Printer Friendly

Distinction of saffron cod (Eleginus gracilis) from several other gadid species by using microsatellite markers.

The saffron cod (Eleginus gracilis) is a gadid fish distributed from the northern Gulf of Alaska (GOA), around the Pacific Rim into the Sea of Okhotsk, and into the Arctic Ocean abutting the North Pacific Ocean (Cohen et al., 1990; Mecklenburg et al., 2016). Mature fish, which generally exceed 20 cm in fork length (FL) and may grow to more than 50 cm FL, are eaten by indigenous Alaskans and in Asia and have potential for commercial harvest in North America (Cohen et al., 1990; NPFMC (1); Love et al. (2)). Saffron cod is also an important component of the Arctic ecosystem (Wolotira, 1985; Copeman et al., 2016; Love et al. (2)) and is a significant prey item for several marine mammals (Bluhm and Gradinger, 2008). It is thought to compete for food with Arctic cod (Boreogadus saida) and may have a competitive advantage as sea ice changes occur in response to climate change (Love et al. (2)). The species, especially in North American waters, is little studied, but its position in the food web, potential population responses to warming and reduction of sea ice in the Arctic, and proposed offshore oil and gas development make learning about this species imperative.

The distributions of several other gadid species--Arctic cod (B. saida), Pacific cod (Gadus macrocephalus), walleye pollock (Gadus chalcogrammus), and Pacific tomcod (Microgadus proximus)--overlap with that of E. gracilis, and furthermore navaga (Eleginus nawaga) from the western Arctic Ocean is a congener of E. gracilis. Small gadids of several species are very similar morphologically and often present challenges for identification. The morphological bases of gadiform taxonomy, including the subfamily Gadinae to which all of the species in our study belong, have been described (e.g., Schultz and Welander, 1935; Svetovidov, 1948; Cohen, 1989), as have the phylogenetic relationships among gadiform families (e.g., Roa-Varon and Orti, 2009) and within Gadinae (Teletchea et al., 2006). However, questions remain about the relationships among E. gracilis, E. nawaga, and M. proximus (e.g., Carr et al., 1999; Roa-Varon and Orti, 2009). Moreover, the modern geographic separation between E. eleginus and E. nawaga, if any exists, is unknown.

Genetic analyses of a species can provide insight into several facets of its biology, including population structure, life history (e.g., Kamin et al., 2014), and recent demographic history (e.g., Harpending et al., 1998). Information about population structure can be obtained from surveys in different geographic regions and the fish tested for genetic variation. Microsatellite data are beneficial, when compared with other classes of molecular markers, in that they are often highly polymorphic in fish species (DeWoody et al., 2000) and are relatively inexpensive to apply. Consequently, microsatellite markers were isolated from and developed for E. gracilis. Here we 1) examine their variability in two E. gracilis collections from geographically separated areas; 2) determine their cross-reactivity with other northern Pacific and Arctic ocean gadids and the ability of suites of these loci to accurately distinguish among species; and 3) evaluate differences in the allele profiles among M. proximus, E. nawaga, and the two collections of E. gracilis.

Materials and methods

Samples and DNA isolation

Collections of E. gracilis were collected from the Chuckchi Sea in 2011 and near Kodiak Island, Alaska, in 2013. Collections of B. saida from the Chukchi Sea were made in 2012 and collections of E. nawaga were collected from the Barents Sea in 2013. In 2015, G. chalcogrammus were collected in the southeast Bering Sea. Two collections of M. proximus were obtained, one from Puget Sound, Washington, between 1997 and 1999, and one from Prince William Sound, Alaska, in 2012. Two collections of G. microcephalus were collected in 2013, one collected from Puget Sound and the other from Unimak Pass in the northern Gulf of Alaska (see details for all collections in Table 1).

Tissue samples were preserved in a DNA preservative solution (Seutin et al., 1991) or 95% ethanol and stored in the laboratory at -20[degrees]C. Total cellular DNA was isolated with Gentra Puregene3 or Qiagen DNeasy kits (Qiagen, Hilden, Germany) by following the manufacturer's instructions.

Discovery of microsatellites

An Illumina paired-end shotgun library (Illumina, Inc., San Diego, CA) was prepared by shearing 1 pg of DNA from a single E. gracilis Chukchi Sea individual with a Covaris S220 focused-ultrasonicator (Covaris, Inc., Woburn, MA). The standard protocol for the TruSeq DNA library kit (Illumina, Inc.) and a multiplex identifier adaptor index were used (see e.g., Stoutamore et al., 2012). A HiSeq system (Illumina, Inc.) was used to sequence 100-base pair [bp] paired-end readings. The program PAL_FINDER, vers. 0.02.03 (Castoe et al., 2012) was used to analyze 5 million of the resulting sequences to identify readings that had di-, tri-, tetra-, penta-, and hexanucleotide repeat motifs. The data are archived in the Sequence Read Archive of the National Center for Biotechnology Information under accession number SAMN06333955. Once positive reads were identified, oligonucleotide primers were designed with the program Primer3, vers. 2.0.0 (Koressaar and Remm, 2007; Untergasser et al., 2012). To avoid issues with copy number of primer sequences in the genome, loci for which the primer sequences occurred only once or twice in the 5 million reads were selected. Forty-eight presumed loci from E. gracilis that met this criterion were chosen for primer design.

The 48 primer pairs were tested with DNA from 8 E. gracilis individuals. The polymerase chain reactions (PCRs) were conducted over two 10[degrees]C spans of annealing temperatures (65-55[degrees]C or 58-48[degrees]C) with touchdown thermal cycling profiles (Don et al., 1991). The results (not presented) were analyzed with GeneMapper, vers. 3.7 (Thermo Fisher Scientific, Waltham, MA). Eighteen primer pairs were then selected for evaluation with larger sample sizes.

Analysis of microsatellites

Target sequences of the 18 primer pairs amplified with a touchdown PCR strategy reduced nontarget bands in the product spectrum (Don et al., 1991). All reactions contained ~1 unit Taq polymerase, 1x PCR buffer (50 mM KCl2, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100; Promega Corp., Madison, WI), 0.5 [micro]M deoxyribonucleotide triphosphates, and 0.025 to 0.1 [micro]g DNA template. Fluorescent primers labeled with an IRDye infrared dye (10 pg/mL; Integrated DNA Technologies, Inc., Coralville, IA) were included in the reactions. The amplification profiles for each locus were the following: denaturation at 95[degrees]C for 5 min; 20 touchdown cycles at 95[degrees]C for 30 s, annealing temperatures ranging from 62 to 52[degrees]C (touchdown) for 30 s (decreased 0.5[degrees]C per cycle), and 72[degrees]C for 30 s; then 15 cycles of 95[degrees]C for 30 s, the lowest annealing temperature (55[degrees]C) for 30 s, and 72[degrees]C for 30 s, and a final extension at 72[degrees]C for 5 minutes.

Approximately 1 pL of amplified PCR product and stop buffer (95% formamide, 0.1% bromophenol blue) was loaded onto a 0.25 mm 6% acrylamide gel (PAGE-PLUS[TM], Amresco, Solon, OH) and fragments were separated in 1x TBE buffer (0.09 M Tris-Borate, 2 mM EDTA, pH 8) at 1500 V with a 4300 DNA Analyzer (LICOR, Inc., Lincoln, NE). Electrophoresis times varied from 2 to 3 hours depending on allele sizes of the PCR product. The image of the PCR product was analyzed with SAGA, vers. 3.1 (LI-COR, Inc.) software. Two individuals scored each gel separately and samples that differed in recorded allele size were genotyped a second or third time.

Analysis of data

Two collections of E. gracilis (one from the Chukchi Sea and another from near Kodiak Island, Alaska) were examined separately (Table 1). Collections of B. saida from the Chukchi Sea were combined for analysis as a single species as were collections of M. proximus (Prince William Sound and Puget Sound), and of G. macrocephalus (Puget Sound and Unimak Pass) (Table 1).

Allele frequencies and expected unbiased heterozygosities were estimated and genotype frequencies were tested for departures from Hardy-Weinberg expectations with GENEPOP, vers. 4.5.1 (Rousset, 2008). Significance of multiple tests was confirmed with sequential Bonferroni tests (Rice, 1989) and false discovery rate (FDR; Benjamini and Hochberg, 1995) corrections. Genotypes of individuals that produced deviations from Hardy-Weinberg expectations or apparent principal component analysis (PCA) outliers were reconfirmed by additional genotyping.

Two genetic distances that are not strongly influenced by the numbers of alleles at a locus, but that are based on very different algorithms, were estimated. The standardized genetic differentiation measure [G'.sub.ST] (Hedrick, 2005), based on ratios of heterozygosities adjusted to account for the amount of genetic variation observed at each locus, was estimated with the software program SMOGD, vers. 1.2.5 (Crawford, 2010). Estimates of chord distances (Cavalli-Sforza and Edwards, 1967), a geometric measure, were made with PHYLIP, vers. 3.6 (Felsenstein, 2005).

Principal component analysis was used to contrast the genetic compositions of species groups (SYTAT, vers. 13 software; SYSTAT Software, Inc., San Jose, CA). Correlation matrix-based PCA standardizes variables so that each variable has a similar scale; it was used to contrast the allelic compositions. Covariance matrix-based PCA applies the observed variances so that the scale of variation is included in the analysis; it was used to contrast allele-frequency profiles. Loci missing from a collection or a species did not contribute to the PCA score.

Assignment tests (GeneClass2; Piry et al., 2004) were used to evaluate the robustness of the differences among species groups. The tests removed each individual fish from the species groups before assignment. The criterion of Rannala and Mountain (1997) was applied in all tests.

Results

Only genotypes from loci that could be reliably interpreted were analyzed in for each species. Nine loci amplified reliably and had no apparent homozygote excess in E. gracilis (Table 2; Suppl. Table 1). However, not all loci that were reliable in E. gracilis amplified consistently and produced just 1 or 2 bands in all sets of samples. Most notably, Elgr38 did not amplify reliably in GOA samples of E. gracilis, nor was it reliable in E. nawaga. In addition, only 7 of the 9 loci worked well in M. proximus and only 5 in either G. chalcogrammus or B. saida. Again, Elgr38 did not amplify reliably in the GOA samples of E. gracilis nor was it reliable in E. nawaga. In addition, only 7 of the loci worked well in M. proximus and only 5 in each of G. chalcogrammus and B. saida. Of the loci that did not amplify reliably for a species group, several did produce bands. Only the loci that could be interpreted reliably were analyzed in each species.

Comparisons of gadid collections

Differences in ranges of allele sizes differentiated species and species groups (Table 2, Suppl. Fig. 1). For example, alleles at Elgr38 were on average much larger for B. saida and G. chalcogrammus than for the other species; alleles at Elgr31 were larger on average for B. saida and alleles at Elgr23 were on average larger for G. macrocephalus and G. chalcogrammus. The divergences in allele frequency size ranges were reflected in values of [D.sub.chord] and [G'.sub.ST] (Table 3), all of which were significant (adjusted pairwise homogeneity tests P<0.0001). The estimate of [G'.sub.ST] between the two E. gracilis collections was smaller than values between all other gadid pairs; whereas the estimate of [D.sub.chord] was smaller than that of all but three of the comparisons of gadids, even though different suites of microsatellite loci were used. To provide a comparison of the extent of divergence between the two E. gracilis collections, values of [G'.sub.ST] and [D.sub.chord] were estimated for the species pair Sebastes aleutianus and S. melanostictus from data in Gharrett et al. (2005), [G'.sub.ST]=0.551 and [D.sub.chord]=0.064. The estimate of [G'.sub.ST] between the E. gracilis pair was lower (0.313) but the estimate of [D.sub.chord] was higher (0.078) than that between S. aleutianus and S. melanostictus, presumably because different algorithms were applied; [D.sub.chord] has a geometric basis and G'ST is based on ratios of heterozygosities adjusted to account for the amount of genetic variation observed at each locus (Hedrick, 2005).

Individual-based PCA of allelic compositions (a correlation matrix) and allele frequency profiles (a covariance matrix) produced both speciesand collection-specific clusters (Fig. 1). The plot of the first and second components of the correlation-based PCA separated individual species more clearly, but separation of the two E. gracilis collections was not as strong. The covariance-based PCA clearly separated the two E. gracilis collections, but the other species were not separated quite as well. The first five components of the correlation-based analysis accounted for 10.6% and the first two components accounted for 5.1% of the overall variation in allelic composition. In contrast, the first five components of the covariance-based PCA accounted for 24.3% and the first two for 14.1% of the overall variation in allelic frequencies. Nevertheless, sufficient variation existed to separate these species and the two collections of E. gracilis.

A series of 4 tests was needed to estimate assignments of individuals because not all loci could be used for all species groups (Suppl. Table 2). The tests were the following: 1) all individuals were assigned on the basis of the three loci all groups had in common--Elgr14, Elgr23, and Elgr31; 2) the individuals scored in 1) as Chukchi Sea E. gracilis (CSC), GOA E. gracilis (GSC), E. nawaga (NAW), M. proximus (PTC), and G. macrocephalus (PCO) were assigned on the basis of Elgr7, Elgr11, Elgr13, Elgr14, Elgr23, and Elgr31; 3) the individuals scored in 2) as CSC, GSC, or NAW were tested at Elgr7, Elgr11, Elgr13, Elgr14, Elgr23, Elgr31, Elgr44, and Elgr45; and 4) the individuals scored in 1) as PTC, PCO, G. chalcogrammus (WPO), or B. saida (ACO) were tested at Elgr14, Elgr23, Elgr31, and Elgr38. The results of 3) and 4) assigned each individual to its own group, except 1 CSC (96.7% of the total) and 1 ACO (98.1% of the total) (Table 4).

Previous molecular studies have recognized G. macrocephalus, G. chalcogrammmus, and B. saida as distinct species (Coulson et al., 2006, Carr et al., 1999) but the systematic relationships among E. gracilis, E. nawaga, and M. proximus are still unresolved (Mecklenburg et al., 2016). Differences in the allele frequency profiles are easier to see in plots that include only those four groups (Table 2, Suppl. Fig. 2). The M. proximus and E. nagawa distributions clearly differ from those of the 2 E. gracilis collections at Elgr07 and Elgr11. The profiles for M. proximus and E. nagawa clearly differ from those for the 2 collections of E. gracilis at Elgr07 and Elgr11. M. proximus also differs at Elgr13 and Elgr31 and has a substantially higher number of large alleles. The numbers of observed alleles (Table 2) in the collection of GOA E. gracilis are relatively lower than those of the others and several are more abundant (Suppl. Fig. 2), which is consistent with the somewhat lower heterozygosity (Table 2) of the GOA E. gracilis.

Discussion

Eight of the nine microsatellites that were evaluated for two collections of E. gracilis and that amplified reliably were variable (heterozygosities 0.537 to 0.933) and had no apparent homozygote excess, indicating low null allele frequencies. The single exception, Elgr38, amplified reliably for the Chukchi Sea collection of E. gracilis but not for the GOA collection. At the other loci, the two collections had similar allele size ranges but differed substantially in allele frequencies (G'ST=0.313, [D.sub.chord]=0.078, P<0.0001). The observed differences were similar to those between two cryptic rockfish species that had overlapping ranges, S. aleutianus and S. melanostictus, although they were estimated with different suites of loci. In the PCA plots, individuals from the two collections of E. gracilis were mostly distinct from each other, particularly in the analysis of the covariance matrix, which focuses on the allele frequencies rather than allele composition. It is also notable that the PCA analyses included frequency differences of the other gadids analyzed, and differences between the 2 collections of E. gracilis were evident against the background variation from other species.

Assignment tests placed all but one saffron cod in the group from which it originated. Not all nine microsatellite loci amplified reliably in all of the other gadid species analyzed and some had an excess of homozygotes, most likely as a consequence of null alleles; those loci were not used for assignment tests. Nevertheless, where comparisons were possible, all the other gadids differed in microsatellite composition (P<0.0001) from both collections of E. gracilis and each other. The correlation matrix-based PCA, in particular, clustered individuals according to species or geographic groups of species. The PCA analyses turned out to be valuable in analyzing a large set of samples of putative E. gracilis because the analysis revealed outliers that, when compared with the clusters of other gadids, enabled detection of individuals misidentified as E. gracilis. Two notable instances were 14 aberrant genotypes included in a collection of E. gracilis from the Chukchi Sea and another 15 in a collection of E. gracilis from Prince William Sound. In both instances, it was possible to re-examine the individual specimens; the former were re-identified as B. saida and the latter as M. proximus (Table 1). Both sets of re-identified individuals were included with their correct species in the analyses presented here (designated as '+' and 'x', respectively in Fig. 1). Assignment tests correctly reassigned all of the other gadids except one Arctic cod.

In these analyses, the two collections of E. gracilis, and the collections of M. proximus, and E. nawaga were all distinct from each other (P<0.0001). The degree of their divergences mostly exceeded those observed between S. aleutianus and S. melanostictus (Gharrett et al., 2005) and each of the collections clustered separately in PCAs. It is notable that misidentified individuals of Prince William Sound M. proximus were collected at the same site with E. gracilis, but were genetically distinct from them. Clearly, some field identifications, even by trained personnel, are challenging (cf. Teletchea, 2009). It is unlikely that they represent two sympatric populations of a single marine species--populations that are so strongly different genetically. Although it could be argued that the genetic differences between the collections of E. nawaga and E. gracilis could result from divergence over the large distance that separates them, the very large divergences in allele frequencies, as well as similar differences in allele size ranges at Elgr11 and Elgr14, are more consistent with their being distinct species. More complete information on the modern Arctic distributions of the two species of Eleginus, and the location of the historic contact zone between them, would contribute to resolving their systematic status, as would independent data, such as mitogenomic sequences of E. nawaga and E. gracilis, coupled with morphological characters (Teletchea, 2009).

Acknowledgements

Funding was provided by the U.S. Department of Interior (Bureau of Ocean Energy Management Agreements M12AC00009 and M12AC00009), the U.S. Department of the Interior (Fish and Wildlife Service Agreements 10-CIAP-010 and F12AF00188), the Department of Energy (award no. DE-FC09-07SR22506), and the Russian Federation for Fundamental Investigations (Grant15-04-02081, Gostema no. 01201351186). This article is contribution EcoFOCI-0896 to NOAA's Ecosystems and Fisheries Oceanography Coordinated Investigations program.

Literature cited

Benjamini, Y., and Y. Hochberg.

1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc., B. 57:289-300. Article

Bluhm, B. A., and R. Gradinger.

2008. Regional variability in food availability for arctic marine mammals. Ecol. Appl. 18:S77-S96. Article

Castoe, T. A., A. W. Poole, A. P. J. de Koning, K. L. Jones, D. F. Tomback, S. J. Oyler-McCance, J. A. Fike, S. L. Lance, J. W. Streicher, E. N. Smith, and D. D. Pollack.

2012. Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PLoS ONE 7(2):e30953. Article

Cavalli-Sforza, L. L, and A. W. F. Edwards.

1967. Phylogenetic analysis: models and estimation procedures. Evolution 21:550-570. Article

Crawford, N. G.

2010. SMOGD: software for the measurement of genetic diversity. Mol. Ecol. Resour. 10:556-557. Carr, S. M., and H. D. Marshall.

2008. Phylogeographic analysis of complete mtDNA genomes from Walleye Pollock (Gadus chalcogrammus Pallas, 1811) shows an ancient origin of genetic biodiversity. DNA Sequence 19:490-496. Article

Carr, S. M., D. S. Kivlichan, P. Pepin, and D. C. Crutcher.

1999. Molecular systematics of gadid fishes: implications for the biogeographic origins of Pacific species. Can. J. Zool. 77:19-26. Article

Cohen, D. M. (ed.).

1989. Papers on the systematics of gadiform fishes. Nat. Hist. Mus. Los Ang. Cty., Sci. Ser. 32, 262 p.

Cohen, D. M., T. Inada, T. Iwamoto, and N. Scialabba.

1990. FAO species catalogue, vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fisheries Synopsis 125, 442 p. FAO, Rome.

Copeman, L. A., B. J. Laurel, K. M. Boswell, A. L. Sremba, K. Klinck, R. A. Heintz, J. Vollenweider, T. E. Helser, and M. L. Spencer.

2016. Ontogenetic and spatial variability in trophic biomarkers of juvenile saffron cod (Eleginus gracilis) from the Beaufort, Chukchi and Bering Seas. Polar Biol. 39:1109-1126. Article

Coulson, M. W., H. D. Marshall, P. Pepin, and S. M. Carr.

2006. Mitochondrial genomics of gadine fishes: implications for taxonomy and biogeographic origins from whole-genome data sets. Genome 49:1115-1130. Article

DeWoody, J. A., and J. C. Avise.

2000. Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. J. Fish Biol. 56:461-473. Article

Don, R. H., P. T. Cox, B. J. Wainwright, K. Baker, and J. S. Mattick.

1991. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19:4008. Article

Felsenstein, J.

2005. PHYLIP (Phylogeny Inference Package), vers. 3.6. Dep. Genome Sci., Univ. Washington, Seattle, WA. [Available from website.]

Gharrett, A. J., A. P. Matala, E. L. Peterson, A. K. Gray, and Z. Li.

2005. Two genetically distinct forms of rougheye rockfish are different species. Trans. Am. Fish. Soc. 134:242-260. Article

Harpending, H. C, M. A. Batzer, M. Gurven, L. B. Jorde, A. R. Rogers, and S. T. Sherry.

1998. Genetic traces of ancient demography. Proc. Natl. Acad. Sci. U.S.A. 95:1961-1967. Article

Hedrick, P. W.

2005. A standardized genetic differentiation measure. Evolution 59:1633-1638. Article

Kamin, L. M., K. J. Palof, J. Heifetz, and A. J. Gharrett. 2014. Interannual and spatial variation in the population genetic composition of young-of-the-year Pacific ocean perch (Sebastes alutus) in the Gulf of Alaska. Fish. Oceanogr. 23:1-17. Article

Koressaar, T., and M. Remm.

2007. Enhancements and modifications of primer design program Primer3. Bioinformatics 23:1289-1291. Article

Mecklenburg, C. W., T. A. Mecklenburg, B. A. Sheiko, and D. Steinke.

2016. Pacific Arctic marine fishes, 375 p. Conservation of Arctic Flora and Fauna, Akureyri, Iceland.

Piry, S., A. Alapetite, J.-M. Cornuet, D. Paetkau, L. Baudouin, and A. Estoup.

2004. GENECLASS2: A software for genetic assignment and first-generation migrant detection. J. Hered. 95:536-539. Article

Rannala, B., and J. L. Mountain.

1997. Detecting immigration by using multilocus genotypes. Proc. Natl. Acad. Sci. U.S.A. 94:9197-9201. Article

Rice, W. R.

1989. Analyzing tables of statistical tests. Evolution 43:223-225. Article

Roa-Varon, A., and G. Orti.

2009. Phylogenetic relationships among families of Gadiformes (Teleostei, Paracanthopterygii) based on nuclear and mitochondrial data. Mol. Phylogen. Evol. 52:688-704. Article

Rousset, F.

2008. GENEPOP'007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 8:103-106. Article

Schultz, L. P., and A. D. Welander.

1935. A review of the cods of the northeastern Pacific with comparative notes on related species. Copeia 1935:127139. Article

Seutin, G., B. N. White, and P. T. Boag.

1991. Preservation of avian blood and tissue samples for DNA analysis. Can. J. Zool. 69:82-90. Article

Stoutamore, J. L., C. N. Love, S. L. Lance, K. L. Jones, and D. Tallmon.

2012. Development of polymorphic microsatellite markers for blue king crab (Paralithodes platypus). Conserv. Genet. Resour. 4:897-899. Article

Svetovidov, A. N.

1948. Gadiformes (Treskoobraznye). Fauna of the U.S.S.R., vol. 9, no. 4, 304 p. Israel Program Sci. Transl., Jerusalem, Israel.

Teletchea, F.

2009. Molecular identification methods of fish species: reassessment and possible applications. Rev. Fish Biol. Fish. 19:265-293. Article

Teletchea, F., V. Laudet, and C. Hannia.

2006. Phylogeny of the Gadidae (sensu Svetovidov, 1948) based on their morphology and two mitochondrial genes. Mol. Phylogen. Evol. 38:189-199. Article

Untergasser, A., I. Cutcutache, T. Koressaar, J. Ye, B. C. Faircloth, M. Remm, and S. G. Rozen.

2012. Primer3--new capabilities and interfaces. Nucleic Acids Res. 40:e115. Article

Wolotira, R. J., Jr.

1985. Saffron cod (Eleginus gracilis) in western Alaska, the resource and its potential. NOAA Tech. Memo. NMFS F/NWC-79, 119 p.

Noel Sme [1]

Sarah Lyon [1]

Michael Canino [2]

Natalia Chernova [3]

Jason O'Bryhim [4]

Stacey Lance [4]

Kenneth Jones [5]

Franz Mueter [1]

Anthony Gharrett (contact author) [1]

Email address for contact author: a.gharrett@alaska.edu

[1] Juneau Center College of Fisheries and Ocean Sciences University of Alaska Fairbanks 17101 Point Lena Loop Road Juneau, Alaska 99801

[2] Alaska Fisheries Science Center National Marine Fisheries Service, NOAA 7600 Sand Point Way NE Seattle, Washington 98115

[3] Zoological Institute of the Russian Academy of Sciences Universitetskaja Naberezhnaya 1

[4] Savannah River Ecology Laboratory University of Georgia P.O. Drawer E Aiken, South Carolina 29802

[5] Section of Hematology-Oncology Department of Pediatrics University of Colorado School of Medicine 12800 East 19th Ave, RC-1 North, Room 4129 Aurora, Colorado 80045 St. Petersburg, Russia 199034

Manuscript submitted 20 April 2017. Manuscript accepted 7 November 2017. Fish. Bull. 116:60-68 (2018) Online publication date: 13 December 2017. doi: 10.7755/FB.116.1.6

The views and opinions expressed or implied in this article are those of the author (or authors) and do not necessarily reflect the position of the National Marine Fisheries Service, NOAA.

(1) NPFMC (North Pacific Fisheries Management Council). 2009. Fishery management plan for fish resources of the Arctic management area, 76 p. NPFMC, Anchorage, AK. [Available from website.]

(2) Love, M. S., N. Elder, C. W. Mecklenburg, L. K. Thorsteinson, and T. A. Mecklenburg. 2016. Alaska Arctic marine fish species accounts: saffron cod (Eleginus gracilis). In Alaska Arctic marine fish ecology catalog. U.S. Geological Survey Sci. Invest. Rep. 2016-5038 (OCS Study, BOEM 2016-048) (L. K. Thorsteinson and M. S. Love, eds.), p. 201-208. [Available from website.]

(3) Mention of trade names or commercial companies is for identification purposes only and does not imply endorsement by the National Marine Fisheries Service

Caption: Figure 1

Results of principle component (PC) analyses. (A) Allele composition (a correlation matrix) and (B) allele frequency profiles (a covariance matrix) of microsatellite data from saffron cod (Eleginus gracilis [SC]) collected in the Chukchi Sea (Chukchi SC) and Gulf of Alaska (Gulf SC) in 2011 and 2013, navaga (E. nawaga) collected in the Barents Sea in 2013, Pacific tomcod (Microgadus proximus) collected in Puget Sound during 1997-1999 and in Prince William Sound in 2012, Pacific cod (Gadus macrocephalus) collected in Puget Sound and Unimak Pass in 2013, walleye pollock (G. chalcogrammus) collected in the southeastern Bering Sea in 2015, and Arctic cod (Boreogadus saida) collected in the Chukchi Sea in 2012. The symbols '+' and 'x' denote individuals provided in saffron cod collections that were later re-identified as Arctic cod and Pacific tomcod, respectively.

Caption: Supplementary Figure 1

Plots of microsatellite allele frequencies at the loci Elgr7, Elgrll, Elgr13, Elgr14, Elgr23, Elgr44, Elgr31, Elgr38, and Elgr45 for saffron cod (Eleginus gracilis, SC) collected in the Chukchi Sea and Gulf of Alaska in 2011 and 2013, navaga (E. nawaga) collected in the Barents Sea in 2013, Pacific tomcod (Microgadus proximus) collected in Puget Sound in 1997-1999 and in Prince William Sound in 2012, Pacific cod (Gadus macrocephalus) collected in Puget Sound and Unimak Pass in 2013, walleye pollock (G. chalcogrammus) collected in the southeastern Bering Sea in 2015, and Arctic cod (Boreogadus saida) collected in the Chukchi Sea in 2012. Arrows indicate large breaks in the scale of the x-axis.

Caption: Supplementary Figure 2

Microsatellite allele frequency plots of for saffron cod (Eleginus gracilis, SC) collected in the Chukchi Sea in 2011 and in the Gulf of Alaska in 2013, navaga (E. nawaga) collected the Barents Sea in 2013, and Pacific tomcod (Microgadus proximus) collected in Puget Sound in 1997-1999 and in Prince William Sound in 2012.
Table 1

Number of samples (n), geographic regions, gear used, collector
(when known) and collector's affiliation for collections of 6
gadid species sampled in this study: saffron cod (Eleginus
gracilis), navaga (E. nawaga), Pacific tomcod (Microgadus
proximus), Pacific cod (Gadus macrocephalus), walleye pollock (G.
chalcogrammus), and Arctic cod (Boreogadus saida). Asterisks denote
specimens originally identified in the field as saffron cod, but
were later re-examined.

Species              Scientific name          n

Saffron cod          Eleginus gracilis        30
                                              41
Nawaga               Eleginus nawaga          81
Pacific tomcod       Microgadus proximus      8
                                              15
Pacific cod          Gadus macrocephalus      5
                                              8
Walleye pollock      Gadus chalcogrammus      6
Arctic cod           Boregadus saida          39
                                              14

Species              n    Geographic region          Latitude

Saffron cod          30   Chukchi Sea                66.91[degrees]N
                     41   Gulf of Alaska             57.73[degrees]N
Nawaga               81   Barents Sea                69.04[degrees]N
Pacific tomcod       8    Puget Sound                47.71[degrees]N
                     15   Prince William Sound *     60.87[degrees]N
Pacific cod          5    Puget Sound                48.40[degrees]N
                     8    Unimak Pass                54.45[degrees]N
Walleye pollock      6    SE Bering Sea              55.67[degrees]N
Arctic cod           39   Chukchi Sea                66.90[degrees]N
                     14   Chukchi Sea *              66.90[degrees]N

Species              n    Longitude

Saffron cod          30   162.55[degrees]W
                     41   152.51[degrees]W
Nawaga               81   57.87[degrees]E
Pacific tomcod       8    122.52[degrees]W
                     15   147.19[degrees]W
Pacific cod          5    124.41[degrees]W
                     8    164.99[degrees]W
Walleye pollock      6    163.33[degrees]W
Arctic cod           39   162.59[degrees]W
                     14   162.59[degrees]W

Species             Date             Gear            Collector

Saffron cod         9/11             jig             A. Whiting
                    6/7/2013         rod and reel    E. Munk
Navaga              7/13             trawl           N. Chernova
Pacific tomcod      3/1997-8/1999    beach seine     M Canino
                    7/12             beach seine     M. Arimitsu
Pacific cod         3/13             beach seine     M. Canino
                    3/13             trawl           M. Canino
Walleye pollock     9/15             trawl           W. Strasburger
Arctic cod          4/12             jig             A. Whiting
                    4/12             jig             A. Whiting

Species             Affiliation

Saffron cod         Native Village of Kotzebue
                    NOAA Fisheries
Navaga              Russian Academy of Sciences
Pacific tomcod      NOAA Fisheries
                    U.S. Geological Survey
Pacific cod         NOAA Fisheries
                    NOAA Fisheries
Walleye pollock     NOAA Fisheries
Arctic cod          Native Village of Kotzebue
                    Native Village of Kotzebue

Table 2

Microsatellite properties of northern gadid species of the Pacific
Rim and Arctic Ocean for the 9 loci designed for saffron cod
(Eleginus gracilis) sampled in the Chukchi Sea and Gulf of Alaska
(GOA) in 2011 and 2013. Number of samples for each species (n), the
numbers of different allele observed ([n.sub.a]), the range of
allele sizes, the mean and standard error of the mean (SE) of
allele sizes, expected heterozygosities ([H.sub.e]), and inbreeding
coefficients ([F.sub.is]) are given. An entry of dna means the
locus did not reliably amplify. Collections were made in 2013 for
navaga (E. nawaga), during 1997-1999 for Pacific tomcod (Microgadus
proximus), in 2013 for Pacific cod (Gadus macrocephalus), in 2015
for walleye pollock (G. chalcogrammus), and in 2012 for Arctic cod
(Boreogadus saida).

Locus and species               n    [n.sub.a]       range

Elgr07
  Chukchi Sea E. gracilis       30       10         127-175
  GOA E. gracilis               41       7          151-179
  E. nawaga                     81       14         115-183
  M. proximus                   22       1            123
  G. macrocephalus              14       2        115 and 131
  G. chalcogrammus              6        2        131 and 135
  B. saida                      53      dna            --
Elgr11
  Chukchi Sea E. gracilis       30       12         208-272
  GOA E. gracilis               41       8          204-260
  E. nawaga                     81       21         240-336
  M. proximus                   22       17         248-340
  G. macrocephalus              14       18         192-204
  G. chalcogrammus              6       dna            --
  B. saida                      53      dna            --
Elgr31
  Chukchi Sea E. gracilis       30       6          191-211
  GOA E. gracilis               41       4          191-203
  E. nawaga                     81       11         179-231
  M. proximus                   22       14         215-267
  G. macrocephalus              14       18         223-299
  G. chalcogrammus              6        10         215-267
  B. saida                      53       37         223-543
Elgr38
  Chukchi Sea E. gracilis       30       9          112-144
  GOA E. gracilis               41      dna            --
  E. nawaga                     81      dna            --
  M. proximus                   22       6          120-140
  G. macrocephalus              14       6          128-160
  G. chalcogrammus              6        7          236-276
  B. saida                      53       37         252-448
Elgr13
  Chukchi Sea E. gracilis       30       12         230-286
  GOA E. gracilis               41       10         226-286
  E. nawaga                     81       19         214-286
  M. proximus                   22       19         242-338
  G. macrocephalus              14       14         250-346
  G. chalcogrammus              6       dna            --
  B. saida                      53       12         206-318
Elgr14
  Chukchi Sea E. gracilis       30       14         322-378
  GOA E. gracilis               41       9          330-370
  E. nawaga                     81       12         318-362
  M. proximus                   22       11         326-370
  G. macrocephalus              14       4          314-346
  G. chalcogrammus              6        10         330-418
  B. saida                      53       19         290-366
Elgr44
  Chukchi Sea E. gracilis       30       14         212-264
  GOA E. gracilis               41       7          228-272
  E. nawaga                     81       14         216-268
  M. proximus                   22      dna            --
  G. macrocephalus              14      dna            --
  G. chalcogrammus              6       dna            --
  B. saida                      53      dna            --
Elgr45
  Chukchi Sea E. gracilis       30       13         205-265
  GOA E. gracilis               41       4          209-221
  E. nawaga                     81       17         189-269
  M. proximus                   22       6          197-217
  G. macrocephalus              14      dna            --
  G. chalcogrammus              6       dna            --
  B. saida                      53      dna            --
Elgr23
  Chukchi Sea E. gracilis       30       15         142-202
  GOA E. gracilis               41       4          162-190
  E. nawaga                     81       17         138-214
  M. proximus                   22       13         138-206
  G. macrocephalus              14       17         154-286
  G. chalcogrammus              6        11         186-318
  B. saida                      53       23         138-258

Locus and species                   mean        [H.sub.e]

Elgr07
  Chukchi Sea E. gracilis        155.7 (1.2)      0.867
  GOA E. gracilis                160.6 (0.5)      0.683
  E. nawaga                      133.7 (0.7)      0.815
  M. proximus                    123.0 (0.0)      0.000
  G. macrocephalus               128.7 (1.1)      0.286
  G. chalcogrammus               133.3 (0.6)      0.833
  B. saida                           --             --
Elgr11
  Chukchi Sea E. gracilis        222.1 (1.7)      0.833
  GOA E. gracilis                214.0 (1.3)      0.634
  E. nawaga                      274.7 (1.4)      0.877
  M. proximus                    285.8 (3.0)      0.727
  G. macrocephalus               202.9 (0.6)      0.286
  G. chalcogrammus                   --             --
  B. saida                           --             --
Elgr31
  Chukchi Sea E. gracilis        197.1 (0.7)      0.833
  GOA E. gracilis                194.8 (0.5)      0.659
  E. nawaga                      204.4 (0.8)      0.864
  M. proximus                     240.5 (2)       0.955
  G. macrocephalus               263.3 (3.7)      1.000
  G. chalcogrammus               241.7 (4.8)      1.000
  B. saida                       355.6 (7.6)      0.962
Elgr38
  Chukchi Sea E. gracilis        127.5 (1.1)      0.867
  GOA E. gracilis                    --             --
  E. nawaga                          --             --
  M. proximus                    127.9 (0.8)      0.727
  G. macrocephalus               141.9 (1.9)      0.786
  G. chalcogrammus               258.0 (4.4)      0.833
  B. saida                       348.6 (6.3)      0.566
Elgr13
  Chukchi Sea E. gracilis        251.1 (1.3)      0.867
  GOA E. gracilis                254.3 (1.4)      0.805
  E. nawaga                      243.8 (1.3)      0.926
  M. proximus                    284.5 (3.7)      0.909
  G. macrocephalus               314.7 (4.3)      1.000
  G. chalcogrammus                   --             --
  B. saida                       250.8 (1.0)      0.830
Elgr14
  Chukchi Sea E. gracilis        347.6 (1.7)      0.800
  GOA E. gracilis                345.7 (1.1)      0.829
  E. nawaga                      329.4 (0.7)      0.790
  M. proximus                    340.3 (1.6)      0.682
  G. macrocephalus               325.6 (0.9)      0.143
  G. chalcogrammus               364.7 (7.2)      1.000
  B. saida                       325.5 (1.7)      0.811
Elgr44
  Chukchi Sea E. gracilis        240.9 (1.7)      0.867
  GOA E. gracilis                247.1 (1.1)      0.537
  E. nawaga                      238.4 (1.1)      0.840
  M. proximus                        --             --
  G. macrocephalus                   --             --
  G. chalcogrammus                   --             --
  B. saida                           --             --
Elgr45
  Chukchi Sea E. gracilis        218.8 (1.6)      0.867
  GOA E. gracilis                213.0 (0.4)      0.683
  E. nawaga                      224.5 (1.2)      0.864
  M. proximus                    204.9 (0.8)      0.955
  G. macrocephalus                   --             --
  G. chalcogrammus                   --             --
  B. saida                           --             --
Elgr23
  Chukchi Sea E. gracilis        170.5 (1.8)      0.933
  GOA E. gracilis                168.1 (0.4)      0.683
  E. nawaga                      168.1 (1.1)      0.926
  M. proximus                    161.6 (2.4)      0.909
  G. macrocephalus               215.0 (5.0)      0.929
  G. chalcogrammus              246.7 (12.6)      1.000
  B. saida                       191.6 (2.3)      0.660

Locus and species               [F.sub.is]

Elgr07
  Chukchi Sea E. gracilis         -0.016
  GOA E. gracilis                 -0.054
  E. nawaga                       -0.028
  M. proximus                       --
  G. macrocephalus                -0.130
  G. chalcogrammus                -0.667
  B. saida                          --
Elgr11
  Chukchi Sea E. gracilis          0.043
  GOA E. gracilis                 -0.117
  E. nawaga                        0.043
  M. proximus                    0.230 (a)
  G. macrocephalus                -0.072
  G. chalcogrammus                  --
  B. saida                          --
Elgr31
  Chukchi Sea E. gracilis         -0.103
  GOA E. gracilis                 -0.015
  E. nawaga                       -0.052
  M. proximus                     -0.027
  G. macrocephalus                -0.034
  G. chalcogrammus                -0.035
  B. saida                         0.005
Elgr38
  Chukchi Sea E. gracilis         -0.026
  GOA E. gracilis                   --
  E. nawaga                         --
  M. proximus                      0.068
  G. macrocephalus                 0.037
  G. chalcogrammus                 0.039
  B. saida                       0.422 (c)
Elgr13
  Chukchi Sea E. gracilis          0.007
  GOA E. gracilis                  0.006
  E. nawaga                       -0.009
  M. proximus                      0.040
  G. macrocephalus                -0.093
  G. chalcogrammus                  --
  B. saida                        -0.064
Elgr14
  Chukchi Sea E. gracilis          0.101
  GOA E. gracilis                 -0.007
  E. nawaga                       -0.010
  M. proximus                      0.217
  G. macrocephalus               0.667 (b)
  G. chalcogrammus                -0.035
  B. saida                         0.121
Elgr44
  Chukchi Sea E. gracilis          0.057
  GOA E. gracilis                0.161 (a)
  E. nawaga                        0.079
  M. proximus                       --
  G. macrocephalus                  --
  G. chalcogrammus                  --
  B. saida                          --
Elgr45
  Chukchi Sea E. gracilis         0.0085
  GOA E. gracilis                 0.0145
  E. nawaga                       0.0471
  M. proximus                     -0.0769
  G. macrocephalus                  --
  G. chalcogrammus                  --
  B. saida                          --
Elgr23
  Chukchi Sea E. gracilis         -0.027
  GOA E. gracilis                 -0.181
  E. nawaga                       -0.019
  M. proximus                     -0.044
  G. macrocephalus                 0.034
  G. chalcogrammus                -0.017
  B. saida                       0.309 (c)

(a) P<0.05; (b) P<0.01; (c) P<0.001.

Table 3

Estimates of pairwise chord distances ([D.sub.chord]; above the
diagonal) and standardized genetic differentiation measure
([G'.sub.ST], below the diagonal) for saffron cod (Eleginus
gracilis) sampled in the Chukchi Sea and Gulf of Alaska (GOA) in
2011 and 2013 and for navaga (E. nawaga), Pacific tomcod
(Microgadus proximus), Pacific cod (Gadus macrocephalus), walleye
pollock (G. chalcogrammus), and Arctic cod (Boreogadus saida)
sampled in the Pacific Rim and Arctic Ocean during 1997-2015. All
estimates were significant (adjusted probabilities: P<0.0001).
Values of average unbiased ex- pected heterozygosity ([H.sub.e])
are indicated in italic type on the diagonal.

Collection                       A          B            C

A Chukchi Sea E. gracilis      0.859    0.078 (a)    0.076 (a)
B GOA E. gracilis              0.313    0.689        0.130 (a)
C E. nawaga                    0.414    0.680        0.863
D M. proximus                  0.603    0.779        0.565
E G. macrocephalus             0.877    0.963        0.822
F G. chalcogrammus             0.868    0.893        0.739
G B. saida                     0.599    0.680        0.584

Collection                         D            E            F

A Chukchi Sea E. gracilis      0.138 (a)    0.189 (b)    0.218 (d)
B GOA E. gracilis              0.183 (b)    0.245 (b)    0.296 (e)
C E. nawaga                    0.093 (b)    0.137 (c)    0.158 (e)
D M. proximus                  0.733        0.182 (b)    0.228 (d)
E G. macrocephalus             0.721        0.633        0.204 (d)
F G. chalcogrammus             0.582        0.449        0.933
G B. saida                     0.781        0.681        0.607

Collection                         G

A Chukchi Sea E. gracilis      0.076 (d)
B GOA E. gracilis              0.095 (e)
C E. nawaga                    0.069 (e)
D M. proximus                  0.088 (e)
E G. macrocephalus             0.092 (e)
F G. chalcogrammus             0.087 (e)
G B. saida                     0.766

(a) 8 loci;

(b) 7 loci;

(c) 6 loci;

(d) 5 loci;

(e) 4 loci for both [D.sub.chord] and [G'.sub.ST] estimates.

Table 4

Summary of results of a series of tests (Piry et al., 2004) that
assigned each fish to 1 of 7 species groups: saffron cod (Eleginus
gracilis) of the Chukchi Sea (CSC), saffron cod of the Gulf of
Alaska (GSC), navaga (E. nawaga) (NAW), Pacific tomcod (Microgadus
proximus) (PTC), Pacific cod (Gadus macrocephalus) (PCO), walleye
pollock (G. chalcogrammus) (WPO), and Arctic cod (Boreogadus saida)
(ACO). n=the number of individuals of each group. For all results
from the assignment tests, see Supplementary Table 2.

                                 Assigned to

n      Species group    CSC   GSC     NAW   PTC   PCO

30          CSC         29    1 (a)   0     0     0
41          GSC         0     41      0     0     0
81          NAW         0     0       81    0     0
23          PTC         0     0       0     23    0
14          PCO         0     0       0     0     14
6           WPO         0     0       0     0     0
53          ACO         0     0       0     0     0

      Assigned to

n     WPO     ACO

30    0       0
41    0       0
81    0       0
23    0       0
14    0       0
6     6       0
53    1 (b)   52

(a) 83% GSC/ 17% CSC.

(b) 55% PCO/ 44% WPO/ 1% ACO.

Supplementary Table 1

Characteristics for 9 polymorphic microsatellite loci developed for
saffron cod (Eleginus gracilis) collected from the Chukchi Sea in
2011 and the Gulf of Alaska in 2013. n=number of samples.

Locus            Primer sequence                         Repeat motif

Elgr7      F:    5'TCCTCTCTCTGAACACAACACTCC 3'               TCTG
           R:    5'ACCAGAGCGGACGAAGGC 3'
Elgr11     F:    5'AATGCTCCTATTTCAATAGCCC 3'                 ATCT
           R:    5'ATAGTTGCAGCTTTCGCAGG 3'
Elgr13     F:    5'TGCTGATAGCTGAAGATGGC 3'                   TCTG
           R:    5'ATTTGCTCAGCAGAACATGG 3'
Elgr14     F:    5'GTGTATTCAAAGCAACGCCG 3'                   TCTG
           R:    5'CAAGCAACACACATCTTCAGTCC 3'
Elgr23     F:    5'AAGAAGGTATTACCCTGTATAATTGCC 3'            TCTG
           R:    5'CCACCTTCAACACGCAGG 3'
Elgr31     F:    5'TTTGGCAGTCACGTGTGC 3'                     AAAG
           R:    5'GAGGCAAGAACAGCATCTGG 3'
Elgr38     F:    5'CAAACCTGGCTCAGGAACG 3'                    TCTG
           R:    5'GGAAAGAGGAGATCCCTGTGG 3'
Elgr44     F:    5'TGGCTCATGGTAGAATCGCC 3'                   TCTG
           R:    5'TGGAAAGCCAAAGTTGTACTGC 3'
Elgr45     F:    5'GAGCACGCGTTTAGCTCC 3'                     AGTG
           R:    5'TTTAAATGGTCGACCTATCACC 3'

Locus      n      [H.sub.E]    [F.sub.is]

Elgr7      30       0.853        -0.016

Elgr11     30       0.833         0.043

Elgr13     30       0.867         0.007

Elgr14     30       0.800         0.101

Elgr23     30       0.933        -0.027

Elgr31     30       0.833        -0.103

Elgr38     30       0.867        -0.026

Elgr44     30       0.867         0.057

Elgr45     30       0.867         0.009

Supplementary Table 2

Results of tests for assignment of individual fish to 1 of 7
species groups analyzed in this study. (A) All specimens were
tested with loci Elgr14, Elgr23, and Elgr31; (B) individuals scored
as saffron cod (Eleginus gracilis) of the Chukchi Sea (CSC),
saffron cod of the Gulf of Alaska (GSC), navaga (E. nawaga) (NAW),
Pacific tomcod (Microgadus proximus) (PTC), or Pacific cod (Gadus
macrocephalus) (PCO) in A were tested at loci Elgr7, Elgr11,
Elgr13, Elgr14, Elgr23, and Elgr31; (C) individuals scored as CSC,
GSC, or NAW in B were tested at loci Elgr7, Elgr11, Elgr13, Elgr14,
Elgr23, Elgr31, Elgr44, and Elgr45; and (D) individuals scored as
PTC, PCO, walleye pollock (G. chalcogrammus) (WPO), or Arctic cod
(Boreogadus saida) (ACO) in A were tested at loci Elgr14, Elgr23,
Elgr31, and Elgr38. n=number of samples.

A

                                Assigned to
n     Species
        group     CSC   GSC   NAW   PTC   PCO   WPO   ACO

30       CSC      19     5     6     0     0     0     0
41       GSC       5    36     0     0     0     0     0
81       NAW       9     1    70     1     0     0     0
23       PTC       0     0     0    23     0     0     0
14       PCO       0     0     0     1    11     0     2
6        WPO       0     0     0     3     1     2     0
53       ACO       0     0     0     0     2     1    50

B

n     Species
        group     CSC   GSC   NAW   PTC   PCO

30       CSC      28     2     0     0     0
41       GSC       1    40     0     0     0
81       NAW       0     0    81     0     0
23       PTC       0     0     0    23     0
12       PCO       0     0     0     0    12

C

n     Species
        group     CSC   GSC   NAW

30       CSC      29     1     0
41       GSC       0    41     0
81       NAW       0     0    81

D

n     Species
        group     PTC   PCO   WPO   ACO

23       PTC      23     0     0     0
14       PCO       0    14     0     0
6        WPO       0     0     6     0
53       ACO       0     0     1    52
COPYRIGHT 2018 National Marine Fisheries Service
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Sme, Noel; Lyon, Sarah; Canino, Michael; Chernova, Natalia; O'Bryhim, Jason; Lance, Stacey; Jones, K
Publication:Fishery Bulletin
Geographic Code:0PACR
Date:Jan 1, 2018
Words:7369
Previous Article:Geographic variations of jumbo squid (Dosidicus gigas) based on gladius morphology.
Next Article:The forgotten need for spatial persistence in catch data from fixed-station surveys.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |