthesis and ecology in the rumen. J. Appl. Microb. 90: 78-88.Moss, A.R., J.P. Jouany and J. Newbold (2000). Methane production by ruminants: its contribution to global warming. Ann. Zootech. 49: 231-253.Newbold, C.J., S.M. Hassan, J. Wang, M.E. Ortega and R.J. Wallace (1997). Influence of foliage from African multipurpose trees on activity of rumen protozoa and bacteria. British J. Nutri. 78: 237249.Ngamsaeng, A. and M. Wanapat (2006). Effect of mangosteen peel (Garcinia mangostana) supplementation on rumen ecology, microbial protein synthesis, digestibility and voluntary feed intake in beef steers. Pakist. J.Nutri. 5: 445-452.Arskov, E.R. (1982). Protein Nutrition in Ruminants.Academic Press, New York, USA. 160 p. Arskov, E.R. (1987). Feeding of Ruminant Livestock,Principle and Practice. Chalcombe Publications, Marlow, England. p. 90.Oyedeji, O.A. and A.J. Afolayan (2005). Chemical composition and antibacterial activity of theessential oil of centella asiatica growing inSouth Africa. Pharm. Biol. 43: 249-252.Perez-Maldonado, R.A. and B.W. Norton (1996). The effects of condensed tannins from Desmodium intorturn and Calliandra calothyrsus on protein and carbohydrate digestion in sheep and goats. British J. Nutri. 76: 515-533.Pilajun, R. and M. Wanapat (2011). Effect of coconut oil and mangosteen peel supplementation on ruminal fermentation, microbial population, and microbial protein synthesis in swamp buffaloes. Livest. Sci. doi:10.1016/j.livsci.2011.05.013.Pimpa, O., J.B. Liang, J. Balcells, Z.A. Jelan and N.Abdullah (2003). Urinary purine derivative excretion in swamp buffaloes after duodenal purine base infusion. Anim. Feed Sci. Technol.104: 191199.Poungchompu, O., M. Wanapat, C. Wachirapakorn, S.Wanapat and A. Cherdthong (2009). Manipulation of ruminal fermentation and methane production by dietary saponins from mangosteen peel and soapberry fruit. J. Agricul. Sci. 63: 389-400.Preston, R.L. (1996). Protein requirements for growing- finishing cattle and lamps. J. Anim. Nutri. 90:157-160.Preston, R.L. and R.A. Leng (1990). Effect of supplementation with protein meal on the growth of cattle given a basal diet of untreated or ammoniated rice straw. Asian-Aust. J. Anim. Sci. 3: 269-279.Puchala, R., B.R. Min, A.L. Goetsch and T. Sahlu (2005).The effect of a condensed tannin-containing forage on methane emission by goats. J. Anim. Sci. 83: 182-186.Samuel, M., S. Sagathewan, J. Thomas and G. Mathen (1997). An HPLC method for estimation of volatile fatty acids of ruminal fluid. Indian J.Anim. Sci. 67: 805-807.SAS (1996). User's Guide: Statistic, Version 5. Edition.,1996. SAS. Inst Cary, NC., U.S.A.Sliwinski, B.J., C.R. Solvia, A. Machmuller and M.Kreuzer (2002b). Efficacy of plant extracts rich in secondary constituents to modify rumen fermentation. Anim. Feed Sci. Technol. 101:101114.Steel, R.G.D., J. H. Torrie and D. A. Dickey (1997).Principles and Procedures of Statistics: A Biometrical Approach (3rd Ed.). McGraw-Hill Inc., New York, U.S.Sylvester, J.T. S.K.R. Karnati, Y. Zhongtang, M.Morrison and J. L. Firkins (2004). Development of an assay to quantify rumen ciliate protozoal biomass in cows using real-time PCR. J. Nutr.134: 33783384.Tavendale, M.H., L.P. Meagher, D. Pacheco, N. Walker, G.T. Attwood and S. Sivakumaran (2005). Methane production from in vitro rumen incubations with Lotus pedunculatus and Medicago sativa, and effects of extractable condensed tannin fractions on methanogenesis. Anim. Feed Sci. Technol. 123124: 403419.Thorpe, A. (2009). Enteric fermentation and ruminant eructation: the role (and control) of methane in the climate change debate. Springer, Berlin, The Netherlands. 93: 3-4.Ushida, K. and J.P. Jouany (1996). Methane production associated with rumen ciliate protozoa and its effect on protozoa activity. Lett. Appl. Microbiol. 23: 129132.Van Soest, P.J., J.B. Robertson and B.A. Lewis (1991).Methods for dietary fiber neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74: 3583-3597.Wanapat, M. and O. Pimpa (1999). Effect of ruminal NH3-N level on ruminal fermentation, Purine derivatives, digest digestibility and rice straw intake in swamp buffaloes. Asian-Aust. J. Anim. Sci. 12: 904-907.Williams, A.G. and G.S. Coleman (1992). The Rumen Protozoa. Springer-verlag New York, Inc. New York, NY. USA.Yu, Z. and M. Morrison (2004). Improved extraction of PCR-quality community DNA from digesta and fecal samples. Bio Techniques. 36: 808812.
COPYRIGHT 2014 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Animal and Plant Sciences
Date:Apr 30, 2014
Words:6467
Previous Article:EFFECTS OF FEEDING BOVINE RUMEN CONTENT-BLOOD MEAL (50:50) MIXTURES ON PERFORMANCE AND SLAUGHTER CHARACTERISTICS OF GROWING RABBITS.
Next Article:CHANGES OF THYROID HORMONES IN DIFFERENT PHYSIOLOGICAL PERIODS IN WHITE GOATS.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |