Printer Friendly

Discovery and cross-amplification of microsatellite polymorphisms in asterinid sea stars.

Introduction

The highly variable dispersal potential and mating systems of asterinid sea stars (e.g., Byrne, 1995, 2005, 2006; )Byrne and Cerra, 1996; Byrne et al., 2003; Hart et al, 2006) combined with specific conservation concerns (Emson and Crump, 1984; Law and Kelly, 2004; Tasmania Threatened Species Protection Act 1995) makes these species particularly interesting for analysis of population genetics. An early study used multiple used multiple allozyme loci (Hunt, 1993) to compare two abundant intertidal Australian asterinid species with different dispersal biology over a small sympatric portion of their extensive geographic ranges. More recent population genetic studies used anonymous dominant nuclear markers (AFLPs; Baus et al., 2005) or a single mtDNA locus (Colgan et al., 2005). Other mtDNA surveys that emphasized phylogeographic hypotheses have been limited by the presence and diversity of cryptic species with population samples (Waters and Roy, 2004a; Hart et al., 2006) and small population samples (Waters and Roy, 2004b; Waters et al., 2004a).

Analysis of the size variation in microsatellite alleles offers several advantages over other classes of genetic markers (Selkoe and Toonen, 2006): co-dominance, high polymorphism, low cost per sample and locus, large numbers of variable loci with potential broad coverage of the genome, and analysis of preserved or very small tissue samples (even single embryos). Microsatellites are known from one sea star species, the crown-of-thorns A canthaster planci (Yasuda et al., 2006), but appear to be rare in the genomes of some other sea stars (Baus et al., 2005; Harper and Hart, 2005). Here we describe the development and application of a large new suite of microsatellite markers for comparative analysis of genetic variation in asterinid population genetics. Genotyping results from two species show among-locus variation in polymorphism, inbreeding coefficients, and range of cross-amplification. We note some correlations among these three variables, and discuss the implications for use of different marker combinations in analyses of population structure and gene flow.

Materials and Methods

Microsatellite identification from pooled genomic DNA

We used standard proteinase K digestion and phenolchloroform extraction methods to obtain genomic DNA from gonads (of large-bodied species) or whole rays (in some small-bodied species). We sampled two to five individuals from each of eight asterinid species in five genera collected from shallow coastal habitats of southern and eastern Australia and western North America: Cryptasterina hystera Dartnall et al. 2003 and C. pentagona (Muller and Troschel, 1842) from central and northern Queensland, respectively; Meridiastra calcar (Lamarck, 1816) and M. oriens O' Loughlin, 2002 (New South Wales); Parvulastra exigua (Lamarck, 1816) (New South Wales) and P. parvivipara Keough and Dartnall, 1978 (South Australia); Patiria miniata (Brandt, 1835) (British Columbia); Patiriella regularis (Verrill, 1867) (Tasmania). We chose these species in order to increase the likelihood that we would sample microsatellites from different clades, modes of reproduction, and biogeographic regions.

Genetic Identification Services (GIS, Chatsworth, CA) pooled similar amounts of high molecular weight genomic DNA from each species above (one or two individuals per species; 10 individuals in total). This bulk genomic DNA was partially digested and then size-selected for fragments about 300-700 bp in length. These fragments were cloned into plasmid libraries enriched for CA, ATG, CAG, and TAGA microsatellite motifs using a method (Jones et al., 2002) that eliminates the need for probing (for detailed methods and recent examples see Tarvin, 2006; Carlon and Lippe, 2007; Hull et al., 2007). We deliberately sequenced and PCR-tested more ATG and CAG clones and fewer CA or TAGA clones as a compromise between the expected lower polymorphism of tetranucleotides and the higher rate of nonspecific stuttering (and errors in allele size estimation) in dinucleotide PCR amplifications.

GIS sequenced randomly selected clones using standard DY Enamic ET Terminator cycle sequencing reagents on an ABI model 377 DNA sequencer. DesignerPCR 1.03 (Research Genetics, Inc.) was used to select PCR primer sequences of similar length and melting temperature for each candidate clone. Primers were then tested under standard PCR conditions. PCR cocktails contained 6.15 [micro]1 water, 1.0 [micro]1 pf 10 X enzyme buffer, 0.4 [micro]1 of 50 mmol [1.sup.-1] MgC[1.sub.2], 0.8 [micro]1 of 2.5 mmol [1.sup.-1] dNTP mix, 0.3 [micro]1 of 20 [micro]mol [1.sup.-1] forward and reverse primers, 0.05 [micro]1 of 5 units [micro][1.sup.-1] BioTaq (Bioline USA Inc.), and 1 [micro]1 of 2 ng [micro][1.sup.-1] template DNA. PCR reactions were denatured at 94 [degrees]C (180 s), followed by 35 cycles of 94 [degrees]C (40 s), 55-57 [degrees]C (40 s), 72 [degrees]C (30 s), and a final extension step of 72 [degrees]C (240 s). Annealing temperature varied slightly among microsatellites depending on predicted primer melting temperatures. PCR products were visualized on 1% agarose gels and scored for qualitative presence or absence of a product similar to the expected size (based on the cloned fragment).

Sequence analysis of clones

Primer pairs designed from 45 clone sequences (GenBank accession numbers EF106738-EF106783) produced consistent amplification results under the standard conditions above. We searched these clones against other echinoderm sequences (txid: 7586) in the nonredundant nucleotide and protein databases using BLAST 2.2.17 (www.ncbi.nlm.nih.gov/BLAST). We used these results to identify microsatellite clones that were strongly similar to other nucleotide sequences (BLASTn, optimized for somewhat similar sequences) or to gene predictions or identified protein-coding genes (BLASTx). All sets of significant BLASTx matches included an open reading frame from the complete Strongylocentrotus purpuratus sea urchin genome. We further characterized these latter similarities by using the Basic Local Alignment Search Tool (BLAST) to compare individual sequences against the sea urchin database at the Human Genome Sequencing Center at Baylor College of Medicine (http://www.hgsc.bcm.tmc.edu/projects/seaurchin/) to obtain provisional gene identifications (GLEAN3 gene names). We then searched the partially annotated sea urchin genome (http://annotation.hgsc.bcm.tmc.edu/Urchin/cgi-bin/pubLogin.cgi) for these GLEAN3 genes.

Species assignment and cross-amplification of microsatellites

For each microsatellite that successfully cross-amplified in two or more species in preliminary testing, we assigned the cloned sequence to a single species by genotyping each of the individual sea stars in those species for which genomic DNA was used in library construction. We used the GIS standard PCR conditions (above) with the following modifications: we used Tsg DNA polymerase (BioBasic) in place of BioTaq; we added 0.8 [micro]1 of 25 mmol [1.sup.-1] [Mgcl.sub.2] stock to the PCR cocktail (and adjusted and d[H.sub.2]0 amount accordingly); we labeled the 5' end of one forward primer with LI-OCR IRDye700 or IRDye800 infrared dyes; we diluted the 100 [micro]mol [1.sup.-1] labeled primer stock 1:99 in 10 [micro]mol [1.sup.-1] unlabeled primer (to reduce background signal); for one trinucleotide (B105) we slightly increased the annealing temperature (58 [degrees]C) and reduced the [MgCl.sub.2] concentration (0.5 [micro]1) to reduce shadow banding. These PCR products were resolved in 25 mm 6% acrylamide gels on a LI-COR 4300 genetic analyzer with IRDye-labeled size standards. Fragment sizes were scored from gel images analyzed in Gene ImageIR (release 2004; LI-COR).

We further explored the cross-amplification of these microsatellites in the Atlantic genus (Asterina) that is the sister group to the major Indo-Pacific asterinid clade (Hart et al., 1997; O'Loughlin and Waters, 2004; Waters et al., 2004b; Keever and Hart, 2008) from which we sampled all eight species in our microsatellite libraries. We tested 11 loci that were known to broadly cross-amplify among Indo-Pacific species. We used a sample of 10 individual A. gibbosa genomic DNA extractions from a single population from Wales that had been included in a recent AFLP study (Baus et al., 2005). We used the modified PCR conditions noted above but with a lower annealing temperature (50 [degrees]C) and fewer amplification cycles (30).

Population polymorphism

We genotyped 30 individuals of Meridiastra calcar from one population (Shell Harbour, New South Wales) at seven polymorphic trinucleotide loci (B202, B236, C8, C112, C114, C204a, C232), and 48 individuals of Patiria miniata from one population (Bamfield, British Columbia) at two of the same loci (B202, C8) plus five others (B11, B201, B209, C113, C210). In both cases, these loci had been chosen independently (by CCK and JS, respectively) for ongoing population genetic analyses on the basis of preliminary surveys of polymorphism and repeatability of PCR amplification and allele size estimation. We extracted DNA from individual tube feet using a simple proteinase K digestion (Addison and Hart, 2004). We used the modified PCR conditions and methods noted above. We estimated allele and genotype frequencies, inbreeding coefficients ([F.sub.IS], by the Weir and Cockerham method), departure from Hardy-Weinberg equilibrium (by the exact test), and linkage disequilibrium using the web-based version of GENEPOP ver. 3.1c (Raymond and Rousset, 1995). For the last two analyses, we used the Bonferroni correction for multiple tests.

Results

Microsatellite characteristics

We obtained positive test results for 45 primer pairs that included five CA repeats (labeled A in Appendix Table 1), 19 ATG (B), 18 CAG (C), and 3 TAGA (D). All CA and TAGA repeats were simple and uninterrupted (with the minor exception of a probable A[right arrow]C transversion in clone A4). In contrast, 7 of 19 clones containing ATG repeats and 12 of 18 CAG repeats included nonrepetitive interruptions caused by deletions or substitutions, or consisted of two or three similar repeated motifs, or included a compound repeat consisting of two similar trinucleotides.

BLASTn comparisons of cloned sea star sequences produced four notable matches to other echinoderm nucleotide sequences. One ATG trinucleotide clone (B101) was strongly similar (expectation value E = 5 X [10.sup.-24]) to the 3' untranslated region in the genomic DNA sequence for the DNA binding protein Ap-Zic from another asterinid, Patiria pectinifera (AB231872; Aruga et al., 2006). Two other clones (B202, B236) resembled sea urchin protein coding genes: B202 included an open reading frame strongly similar to the Nk-class homeodomain protein Sp-Nk7 (E = 8 X [10.sup.-28]); B236 was similar to the cell surface protein SRCR (scavenger receptor cysteine-rich, E = 5 X [10.sup.-5]). The 3' flanking region of one CA dinucleotide clone (A4) was similar (E = 2 X [10.sup.-9]) to the flanking sequence of a CA dinucleotide from Acanthaster planci (AB220018). Two clones (C114, C227) showed highly significant (E = [10.sup.-129]) nucleotide similarity to each other. These sequences might represent two alleles at a single locus, but the clones showed considerable sequence divergence (48 nucleotide substitutions, 11.8%).

BLASTx comparisons to coding sequences produced three matches to sea urchin genes (Appendix Table 1). All matches involved ATG or CAG repeats. Two of these strong similarities were to the predicted protein sequences from some sea urchin open reading frames to which we also found significant nucleotide sequence matches (B202, Sp-Nk7; E = 7 X [10.sup.-17]) (B236, SRCR; E = 1 X [10.sup.-12]). A third clone (B114) included an open reading frame similar (E = 1 X [10.sup.-5]) to a sea urchin adhesion protein in the extracellular matrix (anosim-1 or KAL-1, defective in human Kallmann syndrome). This locus was also a highly similar match (E = 1.3 X [10.sup.-12]) to a recent unannotated expressed sequence tag (DB439856) cloned from 45-h-old embryos of Patiria pectinifera (K. Tachibana, Y. Suzuki, T. Shin-i, Y. Kohara, M. Sugano, T. Kishimoto, Center for Genetic Resource Information, National Institute of Genetics, Shizuoka, Japan; unpubl. data).

Species assignment of loci

Of 45 clones, 39 (0.87) could be unambiguously assigned to one of eight species (and in some cases to individual sea stars in the genomic DNA pool). The number of clones assigned to each species varied from 2 to 10 (Appendix Table 2). A majority of clones (25) were isolated from one clade consisting of the sister genera Meridiastra + Patiria (Appendix Table 2). Six other microsatellites could not be reliably assigned to individual species either because the cloned allele size was found in individuals from two or more species (B106, B202, B234, B236) or because the cloned allele size was not found among any individuals that were genotyped (B222, C112).

Cross-amplification patterns

A majority of microsatellites (23/45) could be cross-amplified in more than one Indo-Pacific species from the genomic DNA pool (Appendix Table 2). These included all of the clones with open reading frames similar to sea urchin genes that encode transcription factors and cell surface proteins. Two of these microsatellites could be amplified in all eight species from the genomic DNA pool, but one was fixed for a single allele (B236, SRCR), while the other was polymorphic within and between species (B202, Sp-Nk7; see below). We found no strong correlation between the number of amplifiable species (1-8) and either (i) the cloned allele size (109-299 bp; r = -0.012, P = 0.934) or (ii) the length of the repeat motif (2-4 bp; r = 0.079, P = 0.602). We found a weak association between motif type and broad cross-amplification: of the 13 microsatellites that could be broadly cross-amplified in four or more species, 12 were ATG (4) or CAG (8) repeat motifs, but this slight difference between cross-amplification of trinucleotides (12/37) versus other motifs (1/8) was not significant by Fisher's exact test (P = 0.252). We found a weak correlation (r = 0.444, P = 0.272) between the number of microsatellite clones assigned to a species (2-10) and the number of other microsatellites that could be cross-amplified in the same species (7-12).

Five of 11 microsatellites that were broadly cross-amplified among Indo-Pacific species could also be amplified in the outgroup Asterina gibbosa. The success or failure of these cross-amplifications was not obviously associated with repeat motif or interruptions, species to which the clone was assigned, or the number of Indo-Pacific species in which the microsatellite could be amplified. All five of the successfully cross-amplified markers were fixed for a single allele size in our small sample of 10 A. gibbosa individuals. This lack of variation is surprising: three of these microsatellites (B202, C8, C204a) are known to be polymorphic in Indo-Pacific species (Appendix Table 3, see below), and previous studies show within-population variation in dominant AFLP fingerprints of A. gibbosa (Baus et al., 2005).

Population polymorphism

Within single Patiria miniata and Meridiastra calcar population samples we found 2-10 alleles per microsatellite (Appendix Table 3) and broad ranges of observed (0.10-0.72) and expected (0.12-0.79) heterozygosities. We found no pairs of microsatellites in significant linkage disequilibrium in either species. In each species, two microsatellites showed high inbreeding coefficients and significant heterozygote deficits relative to Hardy-Weinberg equilibrium expectations. We found the highest number of alleles (C210) and highest inbreeding coefficients (B11) at some loci that amplified in only one species (Appendix Table 3), and the lowest values of both variables at a locus that cross-amplified in all species tested (B202). Over all 14 samples (including pseudoreplication of B202 and C8), both number of alleles (r = --0.566, P = 0.016) and inbreeding coefficient (r = --0.567, P = 0.016) were significantly correlated with breadth of cross-amplification. However, this conclusion depended to some extent on including both samples of a microsatellite (B202) with the broadest cross-amplification and lowest genetic diversity. When we dropped two of the pseudoreplicated observations (n = 12) from either P. miniata or M. calcar, these four correlations were of similar sign and magnitude but of marginal statistical significance (0.039 [less than or equal to] P [less than or equal to] 0.084). We found similarly marginal statistical significance when we analyzed just the seven micro-satellites from P. miniata that differed broadly in breadth of cross-amplification (number of alleles,, r = -0.625, P = 0.071; inbreeding coefficient, r = -0.651, P = 0.060).

Discussion

The among-species and among-clade differences in the number of cloned microsatellites highlight one of the potential pitfalls of our microsatellite isolation approach using pooled genomic DNA. The pooling approach helps to ensure that all microsatellites from different species are isolated simultaneously under identical enrichment conditions (and at 1/n the cost for libraries developed for each of n species). However, libraries enriched for microsatellites from single species (at higher cost) could have allowed us to find many more markers from Cryptasterina and Parvulastra species and avoid the potential effects of using mostly cross-amplified markers in population analyses of those species (see below).

Many published microsatellite descriptions (primer notes) do not specifically include BLAST sequence comparisons to known genes, but we found some broadly cross-amplifiable microsatellites that we confidently identify with coding sequences. Several empirical studies and reviews have noted broader cross-amplification among microsatellites in genes identified from expressed sequence tags than among microsatellites isolated from genomic DNA (see Bouck and Vision, 2007). Thus, these markers might be used in many asterinid species but should be scrutinized for unusual patterns of variation. These anomalies might include low allelic polymorphism or nonconformation to the Ewens-Watterson sampling distribution caused by functional constraints on the gene product (e.g., Li et al., 2002, 2004) or by strong allelic divergence associated with adaptive features of gene function and microsatellite allele size effects (e.g., Hammock and Young, 2004).

Microsatellites often show high inbreeding coefficients that may be caused by segregation of null alleles. This can be due to evolutionary divergence of flanking sequences that include the PCR primer sites (Selkoe and Toonen, 2006). In two population samples we found a few examples of high inbreeding coefficients associated with significant heterozygote deficits (Appendix Table 3). High rates of sequence evolution and high frequencies of microsatellite and allozyme null alleles may be associated with biological and demographic variables such as mating system differences among species (Zouros and Foltz, 1984; Addison and Hart, 2005).

One goal of our microsatellite development was the discovery of broadly cross-amplifiable markers. Cross-amplification varied considerably among loci (Appendix Table 2), and we found some evidence that breadth of cross-amplification was negatively correlated with allelic diversity and inbreeding coefficients (Appendix Table 3). These associations are similar to the ascertainment bias frequently observed in microsatellite cross-amplifications and assumed to be caused by aspects of microsatellite enrichment or isolation that favor the discovery of longer alleles in the target species relative to shorter alleles (with less allelic diversity) at the same loci when cross-amplified in other species (e.g., Ellegren et al., 1995; Hutter et al., 1998). Other empirical studies and reviews have also suggested a broad correlation between the rate of microsatellite sequence evolution and allelic richness, inbreeding coefficients, and frequency of null alleles (Rungis et al., 2004; Pashley et al., 2006). These correlations suggest the need for awareness of among-marker variation and careful selection of markers in asterinid population analyses that use many cross-amplified markers in species or clades (Cryptasterina, Parvulastra) from which we cloned few microsatellites. Such studies could be biased toward lower allelic richness and lower inbreeding coefficients (compare to Primmer et al., 1996; Barbara et al., 2007). These patterns also argue for the development and use of improved standardization methods in estimates of population differentiation (Hedrick, 2005; Meirmans, 2006) in population analyses using these markers.

Acknowledgments

Thanks to Jason Addison (UC Davis), Mark Todd (Genetic Identification Services), Mando Beciaris, Kate Grazier, and Samson Wu (SFU) for laboratory assistance or comments. David Garfield (Duke University) helped us search for sea urchin genes. David Darrock and Mike Bruford (Cardiff University) gave us Asterina gibbosa DNA samples. This work was supported by research grants from the Natural Sciences and Engineering Research Council (MWH), Simon Fraser University (MWH), the Australian Research Council (MB), and the National Science Foundation (R. K. Grosberg and R. Toonen).

Literature Cited

Addison, J. A., and M. W. Hart. 2004. Analysis of population genetic structure of the green sea urchin (Strongylocentrotus droebachiensis) using microsatellites. Mar. Biol. 144: 243-251.

Addison, J. A., and M. W. Hart. 2005. Spawning, copulation and inbreeding coefficients in marine invertebrates. Biol. Lett. 1: 450-453.

Aruga, J., A. Kamiya, H. Takahashi, T. J. Fujimi, Y. Shimizu, K. Ohkawa, S. Yazawa, Y. Umesono, H. Noguchi, T. Shimizu, et al. 2006. A wide-range phylogenetic analysis of Zic proteins: implications for correlations between protein structure conservation and body plan complexity. Genomics 87: 783-792.

Barbara, T., C. Palma-Silva, G. M. Paggi, F. Bered, M. F. Fay, and C. Lexer. 2007. Cross-species transfer of nuclear microsatellite markers: potential and limitations. Mol. Ecol. 16: 3759-3767.

Baus, E., D. J. Darrock, and M. W. Bruford. 2005. Gene-flow patterns in Atlantic and Mediterranean populations of the Lusitanian sea star Asterina gibbosa. Mol. Ecol. 14: 3373-3382.

Bouck, A., and T. Vision. 2007. The molecular ecologist's guide to expressed sequence tags. Mol. Ecol. 16: 907-924.

Byrne, M. 1995. Changes in larval morphology in the evolution of benthic development by Patiriella exigua (Asteroidea: Asterinidae), a comparison with the larvae of Patiriella species with planktonic development. Biol. Bull. 188: 293-305.

Byrne, M. 2005. Viviparity in the sea star Cryptasterina hystera (Asterinidae)--Conserved and modified features in reproduction and development. Biol. Bull. 208: 81-91.

Byrne, M. 2006. Life history diversity and evolution in the Asterinidae. Integr. Comp. Biol. 46: 243-254.

Byrne, M., and A. Cerra. 1996. Evolution of intragonadal development in the diminutive asterinid sea stars Patiriella vivipara and P. parvivipara with an overview of development in the Asterinidae. Biol. Bull. 191: 17-26.

Byrne M., M. W. Hart, A. Cerra, and P. Cisternas. 2003. Reproduction and larval morphology of broadcasting and viviparous species in the Cryptasterina species complex. Biol. Bull. 205: 285-294.

Carlon, D. B., and C. Lippe. 2007. Isolation and characterization of 17 new microsatellite markers for the ember parrotfish Scarus rubroviolaceus, and cross-amplification in four other parrotfish species. Mol. Ecol. Notes 7: 613-616.

Colgan, D. J., M. Byrne, E. Rickard, and L. R. Castro. 2005. Limited nucleotide divergence over large spatial scales in the asterinid sea star Patiriella exigua. Mar. Biol. 146: 263-270.

Ellegren, H., C. R. Primmer, and B. C. Sheldon. 1995. Microsatellite 'evolution': directionality or bias? Nat. Genet. 11: 360-362.

Emson, R. H.. and R. G. Crump. 1984. Comparative studies on the ecology of Asterina gibbosa and Asterina phylactica at Lough Ine. J. Mar. Biol. Assoc. UK 64: 35-53.

Hammock, E. A. D., and L. J. Young. 2004. Functional microsatellite polymorphism associated with divergent social structure in vole species. Mol. Biol. Evol. 21: 1057-1063.

Harper, F. M., and M. W. Hart. 2005. Gamete compatibility and sperm competition affect paternity and hybridization between sympatric Asterias sea stars. Biol. Bull. 209: 113-126.

Hart, M. W., M. Byrne, and M. J. Smith. 1997. Molecular phylogenetic analysis of life history evolution in asterinid starfish. Evolution 51: 1848-1861.

Hart, M. W., C. C. Keever, A. J. Dartnall, and M. Byrne. 2006. Morphological and genetic variation indicate cryptic species within Lamarck's little sea star, Parvulastra ( = Patiriella) exigua. Biol. Bull. 210: 158-167.

Hedrick, P. W. 2005. A standardized genetic differentiation measure. Evolution 59: 1633-1638.

Hull, J. M., D. Tufts, J. R. Topinka, B. May, and H. B. Holly. 2007. Development of 19 microsatellite loci for Swainson's hawks (Buteo swainsoni) and other buteos. Mol. Ecol. Notes 7: 346-349.

Hunt, A. 1993. Effects of contrasting patterns of larval dispersal on the genetic connectedness of local populations of two intertidal starfish, Patiriella calcar and P. exigua. Mar. Ecol. Prog. Ser. 92: 179-186.

Hutter, C. M., M. D. Schug, and C. F. Aquadro. 1998. Microsatellite variation in Drosophila melanogaster and Drosophila simulans: a reciprocal test of the ascertainment bias hypothesis. Mol. Biol. Evol. 15: 1620-1636.

Jones, K. C., K. F. Levine, and J. D. Banks. 2002. Characterization of 11 polymorphic tetranucleotide microsatellites for forensic applications in California elk (Cervus elaphus canadensis). Mol. Ecol. Notes 2: 425-427.

Keever, C. C., and M. W. Hart. 2008. Something for nothing? Reconstruction of ancestral character states in asterinid sea star development. Evol. Dev. 10: 62-73.

Law, R. J., and C. Kelly. 2004. The impact of the "Sea Empress" oil spill. Aquat. Living Resour. 17: 389-394.

Li, Y. C., A. B. Korol, T. Fahima, A. Beiles, and E. Nevo. 2002. Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review. Mol. Ecol. 11: 2453-2465.

Li, Y. C., A. B. Korol, T. Fahima, and E. Nevo. 2004. Microsatellites within genes: structure, function, and evolution. Mol. Biol. Evol. 21: 991-1007.

Meirmans, P. G. 2006. Using the AMOVA framework to estimate a standardized genetic differentiation measure. Evolution 60: 2399-2402.

O'Loughlin, P. M., and J. M. Waters. 2004. A molecular and morphological revision of genera of Asterinidae (Echinodermata: Asteroidea). Mem. Mus. Vic. 61: 1-40.

Pashley, C. H., J. R. Ellis, D. E. McCauley, and J. M. Burke. 2006. EST databases as a source for molecular markers: lessons from Helianthus. J. Hered. 97: 381-388.

Primmer, C. R., A. P. Moller, and H. Ellegren. 1996. A wide-range survey of cross-species microsatellite amplification in birds. Mol. Ecol. 5: 365-378.

Raymond, M., and F. Rousset. 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered. 86: 248-249.

Rungis, D., Y. Berube, J. Zhang, S. Ralph, C. E. Ritland, B. E. Ellis, C. Douglas, J. Bohlmann, and K. Ritland. 2004. Robust simple sequence repeat markers for spruce (Picea spp.) from expressed sequence tags. Theor. Appl. Genet. 109: 1283-1294.

Selkoe, K. A., and R. J. Toonen. 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol. Lett. 9: 615-629.

Tarvin, K. A. 2006. Polymorphic microsatellite loci from the American goldfinch (Carduelis tristis) and their cross-amplification in a variety of passerine species. Mol. Ecol. Notes 6: 470-472.

Waters, J. M., and M. S. Roy. 2004a. Out of Africa: the slow train to Australasia. Syst. Biol. 53: 18-24.

Waters, J. M., and M. S. Roy. 2004b. Phylogeography of a high-dispersal New Zealand sea star: does upwelling block gene flow? Mol. Ecol. 13: 2797-2806.

Waters, J. M., P. M. O'Loughlin, and M. S. Roy. 2004a. Cladogenesis in a starfish species complex from southern Australia: evidence for vicariant speciation? Mol. Phylogenet. Evol. 32: 236-245.

Waters, J. M., P. M. O'Loughlin, and M. S. Roy. 2004b. Molecular systematics of some Indo-Pacific asterinids (Echinodermata, Asteroidea): Does taxonomy reflect phylogeny? Mol. Phylogenet. Evol. 30: 872-878.

Yasuda, N., S. Nagai, M. Hamaguchi, C. L. Lian, and K. Nadaoka. 2006. Development of microsatellite markers for the crown-of-thorns starfish Acanthaster planci. Mol. Ecol. Notes 6: 141-143.

Zouros, E., and D. W. Foltz. 1984. Possible explanations of heterozygote deficiency in bivalve molluscs. Malacologia 25: 583-591.
Appendix Characterization, cross-amplification, and polymorphism of
asterinid sea star microsatellite loci
Appendix Table 1
Microsatellite sequence accession numbers, repeats, and PCR primers

         GenBank
Name   accession no.                           Repeat

A4     EF106738.1     [(CA).sub.7]CC[(CA).sub.6]

A102   EF106739.1     [(CA).sub.7]

A104   EF106740.1     [(CA).sub.14]

A108   EF107741.1     [(CA).sub.11]

A110   EF106742.1     [(CA).sub.13]

B3     EF106743.1     [(ATG).sub.6]

B4a    EF106745.1     [(ATG).sub.6]ATA[(ATG).sub.2]CTGATGATA
                      [(ATG).sub.2]

B6     EF106745.1     ATG[(ATTG).sub.2]ATGAG[(ATG).sub.3]

B11    EF106746.1     [(ATG).sub.8]

B101   EF106747.1     [(ATG).sub.5]

B105   EF106748.1     [(ATG).sub.2]AGG[(ATG).sub.2][(AGG).sub.2]
                      [(ATG).sub.3][(AGG).sub.4][(ATG).sub.2]
                      GGGAGG[(ATG).sub.2]

B106   EF106749.1     [(ATG).sub.5]

B110   EF106750.1     [(ATG).sub.8]

B114   EF106752.1     [(ATG).sub.9]

B201   EF106753.1     [(ATG).sub.6]

B202   EF106754.1     [(ATG).sub.5][(ACG).sub.2][(ATG).sub.5]

B209   EF106755.1     [(ATG).sub.3]GAG[(ATG).sub.4]s

B212   EF106756.1     [(ATG).sub.7]

B222   EF106757.I     [(ATG).sub.2],AATTTG[(ATG).sub.4]ATA[(ATG).sub.3]

B227   EF106758.1     [(ATG).sub.7]

B228   EF106759.1     [(ATG).sub.6]

B231   EF106760.1     [(ATG).sub.8]

B234   EF106761.1     [(ATG).sub.6]

B236   EF106762.1     [(ATG).sub.5],ATA[(ATG).sub.3]

C8     EF106763.I     [(CAG).sub.4]CAACAT[(CAG).sub.4]CAC[(CAG).sub.2]
                      CAACCG[(CAG).sub.4]

CI04   EF106764.1     [(CAG).sub.11]

C107   EF106765.1     [(CAT).sub.4][(CAA).sub.3]GAA[(CAA).sub.2],
                      GAA[(CAA).sub.5]GAACAAAAA[(CAA).sub.6],
                      [(CAG).sub.8]CAACAG[(CAA).sub.3][(CAG).sub.3]

C111   EF106766.1     [(ACC).sub.3]AGCAT[(CAG).sub.4]

CI12   EF106767.1     [CAG).sub.3](CAA).sub.2][(CAG).sub.3]
                      [(CAA).sub.2][(CAC).sub.5]CAACAG[(CAA).sub.4]
                      [(CAG).sub.7]

C113   EF106768.1     [(CAG).sub.7]

C114   EF106769.1     [(CAG).sub.7]

C115   EF106770.1     [(CAG).sub.8]CAA[(CAG).sub.3][(CAACAG).sub.4]
                      [(CAG).sub.2]

C204a  EF106771.1     [(CAG).sub.2]CAA[(CAG).sub.5][(CAACAG).sub.2]

C207   EFI06772.1     [(CAG).sub.4]CACCAA[(CAG).sub.2]CAA[(CAG).sub.3]
                      [(CAA).sub.2]

C210   EF106773.1     [(CAG).sub.5][(CAA).sub.8]CAT(CAG),[(CAA).sub.4]
                      CATGAA[(CAG).sub.10][CAA).sub.5]

C212   EF106774.1     [(CAA).sub.3][(CAG)sub.3]CAA[(CAG)sub.2]
                      CAA[(CAG)sub.3]

C213   EFI06775.I     [(CAG)sub.9]

C216   EF106776.1     [(CAG)sub.7]

C219   EF106777.1     [(CAG)sub.3]CA[(CAG)sub.3]

C227   EF106778.1     [(CAG)sub.7]

C231   EFI06779.I     [CAG).sub.4]CAA[(CAG).sub.4]CAA[(CAG).sub.2]
                      CAA[(CAG).sub.3]

C232   EF106780.1     [(CAG).sub.4]CAACAGCAACTGCAGTGG[(CAG).sub.6]
                      CAA[(CAG).sub.2]CAA[(CAG).sub.2]

D8     EFI06781.1     [(TAGA.sub.7]

D114   EF106782.I     [(TAGA.sub.12]

D127   EF106783.1     [(TAGA.sub.16)]

Name   Label                         Primers

A4     IRDYe  700  5'  CGACGACGGAAGTAAGTTCGGGAAAACAAAGGAAAGTCC

A102   IRDYe  800  5'  GCCTTATGAGGACCATTGGCGTGGCTATTCAGAGAAC

A104   IRDYe  700  5'  GCCTTATGAGGACCATTTGGGGGAATGGGATTTACTATTC

A108   IRDYe  800  5'  ATGGATCTCACCAAGTAGACAGCACAGGACGTATGTAACAACAG

A110   IRDYe  700  5'  GGTCGGTCGATATTAGATTGCGAAGGGGAGAGACAGCTCAG

B3     IRDYe  700  5'  AGGGATAAAAACACCTGGTGTTTCTGTTGACTTGCAGTAACC

B4a    IRDYe  700  5'  AAGCATCAGCATCATTATTAGCAAGACGCCTTCAAGAAAATC

B6     IRDYe  800  5'  GCATTCATCGGTCTCGTCGATCCAAGGGGAGGACTG

B11    IRDYe  800  5'  GCATTCATCGGTCTCGTCGATCCAAGGGGAGGACTG

B101   IRDYe  700  5'  CACACCGTTCGTTTTTAGTCTTTGGACCGCTATTCACTTAC

B105   IRDYe  700  5'  CCCCGTGTCTTGGTTTTCATGAGGAAGATGAAGGTGGAG

B106   IRDYe  700  5'  TGACGGTAAAAAGAAGTTTGCGCCATAATCATCATCATCCTC

B110   IRDYe  700  5'  GCAGATACTTCAGGGTTGTGACGATGACGATGATGATGTT

B114   IRDYe  800  5'  GCCCAGGACACAAGAAGTGGGAGCCATAGGGAGAAAGC

B201   IRDYe  700  5'  CACTGCACATTGAGACTAACGCATCAGCAAGTACAAGGACAGT

B202   IRDYe  700  5'  ACCTCCATCTCATCGTCAGGGCAGAAACAGAGCAGTG

B209   IRDYe  800  5'  TTTCAGTTTCAGCAAGTAGACCAATCCTCTTCCATCTCCATATC

B212   IRDye  800  5'  GTGCCCGAGATGTTTTTCACCGCAAGATGCTACAATG

B222   IRDye  700  5'  CTGCGTAGAATGGTCTTAGTTCCTTTGAAAACAGGGGTATGTC

B227   IRDye  700  5'  TTTTTACGCTTGTGGTTTGACTCGCACTTTGCCTGATTC

B228   IRDye  800  5'  GACCAGTGAAGTGAACCAGTTCTTTTTCATGGCGAGTTAGGAC

B231   IRDye  700  5'  AGGGTATAGGAGACCCATCAGGCTTACTCAGCCACTTGAGAG

B234   IRDye  700  5'  TGGGTGACTTGTGATGAACTGAATGTTGGACTTGATGTG

B236   IRDye  800  5'  CCACAACAAGTGCTCAAACATCAAGTATCGCCAACTGTC

C8     IRDye  700  5'  TTACGGCAGTAGAACCCACTGGAGGAGTCAAAGGTGAG

CI04   IRDye  800  5'  GCTGACTTTGTGGCTTGACAATCGGTTTGTGCTGTCC

C107   IRDye  700  5'  TTATGACACCATTTCCCATATCCCATATCCCCTTGATCTCTC

C111   IRDye  700  5'  TTGCCACTGCTGTTGTAGGGCCAAATCGTGACAGGTG

CI12   IRDye  700  5'  TTTTGTCGGGACTGAACTTCGTTTGAAAGCAGCCTGAGTG

C113   IRDye  700  5'  CCCAGGCACACTTGATTGTCGGTTGGACCACTTTTG

C114   IRDye  700  5'  GTGGCAAGGATACCTCGTCGGGTTGACAAATCGTGGAG

C115   IRDye  700  5'  GATGGTCCTGTGTGTTTACGACTTGTTGGGCAAGCAGTTG

C204a  IRDye  800  5'  GTTGCTGTTGGTTTGGATACATCTTCTGCCATTTTCAGTTC

C207   IRDye  800  5'  TATGCCAGAGGCTATTCAGACTTGTTGCGAGGGAAGAG

C210   IRDye  700  5'  CAGTTTTCAACAACAGCAGATGGGTGGTATCATTGGAGAGTAGC

C212   IRDye  800  5'  GCTTGATTTTTTTTCCTCTCACCACTGCTGCTGGTGTTACTG

C213   IRDye  700  5'  CTCTCGGCAATCCTCATAGGACCAAGCAAATCTACAAAGAC

C216   IRDye  700  5'  GACCTGTCTATGATGCCCATACCAACCAGACTTACCTGTTGGAC

C219   IRDye  700  5'  CTGCTGTTGTTGCTGTTTCTGGAAGTTACCCGACTCC

C227   [RDye  800  5'  GCACACTTGTCGTAGCACTTGTCGGTCATCCAACACACAC

C231   IRDye  700  5'  CCACAATAGGAAATCGGTTACGAAGCCAAGAAACAGAAGAAG

C232   IRDye  700  5'  TTGCTCAGGGAACTGTCCGCGGAACTGTTGTTGATTG

D8     IRDye  800  5'  CGTGTTTGTATGTGTGTGTTTGGTCAGTTGGACTACGATGTGTC

D114   IRDye  800  5'  AAACGGAAGGCACAGTTCTCTCAAATGTCACCCATCTG

D127   IRDye       5'  ACGGCCAAATCCAAAATGGGAGGGAACAAGCATTGC

Primer oligonucleotide sequences (5' to 3') are shown for each clone.
Forward primers (top sequence for each microsatellite) were labeled
with LI-COR infrared dyes (IRDye 700 or 800).

Appendix Table 2
Microsatellite cross-amplification patterns

Genus                 Cryptasterina         Patiriella
                 C. pentagona  C. hystera  P. regularis

A4                     -            -            -
A102                   -           214           -
A104                   -            -            -
A108                  179           +            -
A110                   -            -            -
B3                     -            -            -
B4a                    -            -            -
B6                     +            +            -
Bll                    -            -            -
B101                   -            -            -
B105                   -            -            -
B106                   +            +            -
B110                   -            -            -
B114                   -            -            -
B201                   -            -            -
B202                   +            +            +
B209                   -            -            -
B212                   -            -           299
B222                   -            -            -
B227                  180           +            -
B228                   -            -            -
B231                  193           -            -
B234                   +            -            -
B236                   +            +            +
C8                     +            -            -
C104                   -            -            -
C107                   -            -            -
C111                   -            +            -
C112                   -            -            -
C113                   -            -            +
C114                   -            -            -
C115                   -            -            -
C204a                  -            -            +
C207                   -            -            -
C210                   -            -            -
C212                   -            -            -
C213                   -            -            -
C216                   -            -            -
C219                   +            +           165
C227                   -            -            +
C231                   -            -            -
C232                   -            -            +
D8                     -            -            +
D114                   -            -           232
D127                   -           200           -
Assigned                3            2            3
Cross-amplified         7            8            7

Genus                 Meridiastra        Patiria
                 M. calcar  M. oriens  P. miniata

A4                  181         +           -
A102                 -          -           -
A104                137         -           -
A108                 -          -           -
A110                 -          -           -
B3                   -          -          122
B4a                  +         123          -
B6                   -          +           +
Bll                  -          -          154
B101                 -         234          -
B105                 +         273          -
B106                 -          -           -
B110                 -          -          286
B114                256         -           -
B201                 -          -          294
B202                 +          +           +
B209                 -          -          148
B212                 -          +           -
B222                 +          +           -
B227                 -          -           -
B228                 -          -          208
B231                 -          -           -
B234                 +          +           -
B236                 +          +           +
C8                   +         151          +
C104                 -          -           -
C107                264         -           -
C111                 +         109          -
C112                 +          +           -
C113                 +          +          266
C114                 +         292          +
C115                 -          -           -
C204a                +         199          +
C207                 -          -           -
C210                 -          -          231
C212                 -          -           -
C213                 -         194          -
C216                202         -           -
C219                 -          +           +
C227                 -         187          +
C231                283         -           -
C232                143         +           -
D8                   -         279          -
D114                 -          -           -
D127                 -          -           -
Assigned              7         10           8
Cross-amplified      12         11           8

Genus                   Parvulastra
                 P. exigua  P. parvivipara  Total

A4                   -             -          2
A102                 -             -          1
A104                 -             -          1
A108                 -             -          2
A110                 +            226         2
B3                   -             -          1
B4a                  -             -          2
B6                  249            -          5
Bll                  -             -          1
B101                 -             -          1
B105                 -             -          2
B106                 -             -          2
B110                 -             -          1
B114                 -             -          1
B201                 -             -          1
B202                 +             +          8
B209                 -             -          1
B212                 -             -          2
B222                 -             -          2
B227                 -             -          2
B228                 -             -          1
B231                 -             -          1
B234                 +             -          4
B236                 +             +          8
C8                   -             -          4
C104                 -            230         1
C107                 -             -          1
C111                 -             -          3
C112                 +             +          4
C113                 +             +          6
C114                 +             -          4
C115                 -            249         1
C204a                -             -          4
C207                287            -          1
C210                 -             -          1
C212                 -            272         1
C213                 -             -          1
C216                 -             -          1
C219                 +             +          7
C227                 +             +          5
C231                 -             -          1
C232                 +             -          4
D8                   +             +          4
D114                 -             -          1
D127                 -             -          1
Assigned              2             4        39
Cross-amplified      11             7        71

Genus       Asterina   Strongylocentrotus
           A. gibbosa    S. purpuratus
                           GLEAN3 gene
A4
A102
A104
A108
A110
B3
B4a
B6             -
Bll
B101                        (Ap-Zic)
B105
B106
B110
B114                     28470: anosim-J
B201
B202           +         22573: Sp-Nk7
B209
B212
B222
B227
B228
B231
B234           -
B236           -           07839: SRCR
C8             +
C104
C107
C111
C112           -
C113           +
C114
C115
C204a          +
C207
C210
C212
C213
C216
C219
C227           +
C231
C232
D8             -
D114
D127
Assigned
Cross-
amplified

Successful (+) and unsuccessful (-) cross-amplification of each
microsatellite is indicated. Locus names are the same as in Appendix
Table 1. Numbers under taxon names are PCR product size for clones from
that species. Empty cells for Asterina gibbosa indicate amplifications
not attempted. Row totals show the number of successful amplifications
among Indo-Pacific asterinid species; column totals show number of
clones isolated from each species and number of additional cross
amplifications. Homologies of four clones to sea urchin or sea star
protein-coding genes are shown in the last column (and explained in the
text). The branching diagram above the genus names shows well-known
phylogenetic relationships based on mtDNA sequences (see Keever and
Hart, 2008).

Appendix Table 3
Polymorphism at 12 microsatellites in single population samples of
Meridiastra calcar (Mc) and Patiria miniata (Pm)

                           # Alleles  [H.sub.obs]

Name   # Species    Gene     Pm  Mc     Pm     Mc

B11    [1.sub.pm]             5       0.104
B201   [1.sub.pm]             8       0.542
B202       8       Sp-Nk7     2   3   0.229  0.200
B209   [1.sub.pm]             8       0.604
B234       4                      7          0.200
C8         4                  6   3   0.125  0.166
C112       4                      7          0.566
C113   [6.sub.pm]             8       0.729
C114       4                      3          0.133
C204a      4                      9          0.433
C210   [1.sub.pm]            10       0.583
C232   [4.sup.Mc]             8              0.600

        [H.sub.exp]     [F.sub.IS]

Name      Pm    Mc       Pm      Mc

B11     0.585          0.824
B201    0.647          0.165
B202    0.204  0.186  -0.119  -0.084
B209    0.752          0.197
B234                   0.190  -0.045
C8      0.120  0.156  -0.029  -0.058
C112           0.546          -0.036
C113    0.791          0.081
C114           0.293           0.550
C204a          0.660           0.348
C210    0.791          0.266
C232           0.736           0.189

Six microsatellites cloned from these species are indicated by
superscript acronyms; six others were cloned in other asterinid species
and cross-amplified in M. calcar (n = 30 individuals) or P. miniata (n
= 48 individuals). Locus names are the same as in Appendix Table 1.
Inbreeding coefficients ([F.sub.is) are based on observed ([H.sub.obs])
and expected ([H.sub.exp]) heterozygosities; those significantly
different from zero after Bonferroni correction are shown in bold
italics.


Received 11 February 2008; accepted 6 May 2008.

CARSON C. KEEVER (1), JENNIFER SUNDAY (1), CHARLENE WOOD (1), (2), MARIA BYRNE (3), AND MICHAEL W. HART (1), *

(1) Department of Biological Sciences, Simon Fraser University, Burnaby, British Columbia V5A 1S6. Canada; (2) Department of Renewable Resources, University of Alberta, Edmonton, Alberta T6G 2HI, Canada; and (3) Department of Anatomy and Histology, F-13, University of Sydney, 2006, Australia

* To whom correspondence should be addressed. E-mail: mike_hart@ sfu.ca
COPYRIGHT 2008 University of Chicago Press
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Keever, Carson C.; Sunday, Jennifer; Wood, Charlene; Byrne, Maria; Hart, Michael W.
Publication:The Biological Bulletin
Article Type:Report
Geographic Code:8AUST
Date:Oct 1, 2008
Words:5931
Previous Article:Parameterization and prediction of community interaction models using stable-state assumptions and computational techniques: an example from the high...
Next Article:Heat-shock protein 70 (Hsp70) expression in four limpets of the genus Lottia: interspecific variation in constitutive and inducible synthesis...
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |