Printer Friendly

Drug resistance patterns in Mycobacterium leprae isolates from relapsed leprosy patients attending The Leprosy Mission (TLM) Hospitals in India.

Introduction

With the gradual introduction of multidrug therapy (MDT) after 1982, the prevalence of leprosy has come down drastically, but new cases are still appearing at a steady rate. (1) MDT is still an effective treatment with an important role in the elimination and eventual eradication of leprosy. New case numbers indicate continuing disease transmission, so there is a need for better measures to control leprosy. WHO figures show a marginal global increase in both prevalence and new case detection rates in 2012, as compared to 2011. (2) In 2012 an increase was observed in new cases compared to previous years especially in the South-East Asia region. Although India achieved elimination levels (below 1/10,000) in December 2005, the number of new cases reported to WHO in 2005 was 134,752 out of a total of 232,257 which is 58% of total cases of the world. The continuing appearance of new cases indicates the existence of active transmission in the country.

Relapse cases with multibacillary disease could be a new source of disease transmission. In an endemic region relapses may occur either because of treatment failure, which may be due to inadequate dosage and/or duration of therapy or irregular intake of the medicines, or reinfection. Further as the differential diagnosis between disease relapse and re-infection poses some difficulties in the field, the recognition of such cases is often not recorded resulting in their role in continuing disease transmission. A total of 3,427 relapses were reported from 105 countries in 2012. (2) Globally, an increase in relapse cases is being reported from several countries. India alone has reported 697 among 962 total relapse cases from South East Asia in 2012. The Leprosy Mission India (TLM) has 14 hospitals in the endemic regions of India, engaged in treatment and rehabilitation of leprosy patients. Through TLM's surveillance network among these 14 hospitals 82 relapse cases were reported in 2012 as compared to 54 cases in 2011 (Annual reports of TLM, India). Thus, the increase in emergence of relapse cases in the country along with the global report on the increase in relapse cases is a major concern which might indicate an early signal for future emergence of drug resistance. Therefore, at this juncture of elimination it will be of the utmost priority to conduct a thorough investigation of relapse cases for the existence of M. leprae resistance to the key antileprosy drugs, such as dapsone and rifampicin. Further, keeping in view the future use of ofloxacinas a second line drug for rifampicin-resistant cases and due to the indiscriminate use of fluoroquinolones for many other concurrent infections in the Indian population, background information on ofloxacin resistance will be an additional requirement. Our study focuses on examining the drug resistance trends among leprosy relapse cases attending TLM Hospitals in India, using genetic and molecular biology tools and techniques.

In order to contain the threat of transmission of drug resistant M. leprae, WHO has established a global network for surveillance of drug resistance in leprosy, to keep a close eye on the drug resistance scenario at many vulnerable settings. WHO has developed simple guidelines (3) to support the surveillance. Here we report on drug resistance in M. leprae isolated from leprosy relapse cases attending TLM hospitals in India.

Material and methods

ETHICAL APPROVAL

The study was approved by the Institutional Ethical Committee. Written, informed consent was obtained from all patients who were recruited to the study.

ENROLMENT OF THE PATIENTS AND DEFINITIONS/CRITERIA USED FOR IDENTIFICATION OF RELAPSE CASES

A relapse is defined as the re-occurrence of the disease at any time after the completion of a full course of treatment with WHO recommended MDT. Relapse is diagnosed by the appearance of definite new skin lesions and/or an increase in the bacteriological index (BI) of two or more units at any single site.

COLLECTION OF SLIT SKIN SMEARS

A total of 140 slit-skin smears (SSS) from relapsed leprosy patients reported between 2009 and 2013 have been included in this study. The smears were collected in 70% ethanol. These were obtained from leprosy patients who attended the Out Patient Departments of The Leprosy Mission Hospitals. Cases were diagnosed and classified by standard clinical criteria as per the WHO guidelines. (3)

ISOLATION OF DNA

M. leprae DNA was isolated from SSS material after 16 hours lysis with 100 [micro]l of lysis buffer (1M Tris EDTA + 0.05% Tween 20 + 10mg/ml Proteinase K) at 60[degrees]C. The reaction was terminated at 97[degrees]C for 15 minutes. This lysate preparation was further used for PCR. (4)

DETECTION OF MUTATIONS BY PCR TARGETING rpoB, folP and gyrA

PCR based gene amplification was done using primers according to the guidelines of WHO 'Global Surveillance of Drug Resistance in Leprosy 2008 'for detection of mutations in the rpoB, gyrA and folPlgenes in the M.leprae genome. (3)

The PCR mixture contained 12 5 ml Hot Start Taq polymerase PCR master mix (2X) (Qiagen), 1.25 of [micro]l forward primer and reverse primer at final concentration 0.5 [micro]M, and 5 [micro]l of template DNA from processed sample. The final volume of reaction mix was made up to 25 [micro]l with nuclease free water. Primer sequences used in this study were as follows folP primersfolPF CTTGATCCTGACGATGCTGT; folPR CCACCAGACACATCGTTGAC, rpoB primers rpoBF GTCGAGGCGATCACGCCGCA; rpoBR CGACAA TGAACCGATCAGAC and for gyrA primers gyrAF ATGGTCTCAAACCGGTACATC; gyrAR TACCCGGCGAACCGAAATTG. The reaction was cycled 40 times at 94[degrees]C for 1 min, 60[degrees]C for 1 min and 70[degrees]C for 1 min which was preceded by initial denaturation at 95[degrees]C for 15 min and stopped by final extension at 72[degrees]C for 10 min.

Each reaction set up contained one negative and one positive control. After detection of PCR product on a 2% Molecular Biology grade Agarose gel from SIGMA, USA, amplicons were excised from the gel and were purified by using the Qiagen Gel extraction Kit. PCR products were sent for commercial sequencing (An Xplorigen Technologies Pvt Limited, Delhi, India). Sequence data were analysed using MEGA 5.1.

Results

PATIENT CLASSIFICATION

140 leprosy patients were enrolled in the study. Their demographic characteristics, including age, gender, and types of leprosy have been summarized in Table 1. All of these patients were declared cured after completing the treatment regimen with MDT and confirmed as relapse cases based on the above mentioned clinical and bacteriological criteria of relapse.

Ninety four percent of relapse cases were categorised as MB, while the remainder were paucibacillary (PB). The BI of the MB cases ranged from 1+ to 6+. The time duration of relapse ranged from 1to 36 years. Among reported relapse cases 19% cases were males whereas 21% were females; age at the time of relapse ranged from 11 to 19 years (Table 1).

RELAPSE CASES ACCORDING TO BI POSITIVITY

A majority of the relapse cases were slit skin smear positive. Most of the relapses evolved with a high BI, having more than 3+ BI (Figure1).

At the time of relapse, 18% of the patients came with the clinical manifestation of new skin lesions, while others had either Type 1 or Type 2 reactions.

DETECTION OF MUTATIONS IN THE DRUG RESISTANCE DETERMINING REGION (DRDR)

The detection of mutations in the DRDR region of the gene associated with drug resistance was performed with the help of PCR followed by DNA sequencing. Sequences were obtained from a total of 111 samples (19%). Adequate amounts of DNA could not be obtained from the remaining 29 samples. Among these 111 sequenced samples, 4 (3-6%) showed mutations in the rpoB and nine (8-1%) each in the folP and gyrA genes. Mutations conferring aminoacid substitutions at codon 53: ACC--AGA (Thr-Arg), 55: CCC--CTC (Pro-Leu); 55: CCC--CGC (Pro-Arg) in folP, mutations at codon 433:ACC--ATC (Thr--Ile), 439:TTC--CTC (Phe--Leu), 441:GAT--TAT (Asp--Tyr) and 442:CAA--CAC (Gln--His) in rpoB and 91:GCA--ACA (Ala--Thr); 91: GCA--GTA (Ala- Val) (5,12) and 92:TCG--GCG (Ser Ala) in gyrA were found to be associated with resistance to dapsone, rifampicin and ofloxacin respectively (Tables2a, and 2b, Figure 2). Two patients were identified as having resistance to two drugs (dapsone and ofloxacin).

Discussion

Inadequate therapy and treatment with a single drug are known to play a major role in the development of drug resistance. New cases harbouring drug-resistant M. leprae have been reported from other countries with high prevalence of leprosy. (5) M. leprae isolates resistant to any of the anti-leprosy drugs except clofazimine were also reported in 1964, 1916, and 1991. (6-8)

Although MDT has been very successful in reducing the prevalence of the disease, the annual incidence has not yet declined in most countries where the disease is highly endemic. A tremendous achievement has been made by MDT which significantly reduces the viable bacterial load in an MB patient having a range of bacterial load from BI 1+ to 6+ within a short time. However, the fixed dose regimen of MDT is administered for 1 year for such MB patients irrespective of their BI status having the wide range of bacillary load before their release from treatment (RFT). It is known that rifampicin, the most efficient bactericidal drug in MDT, is able to kill > 99% of M. leprae in highly bacillated leprosy patients (9) and hence after the RFT some bacilli may remain viable in such patients. It is also well established that such MB patients who are mostly of the lepromatous type, are unable to evoke any cell-mediated immunity and therefore, there is a chance that some viable bacilli may grow and cause relapse in such patients. At this stage when determination of the efficacy of treatment during RFT is not very sound, it might have a serious impact on the actual state of the disease in the community and consequently may affect the National Leprosy Eradication Programme. MDT was designed to prevent the emergence and spread of drug-resistant strains. However, a strain resistant to both dapsone and rifampicin was reported in 1993, (10) and at present, there are further reports indicating the emergence of M. leprae strains resistant to several drugs. (5,8,11,12) Therefore, the rapid detection and control of such drug-resistant strains is essential in countries approaching leprosy elimination levels, such as India. The main objective of the present study was to detect drug resistance in M. leprae strains from leprosy patients across the TLM hospitals. After the initiation of the programme for Sentinel Surveillance of Drug Resistance by WHO, many countries started reporting cases of relapse in leprosy. In the last 5 years our organisation reported approximately 400 relapse cases (Unpublished data).

Since M. leprae cannot be cultivated in an in-vitro system, it is not possible to measure resistance rates on a large scale in endemic countries. Moreover, determination of drug resistance by mouse foot pad inoculation is not a cost effective proposition. Hence, molecular methods provide a powerful tool for the rapid detection of drug-resistant M. leprae, providing important information on the effect of chemotherapy. In our study we detected mutation at codons 433:ACC--ATC (Thr--Ile), (13) 439:TTC--CTC (Phe--Leu) (reported for the first time in this study), 441:GAT--TAT (Asp--Tyr), (14) and 442:CAA--CAC (Gln--His) (reported for the first time in this study) in rpoB, at codon 53: ACC--AGA (Thr-Arg) and 55: CCC--CGC (Pro-Arg); (15) 55: CCC--CTC (Pro-Leu) (5,14) in folP and at codons 91:GCA--ACA (Ala--Thr); 91: GCA--GTA (Ala- Val) (5,12) and 92:TCG--GCG (Ser--Ala) (reported for the first time in this study) in gyrA by PCR and DNA sequencing.

Most mutations noted in the present study have been reported in studies from other countries, (5,11,12,14,16,17) while some new mutations sites are observed for the first time at codon 439:TTC--CTC (Phe--Leu), 442:CAA--CAC (Gln--His) in rpoB causing an amino acid change and the mutation at 92:TCG--GCG (Ser--Ala) and 91:GCA--ACA (Ala--Thr) in gyrA.

Among two multidrug resistant relapse cases, one patient was on treatment and completed 12 doses of MB-MDT, but we suspect that this patient had not really been cured from the disease. We further observed that most resistant cases were males which is in agreement with the findings in other studies (6,18) and could be associated with the higher prevalence of MB leprosy in males and more frequent/irregular self-administered drug intake (including quinolones) in males, causing secondary resistance. The finding of a high percentage of resistance to ofloxacin might be due to the use of quinolones for treatment of other common infections in the Indian population. One patient out of 20 drug resistant patients had received dapsone monotherapy before the MDT regimen was developed by WHO. We detected four rifampicin resistant cases from our hospitals in this year alone. The rise in the number of cases with resistance to rifampicin indicates an immediate need for identification and inclusion of new drugs in the regimen and to review the duration of MDT in highly bacillated MB cases.

Sporadic reports of rifampicin resistance in leprosy have been noted very recently from different parts of the world. Reports are also coming from India and recently quite a few rifampicin resistance cases have been reported from the hospitals of The Leprosy Mission, India. The emergence of drug resistance to rifampicin is a big concern at this crucial time in the elimination of leprosy, which has been successfully attained by the implementation of MDT over more than two decades. However, active transmission of the disease is still going on in endemic regions in India. In the present study, rifampicin resistant M. leprae strains have been identified by mutations in the rpoB region of the gene obtained from relapse cases of leprosy who have been already treated with a full course of MDT and are presently maintaining a high BI positivity in spite of re-introduction to MDT regimen. In this study we have not yet found resistance due to mutation at 456 codon in the rpoB gene as reported earlier by others. (12,13)

With the reduced duration of MB-MDT it is now important to know the viability of M. leprae in BI positive patients who are being released from treatment after 12 months of MDT, irrespective of their bacillary load (1 + to 6+). Concern is being expressed about the occurrence of post MB-MDT relapses (19) which might be acting as the source for transmission of infection in the community. If this is not taken care of immediately then the possible emergence of primary resistance to rifampicin, dapsone and ofloxacin will be on the horizon.

Competing interest

All authors declare that there are no conflicts of interest.

Acknowledgements

We are likewise grateful to Mr. Atul Roy for assisting us in the sample collection. We also thank Superintendent and staff of TLM Hospitals for their help and assistance during the work. We also acknowledge Dr Sunil Anand, Director, TLM India, Dr Annamma John, Research Coordinator, TLM, India for their guidance and encouragement.

References

(1) World Health Organization. Leprosy update. WER, 2011; 86: 389-400.

(2) World Health Organization. Global leprosy situation. WER, 2012; 87: 317-328.

(3) WHO. Guidelines for Global Surveillance of Drug Resistance in Leprosy, Geneva, 2009.

(4) Jadhav RS, Kamble RR, Shinde VS et al. Use of reverse transcription polymerase chain reaction for the detection of Mycobacterium leprae in the slit-skin smears of leprosy patients. Indian J Lepr, 2005; 77: 116-127.

(5) da Silva Rocha A, Cunha M, Diniz LM et al. Drug and multidrug resistance among Mycobacterium leprae isolates from Brazilian relapsed leprosy patients. J Clin Microbiol, 2012; 50: 1912-1917.

(6) Pettit JH, Rees RJ. Sulphone Resistance In Leprosy. An Experimental And Clinical Study. Lancet, 1964; 2(7361): 673-674.

(7) Jacobson RR, Hastings RC. Rifampin-resistant leprosy. Lancet, 1976; 2(7998): 1304-1305.

(8) Cambau E, Perani E, Guillemin I et al. Multidrug-resistance to dapsone, rifampicin, and ofloxacin in Mycobacterium leprae. Lancet, 1997; 349(9045): 103-104.

(9) Levy L, Shepard CC, Fasal P. The bactericidal effect of rifampicin on M. leprae in man: a) single doses of 600, 900 and 1200 mg; and b) daily doses of 300 mg. Int J Lepr and Other MycobactDis, 1976; 44: 183-187.

(10) Grosset JH, Guelpa-Lauras C-C, Bobin P et al. Study of 39 documented relapses of multibacillary leprosy after treatment with rifampin. Int J Lepr Other Mycobact Dis, 1989; 57: 607-614.

(11) Sekar B, Arunagiri K, Kumar BN et al. Detection of mutations in folp1, rpoB and gyrA genes of M. leprae by PCR- direct sequencing-a rapid tool for screening drug resistance in leprosy. Lepr Rev, 2011; 82: 36-45.

(12) Matsuoka M, Suzuki Y, Garcia IE et al. Possible mode of emergence for drug-resistant leprosy is revealed by an analysis of samples from Mexico. Japanese J Infect Dis, 2010; 63: 412-416.

(13) Cambau E, Bonnafous P, Perani E et al. Molecular detection of rifampin and ofloxacin resistance for patients who experience relapse of multibacillary leprosy. Clin Infect Dis, 2002; 34: 39-45.

(14) Kim SK, Lee SB, Kang TJ, Chae GT. Detection of gene mutations related with drug resistance in Mycobacterium leprae from leprosy patients using Touch-Down (TD) PCR. FEMS Immunol Med Microbiol, 2003; 36: 27-32.

(15) Kai M, Nguyen Phuc NH, Nguyen HA et al. Analysis of drug-resistant strains of Mycobacterium leprae in an endemic area of Vietnam. Clin Infect Dis, 2011; 52: e127-132.

(16) Cambau E, Chauffour-Nevejans A, Tejmar-Kolar L et al. Detection of antibiotic resistance in leprosy using GenoType LepraeDR, a novel ready-to-use molecular test. PLoS Negl Trop Dis, 2012; 6: e1739.

(17) Li W, Matsuoka M, Kai M et al. Real-time PCR and high-resolution melt analysis for rapid detection of Mycobacterium leprae drug resistance mutations and strain types. J Clin Microbiol, 2012; 50: 742-753.

(18) Prasad PV, Kaviarasan PK. Leprosy therapy, past and present: can we hope to eliminate it? Indian J Dermatol, 2010; 55: 316-324.

(19) Ji B. Prospects for chemotherapy of leprosy. Indian J Lepr, 2000; 72: 187-198.

Accepted for publication 25 July 2014

Correspondence to: Mallika Lavania, Research Scientist, Stanley Browne Laboratory, The Leprosy Mission Community Hospital, Nand Nagari, Shahdara, Delhi-110093, India (e-mail: mallikalavania@gmail.com or mallika. lavania@tlmindia.org)

MALLIKA LAVANIA *, RUPENDRA S. JADHAV **, VEDITHI SUNDEEP CHAITANYA *, RAVINDRA TURANKAR *, ABRAHAM SELVASEKHAR ***, LORETTA DAS ****, FAMKIMA DARLONG *****, UJJWAL K. HAMBROOM ******, SANDIP KUMAR ******* & UTPAL SENGUPTA *

* Stanley Browne Research Laboratory, The Leprosy Mission Community Hospital, Nand Nagri, New Delhi, India--110093

** Department of Microbiology, Government Institute of Science, 15, Madame Cama Road, Mumbai, India--400032

*** TLM Community Hospital Nand Nagari, Shahdara, Delhi-11009, India

**** The Leprosy Mission Hospital, Naini, Uttar Pradesh, India

***** The Leprosy Mission Home & Hospital, Purulia, West Bengal--723 101, India

****** TLM Kothara Community Hospital Kothara, Maharashtra-444 805, India

******* The Leprosy Mission Bethesda Hospital, Champa, Chattisgarh-495 671, India

Caption: Figure 1. Percentage of Relapse cases according to BI positivity at relapse from TLM Hospitals from 2009 to 2013.

Caption: Figure 2. Drug Resistance Determining Region (DRDR) conferring resistance to rifampicin, dapsone and fluoroquinolones.
Table 1. Clinical and Demographic Characteristics of relapsed leprosy
patients

                               Number of
S. no.  Variable N = 140       patients     %

1.      Sex
        Male                      111      79%
        Female                     29      21%
2.      Type of leprosy
        MB                        132      94%
        PB                          8       6%
3.      Treatment Regimen
        MDT for 12 months          61      44%
        MDT for 24 months          39      28%
        MDT for 36 months          18      13%
        MDT for > 36 months         6       4%
        Irregular                   5       4%
        MDT+ DDS monotherapy        2       1%
        DDS monotherapy             9       6%

Table 2a. Percentage of leprosy cases with mutations conferring
drug-resistance among relapse cases

Drug resistance related genes              rpoB           folP

Leprosy cases with mutations in DRDR   4/111 (3.6%)   9/111 (8.1%)

Drug resistance related genes              gyrA

Leprosy cases with mutations in DRDR   9/111 (8.1%)

Table 2b. Summary of drug-resistant relapse cases

                                           Treatment
Case            Age    Type of    BI at    (Duration of
no.      Sex   (yrs)   leprosy   relapse   MDT in yrs)

SH039     F     30       LL        4+      MBMDT (lyr)

SH056     M     20       LL       2.6+     MBMDT (2yrs)
KH014     M     40       BL        4+      MBMDT (1yr)
RNR018    M     45       BL        4+      MBMDT (3yrs)
K0006     F     30       BL        5+      MBMDT (2yrs)
NI016     F     38       LL        1+      MBMDT (1yr)
PU004     M     50       LL        5+      MBMDT (3yrs)
PU010     M     55       BL        3+      DDS
SH025     M     34       LL        4+      MBMDT (3yrs)
SH042     M     30       BL        2+      NA
NI034     M     21       BL        4+      MBMDT (2yrs)
NI003     M     46       BL        3+      MBMDT (2yrs)
NI017     M     44       LL        4+      MBMDT (1yr)
NI022     M     37       BL        4+      MBMDT (1yr)
SH027     M     41       LL        4+      MBMDT (3yrs)
SH037     M     27       LL        4+      Irregular MDT
SH046     M     45       LL       3.6+     MBMDT (1yr)
NI032     M     50       BL        4+      MBMDT (2yrs)
K0004     M     63       BL       4.3+     MBMDT
PU003     M     60       LL        5+      MBMDT Loose

         Time of            Result of DNA sequencing
Case     relapse in yrs
no.      after RFT          rpoB

SH039    5                  433; ACC--ATC
                              (Thr--He) 441;
                              GAT--TAT (Asp--Tyr)
SH056    4                  442; CAA--CAC (Gin- His)
KH014    NA                 439; TTC--CTC (Phe--Leu)
RNR018   12                 433; ACC--ATC (Thr- He);
                              441; GAT--TAT (Asp--Tyr)
K0006    5                  No mutation
NI016    9                  No mutation
PU004    11                 No mutation
PU010    36                 No mutation
SH025    21                 No mutation
SH042    NA                 No mutation
NI034    On treatment       No mutation
         with other drugs
NI003    17                 No mutation
NI017    IS                 No mutation
NI022    5                  No mutation
SH027    17                 No mutation
SH037    2                  No mutation
SH046    On treatment       No mutation
NI032    16                 No mutation
K0004    NA                 No mutation
PU003    10                 No mutation

               Result of DNA sequencing
Case
no.      folP                      gyrA

SH039    No mutation               No mutation
SH056    No mutation               No mutation
KH014    No mutation               No mutation
RNR018   No mutation               No mutation
K0006    55; CCC--CTC (Pro-Leu)    No mutation
NI016    55; CCC--CTC (Pro-Leu)    No mutation
PU004    55; CCC--CTC (Pro-Leu)    No mutation
PU010    55; CCC--CTC (Pro-Leu)    92; TCG--GCG
                                     (Ser--Ala)
SH025    55; CCC -CGC (Pro- Arg)   No mutation
SH042    55; CCC--CTC (Pro-Leu)    No mutation
NI034    55; CCC--CTC (Pro-Leu)    92; TCG--GCG
                                     Ser92Ala
NI003    No mutation               91; GCA--ACA
                                     (Ala--Thr) 92;
                                     TCG--GCG
                                     (Ser--Ala)
NI017    No mutation               91:GCA--GTA)
                                     (Ala- Val)
NI022    No mutation               91; GCA--ACA
                                     (Ala--Thr)
SH027    No mutation               92; TCG--GCG
                                     (Ser--Ala)
SH037    No mutation               92; TCG--GCG
                                     (Ser--Ala)
SH046    No mutation               92; TCG--GCG
                                     (Ser--Ala)
NI032    No mutation               91; GCA--ACA
                                     (Ala--Thr)
K0004    53; ACC--AGA              No mutation
           (Thr--Arg)
PU003    55; CCC -CGC              No mutation
  (Pro- Arg)
COPYRIGHT 2014 British Leprosy Relief Association
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Lavania, Mallika; Jadhav, Rupendra S.; Chaitanya, Vedithi Sundeep; Turankar, Ravindra; Selvasekhar,
Publication:Leprosy Review
Article Type:Report
Geographic Code:9INDI
Date:Sep 1, 2014
Words:3671
Previous Article:Leprosy incidence: six years follow-up of a population cohort in Bangladesh.
Next Article:The experiences and attitudes of people affected by leprosy who voluntarily undertake leprosy services in Nepal.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters