Printer Friendly

Diferenciacion genetica de tilapia roja y gris (Oreochromis niloticus) mediante microsatelites y marcadores SCAR como indicadores del sexo genetico.

Genetic differentiation of red and gray tilapia (Oreochromis niloticus) using microsatellites and SCAR markers as indicators of genetic sex

Introduccion

Las especies de tilapia se cultivan en paises tropicales y subtropicales con exito productivo (Cnaani et al. 2008). En el Peru, la acuicultura de la tilapia no esta muy desarrollada comparada con otros paises latinoamericanos (Baltazar & Palomino 2004), como Brasil, Chile y Ecuador, que se ubican entre los 18 principales productores mundiales (FAO 2016).

Para obtener un optimo cultivo de tilapia es necesario considerar un adecuado manejo, alimentacion, buena calidad genetica y monosexo masculino (Ruiz 2012). Independientemente de la especie, raza o linea de la tilapia, los machos tienen la propiedad de crecer mas rapido que las hembras e invierten menos energia en la reproduccion, por lo que muchas investigaciones han enfatizado las tecnicas para la obtencion de poblaciones 100% machos geneticamente, pues tienen entre 20 y 30% mas peso que una hembra (Castillo 2011). Sin embargo, la gran diversidad de especies, poblaciones y linajes de tilapia, sumado a la similitud fenotipica de la morfologia corporal, dificulta su diferenciacion, lo que es indispensable para estudios de poblaciones, parentesco, manejo genetico y productivo. En este sentido, la contribucion de herramientas para la identificacion molecular ha significado un claro aporte en la descripcion de secuencias del ADN de la tilapia.

Sin embargo, las variaciones en los valores de diversidad genetica son propias de un lote poblacional particular. Por ejemplo, Guyon et al. (2010) reportaron alrededor de 1358 marcadores, de los cuales 154 fueron microsatelites de importancia para la evaluacion de la radiacion de hibridos y otras investigaciones. Cuevas (2010) estudiando Oreochromis aureus, O. niloticus y O. mossambicus estimo la variabilidad genetica con ocho microsatelites: UNH145, UNH155, UNH160, UNH166, UNH190, UNH207, UNH208 y UNH211; encontrando que O. mossambicus registraba los menores valores de heterocigosidad al ser comparada con O. aureus y O. niloticus. En el sur de China, con el uso de los microsatelites UNH995, UNH954, GM024, GM119, UNH738, UNH971, GM677, UNH860 y UNH932 se reportaron loci polimorficos y heterocigosidad sobre 0.39 en seis poblaciones de Oreochromis spp. (Dang-en Gu et al. 2014).

A diferencia de los anteriores marcadores, se reportan los microsatelites UNH995 y UNH104 asociados al sexo fenotipico en algunas familias de O. niloticus (Lee et al. 2003) y marcadores SCAR (sequence characterized amplified regions) relacionados con los cromosomas sexuales Y y X de O. niloticus (Sunet al. 2014). Estos marcadores son importantes para la diferenciacion del sexo en juveniles, que solo es posible cuando los peces superan los 100 g con la visualizacion de gonopodios.

Estas investigaciones son relevantes para O. niloticus, ya que la comprobacion de su repetitividad en diferentes familias facilitaria el sexaje a temprana edad. Las especies de tilapia tienen 44 cromosomas sin diferencias en el tamano ni forma de los cromosomas sexuales (McAndrew et al. 2016) y presentan un periodo de indiferenciacion en la morfogenesis hasta los 15 dias despues de la eclosion, que a pesar del sexo genetico queda definida en la singamia. La diferenciacion sexual fenotipica puede ser modificada por efectos de la variacion de la temperatura, salinidad u otros agentes quimicos, como hormonas (Faulkner et al. 1981, Devlin & Nagahama 2002).

Tanto los microsatelites como los marcadores SCAR son herramientas valiosas que deben ser evaluadas en las poblaciones con un plantel productivo y con mayor utilidad en un plantel orientado a la mejora genetica, como el de la Universidad Nacional de Trujillo, que cuenta con poblaciones de tilapia de linaje distinto, tilapia gris procedente de San Martin (Peru) y tilapia roja de TilAqua International (Paises Bajos).

El objetivo del presente trabajo fue evaluar los microsatelites del ADN para diferenciar linajes de tilapia gris y roja de la especie O. niloticus y la evaluacion de los marcadores SCAR en hembras y machos de tilapia roja y gris en dos generaciones Go y G1.

Material y metodos

Material biologico.--Las muestras fueron obtenidas del Centro Experimental de Genetica de la Universidad Nacional de Trujillo, Peru. Hembras XX y YY O. niloticus roja. G1 YY del cruce de machos YY con hembras YY O. niloticus roja. Machos XY y YY O. niloticus roja. Hembras XX y machos XY O. niloticus gris generaciones Go y G1.

La determinacion del sexo fenotipico se realizo por la observacion directa de las gonadas del individuo y el sexaje visual de las papilas genitales (Hussain 2004).

Extraccion de ADN total.--Se corto aproximadamente 15 mg de la aleta caudal de cada individuo. Las muestras fueron guardadas a -20 [grados]C por 24 horas. La extraccion del ADN total se realizo mediante la combinacion y modificaciones de los metodos descritos por Cawthom et al.(2011), Aljanabi & Martinez(1997) y Kunhareang et al. (2010) modificado, que consistio en colocar las muestras de la aleta caudal en un tubo de microcentrifuga de 1.5 mL, al cual se le agrego 800 pL de buffer de digestion (10 mMTRIS-HCL pH 8.0; 25 mM EDTA pH 8.0; 20 mM NaCl; 2% SDS; triton 0.5%, PVP 2%, mercaptoetanol 1%, 7 pL de proteinasa K 20 mg/mL), se agito en vortex por 30 segundos, se dejo reposar los tubos en forma horizontal por 15 minutos y se incubaron a 55 [grados]C por 1 hora. Se centrifugo a 14000 r.p.m. por 5 minutos, se transfirio 400 pL del sobrenadante a un tubo nuevo Eppendorf de 1.5 mL, se adiciono 100 pL de cloruro de sodio 6 M y se agito en vortex por 30 segundos.

De inmediato, se anadio 300 pL de cloroformo frio y se centrifugo a 14000 r.p.m. por 10 minutos a 4 [grados]C, luego se transfirio 200 pL de la fase acuosa superior a un nuevo tubo. El ADN se precipito agregando 200 pL de isopropanol, posteriormente se incubo a -20 [grados]C por 30 minutos. Se centrifugo a 14000 r.p.m. por 7 minutos a 4 [grados]C y se descarto el sobrenadante. Se lavo el pellet con 1ml de etanol al 70% y se seco durante 15 minutos a temperatura ambiente. El ADN fue resuspendido en 50 pL de buffer TE (10 mM TRIS -1mM EDTA con pH 8) y se almaceno a -20 [grados]C.

Electroforesis.--La visualizacion de los fragmentos de ADN se realizo en gel de agarosa al 1.5% tenido con SYBR Safe DNA. La electroforesis se llevo a cabo a 100 V, 100 mA por 30 minutos. Las bandas de ADN fueron fotografiadas en el fotodocumentador de imagenes BIO-RAD Molecular Imager ChemiDoc XR+ System. Se verifico la calidad del ADN extraido mediante la amplificacion del gen endogeno [beta]-actin.

Amplificacion de .ADN con microsatelites.--Los cebadores usados fueron: UNH190 (5 '-TGTCTGGACGCGCTTTTGT3'F y 5'-CGCGATCGAGCATTC-TAA-3'R), UNH136 (5-TGTGAGAATTCACATATCAC-TA-3'F y 5'-TACTCCAGTGACTCCTGA-3'R), UNH123 (5'ATCATCACAGACAGATTAGA-3'F y 5'-GATTGA-GATTTCATTCAAG-3'R) y UNH106 (5'-GTCTC-TTTCTCTGTCACAAG-3'F y 5'-CCTTCAGCATC-CGTATAT-3'R); UNH115 (5'-TCAAGCTAGCGATTTTT-3'R y 5'-ACCTTCATCTCGGTCAG-3'F), UNH995 (5'-G-CAGCACAACCACAGTGCTA-3'R y 5'-CCAGCCCTCTG-CATAAAGAC-3'F), GM271 (5'-TGGGAAGTCGTTCATACAAAG-3'R y 5'-GCAGCTGGATCAGTCTCTG3'F) y GM180 (5'-CGGCGGCGACTTGTAGTGTAA-3'F y 5'-GGACGGTCTGGCGAGGAC-3'R) (GenBank numero de accesiones: G12342, G12288, G12276, G12259, G12268, G68274, BV005386, BV005346).

Se estandarizo la temperatura de hibridacion de los microsatelites usando seis temperaturas distintas. Se uso el termociclador de Applied Biosystem Veriti de 96 pocillos de 0.2 mL.

La mezcla maestra se preparo de la siguiente manera: 2.5 [micron]L de buffer 10X PCR-buffer Mg[Cl.sub.2] Invitrogen, 0.75 [micron]L Mg[Cl.sub.2] 50 mM Invitrogen, 0.5 [micron]L dNTP 10 MmThermo Scientific, 1 [micron]L primer, 0.1 [micron]L Platinum[R] Taq DNA Polymerase Invitrogen, 18.15[my]l agua DEPC y 1 [micron]L ADN. La PCR se realizo con las siguientes condiciones: desnaturalizacion inicial a 95 [grados]C por 3 minutos, 35 ciclos de desnaturalizacion a 94 [grados]C por 30 segundos; la Tm vario de acuerdo con el primer por 45 segundos, extension 72 [grados]C por 1 minuto; extension final 72 [grados]C por 7 minutos.

Con los microsatelites UNH106, UNH136 y UNH995, y [beta] actin, se analizaron las poblaciones de tilapia roja y tilapia gris, en muestras de 25 individuos de cada linaje.

Amplificacion con marcadores SCAR (Sun et al. 2014). Los cebadores usados fueron SCAR-5F (TAAATTAATGACATTTCAGTTATG); SCAR-5R (CAGAAATGTAGACGCCAGGTATC); SCAR-5F-X (CTGGTTTGCAATAGTTAGGGTGCT); SCAR-5R-Y (TTA CAG CAC CCA GAG TCAT) (Sun et al. 2014).

Para la preparacion de la mezcla maestra se uso 2.5 pL 10x Coral Load PCR-Buffer Qiagen, 0.5 [micron]L dNTP 10 mM Thermo Scientific, 1 [micron]L primer, 0.125 [micron]L Hot Start Taq Plus, 15.875 [micron]L agua DEPC, 4 [micron]L ADN. La PCR se realizo con las siguientes condiciones: desnaturalizacion inicial a 94 [grados]C por 5 minutos, 34 ciclos de desnaturalizacion a 94 [grados]C por1 minutos; SCAR5F/5R-Y 53 [grados]C por 1 minutos, SCAR-5F-X/5R 63 [grados]C por un minuto, extension 72 [grados]C por un minuto; extension final 72[grados]C por 7 minutos.

Analisis de datos.--Se determino el tamano de cada producto amplificado mediante el software del fotodocumentador de geles ChemiDoc XR+ System. Se comparo el tamano de bp en los genotipos de hembras y machos en Oreochromis niloticus "tilapia gris" y "tilapia roja" y se evaluo cualitativamente la presencia o la ausencia de bandas para cada marcador.

Resultados

Se obtuvo ADN de tilapia de buena calidad con el protocolo modificado (Fig. 1). En la Tabla 1 y Figura 2 se presentan los resultados de estandarizacion de la temperatura de hibridacion para los microsatelites y SCAR-5F-X/5R y SCAR-5F/5R-Y, y de [beta]-actin, asi como el tamano de los productos amplificados por PCR. Los fragmentos de los microsatelites UNH190, UNH123, UNH136, UNH106, UNH115, UNH995, GM180 y GM271 fueron:178, 151, 172, 154, 143, 172, 171 y 702 bp, respectivamente. Para el SCAR-5F-X/5R fue de 903.30 [+ o -] 38.40 bp, para el SCAR-5F/5R-Y fue de 280 [+ o -] 17.29 bp y el tamano del fragmento amplificado para [beta]-actin fue de 715.0 [+ o -] 40.87 bp.

Los perfiles geneticos para los microsatelites UNH y GM fueron monomorficos. En la Figura 3, se observa muestras de individuos de tilapia gris y individuos de tilapia roja amplificados con UNH136 y UNH995 monomorficos con similar velocidad de migracion para ambos linajes. No obstante, con el marcador UNH106 no hubo amplificacion en ninguna muestra de los individuos de tilapia gris.

El marcador SCAR-5F-X/5R amplifico en todas las muestras de hembras grises y rojas, asi como en los machos grises y rojos excepto en los machos YY; de manera opuesta, con el marcador SCAR-5F/5R-Y se obtuvo producto amplificado en todas las muestras de los machos grises y machos rojos XY y YY (Fig. 4 a y b).

Asi tambien, los marcadores SCAR-5F-X/5R y SCAR-5F/5RY correlacionaron con el sexo fenotipico de las progenies G1 del cruce de hembra YY O. niloticus roja con macho YY O. niloticus roja y G1 del cruce de hembra XX y macho XY tilapia gris (Fig. 5 a y b).

Discusion

Las modificaciones realizadas tomando como base los metodos de extraccion de ADN de Aljanabi & Martinez (1997) y Kunhareang et al. (2010) permitieron mejorar la calidad del extracto de ADN de muestras de aleta caudal de tilapia. La adicion de triton al 0.5% en la mezcla del amortiguador de extraccion fue lo mas relevante de las modificaciones realizadas.

Los microsatelites, marcadores codominantes, se distinguen por su alto grado de polimorfismos que permiten detectar variaciones geneticas entre poblaciones y dentro de ellas (RomanaEguia et al. 2004). Sin embargo, requieren de estandarizacion tanto en la calidad del ADN extraido como en la hibridacion de los cebadores. Asi tambien, el tamano de fragmentos de los microsatelites puede diferir entre poblaciones, dependiendo del grado de diferenciacion genetica existente entre ellas.

En los resultados del trabajo, los tamanos de los fragmentos amplificados concordantes con los registrados en la base de datos del GenBank (htt//:www.ncbi.nlm.nih.gob) fueron: UNH136 (G12288),UNH190 (G12342), UNH123 (G12276), GM180 (BV005346), UNH106 (G12259)y UNH995 (G68274). Sin embargo, los fragmentos para UNH115 registraron 143 bp, lo que difiere de lo reportado por Lee et al. (2004) (G12268); para GM271 se registro 702 bp, distinto de los resultados de Lee et al. (2004) y Cnaani & Kocher 2008, quienes reportaron de 121 a 125 bp y de 96 a 110 bp, respectivamente. El fragmento amplificado del control interno PCR [beta] actin fue 715 bp, distinto de lo registrado por Jimenez et al. (2011).

Las diferencias en los fragmentos de la PCR, particularmente con el marcador GM271, se explicaria debido a la amplificacion intensificada en el proceso de replicacion, que suele ocurrir por la presencia de secuencias repetidas como los microsatelites (Leffak et al. 2016). La secuencia del gen endogeno [beta]-actin puede explicarse como consecuencia de una insercion en la secuencia. Sin embargo, se necesitan pruebas de secuenciacion y realizar una alineacion con la base de datos GenBank.

Del grupo de microsatelites evaluados en el Centro Experimental de Genetica de la Universidad Nacional de Trujillo, el UNH106 fue el unico microsatelite que permitio diferenciar geneticamente la tilapia roja de la tilapia gris y se obtuvo producto de la PCR en todas las muestras de tilapia roja; sin embargo, en las muestras de tilapia gris, la amplificacion fue negativa, debido probablemente a los cambios en la secuencia de hibridacion del genoma, lo que impidio la complementariedad de bases con uno o ambos cebadores utilizados.

Por otro lado, la presencia de los loci monomorficos analizados con los microsatelites UNH106, UNH136, UNH995 explica y confirma la variacion genetica reducida, propia de las lineas geneticas establecidas, con la evaluacion con microsatelites adicionales podria evidenciar con mayor aproximacion la variacion genetica existente. Estas difieren notoriamente de las poblaciones en las que se producen cruzamientos aleatorios y estan sujetas a efectos evolutivos, como las mutaciones, seleccion natural, migraciones o deriva genetica, como las reportadas por Hassanien & Gilbey (2005) en poblaciones de O. niloticus del rio Nilo. Para el marcador UNH106 se observo polimorfismo con el valor de 6.01 para el numero efectivo de alelos y heterocigosidad promedio de 0.76. Asi tambien, Brinez et al. (2011) y otras investigaciones registraron polimorfismos con distintos microsatelites.

Con relacion a la determinacion del sexo en la tilapia, la plasticidad genetica que presentan los genomas masculino y femenino, y la ocurrencia de cambios de expresion de los genes en las etapas iniciales de diferenciacion gonadal dificultan el manejo de cruzamientos. Puede darse el caso de que fenotipicamente un individuo sea macho cuando geneticamente estaba programado para ser hembra y viceversa. Por ello, es necesaria la identificacion del sexo genetico de los individuos para programar cruzamientos con fines de mejora productiva.

En las especies de tilapia no se registran diferencias en los cromosomas sexuales, pues existe similitud en el tamano y morfologia de los pares de cromosomas (2n= 44) (Majumdar & McAndrew 1986) y hay secuencias de ADN repetido en todos los cromosomas (Martins et al. 2004). Segun las evidencias cromosomicas en espermatocitos en paquiteno de O. niloticus, basado en la homologia genetica que ocurre entre cromosomas homologos, se registro sinapsis parcial entre el par cromosomico de mayor tamano (cromosoma 1); al respecto, Carrasco et al. (1999) propusieron que estos serian los cromosomas sexuales. Estudios sobre O. mossambicus mediante pruebas de hibridacion in situ por fluorescencia FISH y la sinapsis de cromosomas homologos en paquiteno de hembras y machos sostienen tambien que el par 1 corresponderia a los cromosomas sexuales (Campos-Ramos et al. 2003). Ferreira & Martins (2008) mediante el analisis de secuencias repetidas por FISH reportaron diferencias entre los cromosomas del primer par de cromosomas y los propusieron como los sexuales.

Diversas investigaciones sobre microsatelites asociados a la segregacion en funcion del sexo fenotipico de la tilapia han identificado grupos de ligamiento LG1 y LG23 relacionados con el sexo de O. aureus (Lee et al. 2004). En O.hornorum, el microsatelite UNH168 fue consistente en la amplificacion y asociacion al sexo fenotipico femenino, mientras que otros microsatelites estaban presentes en muestras de ambos sexos (Zhu et al. 2016). Los marcadores microsatelites UNH995 y UNH104 relacionados con la diferenciacion del sexo en O. niloticus fueron determinados por Lee et al. (2003) y el microsatelite UNH898 fue propuesto como el mejor marcador asociado a los genes determinantes del sexo, por diferenciar machos de hembras con una sensibilidad de 96.71% (Naranjo et al. 2015). Ademas de los genes en los crosomomas sexuales, proponen la presencia de genes autosomicos en la determinacion del sexo (Lee et al. 2003, Eshel et al. 2011).

Sun et al. (2014) disenaron cebadores SCAR de muestras de O. niloticus y reportaron cuatro marcadores ligados al sexo asignados al grupo de ligamiento LG23 y que hibridan por FISH con los cromosomas mas pequenos, el par 22. De estos marcadores, SCAR-5F-X/5R y SCAR-5F/5R-Y fueron probados en la presente investigacion y se confirmo su asociacion con la diferenciacion del sexo fenotipico en hembras y machos de linajes distintos de tilapia roja y gris, producto de la PCR para SCAR-5F-X/5R de 903.3 [+ o -] 38.40 y para el SCAR-5F/5R-Y de 280.70 [+ o -] 17.29 bp. Esto concuerda con lo reportado por Sun et al. (2014), quienes proponen que SCAR-5F-X/5R y SCAR-5F/5R-Y se distinguen por la presencia de delecciones o inserciones de varios cientos de pares de nucleotidos que se diferencian en el tamano de los fragmentos amplificados entre los marcadores y se asocian a los cromosomas sexuales YX.

Los resultados de varias investigaciones demuestran la posible existencia de genes determinantes del sexo en diferentes cromosomas del complemento, siendo los cromosomas candidatos a la presencia de genes mayores de determinacion del sexo los pares cromosomicos 1 y 22 del complemento cromosomico.

Conclusiones

Los microsatelites UNH136, UNH115, UNH995 y los SCAR-5F/5R-Y, SCAR-F-X/5R presentaron loci monomorfico y no diferencian a O. niloticus "tilapia gris" de O. niloticus "tilapia roja". Mientras que con el microsatelite UNH106 si se pudo diferenciar a O. niloticus "tilapia roja" de O. niloticus "tilapia gris". Para la [beta]-actin, SCAR-5F/5R-Y y SCAR-5F-X/5R, el tamano de fragmentos amplificados por la PCR es de 715, 280 y 903 pb, respectivamente. Mientras que en los microsatelites UNH190, UNH123, UNH136, UNH106, UNH115, UNH995, GM180 y GM271 los fragmentos fueron de 178, 151, 172, 154, 143, 172, 171 y 702 bp, respectivamente. La temperatura de hibridacion optima fue de 50 [grados]C para UNH123 y GM271; para los marcadores SCAR-5F/5R-Y fue de 53 [grados]C; para UNH190, UNH136, UNH106, UNH995 fue de 55 [grados]C; para UNH115, 58 [grados]C; para SCAR-5F-X/5R fue de 63 [grados]C; y para [beta]-actin y GM180 fue de 61[grados]C.

Se logro determinar de manera inequivoca la asociacion del sexo fenotipico con los marcadores SCAR (5F-X/5R y 5F/5R-Y) en hembras XX, machos XY y supermachos YY de O. niloticus "tilapia roja" y hembras XX y machos XY en O. niloticus "tilapia gris".

doi: http://dx.doi.org/10.15381/rpb.v24i3.13900

Agradecimientos. A los biologos Julio Leon, Carlos Quijano y David Salirrosas por el apoyo en la investigacion.

Literatura citada

Aljanabi S.M. & I. Martinez. 1997. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Research 25: 4692-4693. DOI https://doi. org/10.1093/nar/25.22.4692

Baltazar P. & A. Palomino. 2004. Manual de cultivo de tilapia. Lima: Fondo Nacional de Desarrollo Pesquero. Fondo Nacional de Desarrollo Pesquero -FONDEPES, Agencia Espanola de Cooperacion Internacional -AECI, Proyecto de Apoyo al Desarrollo del Sector Pesca y Acuicola del Peru--PADESPA. 115p

Brinez B., X Caraballo, M. Salazar. 2011. Genetic diversity of six populations of red hybrid tilapia, using microsatellites genetic markers. Revista MVZ Cordoba 16(2):2491-2498.

Campos-Ramos R., S. Harvey, J. Brendan, et al.2003. An investigation of sex determination in the Mozambique tilapia, Oreochromis mossambicus, using synaptonemal complex analysis, FISH, sex reversal and gynogenesis. Aquaculture 221:125-140. DOI https://doi.org/10.1016/S00448486(03)00072-3

Carrasco, L.A., D.J. Penman & N. Bromage. 1999. Evidence for the presence of sex chromosomes in the Nile tilapia (Oreochromis niloticus) from synaptonemal complex analysis of XX, XY and YY genotypes. Aquaculture 173:207-218. DOI https://doi.org/10.1016/S0044-8486(98)00488-8

Castillo C. L.F. 2011. Tilapia roja 2011. Una evolucion de 29 anos, de la incertidumbre al exito. Colombia. Disponible en https:// ag.arizona.edu/azaqua/ista/reports/TILAPIAROJA2010.doc

Cawthorn D.M., H.A. Steinman & R.C. Witthuhn. 2011. Comparative study of different methods for the extraction of DNA from fish species commercially available in South Africa. Food Control 22(2):231-244. DOI https://doi.org/10.1016/j. foodcont.2010.07.003

Cnaani A., B. Lee, N. Zilberman, C. Ozouf, et al. 2008. Genetics of sex determination in tilapiine species. Sexual Development 2(1): 43-54. DOI https://doi.org/10.1159/000117718

Cuevas R., B.L. 2010. Evaluacion productiva y variabilidad genetica de especies de tilapia del genero Oreochromis en el estado de Sinaloa. Tesis demaestria en recursos naturales y medio ambiente. Instituto Politecnico Nacional. Centro Inter-disciplinario de Investigacion para el Desarrollo Integral Regional, UnidadSinaloa. http://itzamna.bnct.ipn.mx/ bitstream/handle/123456789/9899/258.pdf?sequence=1

Dang-en Gu, Xi-dong Mu, Hong-Mei Song, et al. 2014.Genetic diversity of invasive Oreochromis spp. (tilapia) populations in Guangdong province of China using microsatellite markers. Biochemical Systematics and Ecology, 55: 198-204. DOI https://doi.org/10.1016Zj.bse.2014.03.035

Devlin, R.H. & Y. Nagahama. 2002. Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture 208 (3-4): 191-364. DOI https://doi.org/10.1016/S0044-8486(02)00057-1

Eshel O., A. Shirak, J.I. Weller, et al. 2011. Fine mapping of a locus on linkage group 23 for sex determination in Nile tilapia (Oreochromis niloticus). Anim. Genet. 42: 222-224. DOI https://doi.org/10.1111/j.1365-2052.2010.02128.x

FAO 2016. El estado mundial de la pesca y la acuicultura 2016. Contribucion a la seguridad alimentaria y la nutricion para todos. Roma. 224 pp <http://www.fao.org/3/a-i5555s.pdf>

Faulkner, L.C., M.H. Pinedo, L.E. McDonald. 1981. Reproduccion y endocrinologia. 2a.ed. Mexico: Interamericana. pp. 180-182.

Feng Liu, Jian Li, Fei Sun, et al. 2013. A microsatellite-based linkage map of salt tolerant tilapia (Oreochromis mossambicus x Oreochromis spp) and mapping of sex-determining loci. BMC Genomics 14:58. DOI https://doi.org/10.1186/1471-2164-14-58

Ferreira, I.A. &C. Martins. 2008. Physical chromosome mapping of repetitive DNA sequence in Nile tilapia Oreochromis niloticus: Evidences for a differential distribution of repetitive elements in the sex chromosome. Micron 39(4): 411-418. DOI https://doi.org/10.1016/j.micron.2007.02.010

Guyon R., F. Senger, M. Rakotomanga, et al. 2010. A radiation hybrid map of the European sea bass (Dicentrarchus labrax) bases on 1581markers: Synteny analysis with model fish genomes. Genomics 96(4):228-238. DOI https://doi.org/10.1016/j. ygeno.2010.07.007

Hassanien A.H. & J. Gilbey. 2005.Genetic diversity and differentiation of Nile tilapia (Oreochromis niloticus) revealed by DNA microsatellites. Aquaculture Research 36:1450-1457. DOI https://doi.org/10.1111/j.1365-2109.2005.01368.x

Hussain, M.G. (2004). Farming of tilapia: breeding plans, mass seed production and aquaculture techniques. Bangladesh Fisheries Research Institute.

Jimenez A., V. Tibata, H. Junca, et al. 2011. Evaluating a nested-PCR assay for detecting Streptococcus agalactiae in red tilapia (Oreochromis sp.) tissue. Aquaculture 321(3-4):203-206. DOI https://doi.org/10.1016/j.aquaculture.2011.09.011

Kunhareang S.,H. Zhou & J.G.H. Hickford.2010. Rapid DNA extraction of pig ear tissues. Meat Science 85(3):589-590. DOI https://doi.org/10.1016/j.meatsci.2010.02.028

Lee, D., J.Penman & T.D. Kocher. 2003. Identification of a sex-determining region in Nile tilapia (Oreochromis niloticus) using bulked segregant analysis. International Society for Animal Genetics, Animal Genetics, 34: 379-38. DOI https://doi. org/10.1046/j.1365-2052.2003.01035.x

Lee B.Y.,G. Hulata & T.D. Kocher.2004. Two unlinked loci controlling the sex of blue tilapia (Oreochromis aureus) Heredity, 59(2): 543-549. DOI https://doi.org/10.1038/sj.hdy.6800453

Leffak M., R. Gadgil, J. Barthelemy & T. Lewis. 2016. Replication stalling and DNA microsatellite instability. Biophysical Chemistry. DOI https://doi.org/10.1016/j.bpc.2016.11.007

McAndrew B., D.J. Penman, M. Bekaert & S. Wehner. 2016. Tilapia genomics studies. Genome in Aquaculture.Pp. 105-129. DOI https://doi.org/ 10.1016/B978-0-12-801418-9.00005-6

Majumdaa, K.C. & B.J. McAndrew. 1986. Relative DNA content of somatic nuclei and chromosomal studies in three genera, Tilapia, Sarotherodon, and Oreochromis of the tribe Tilapiini (Pisces, Cichlidae). Genetica 68:175-188. DOI https://doi. org/10.1007/BF02424441

Martins C., C. Oliveira, A. Wasko & J.M.Wright.2004. Physical mapping of the Nile tilapia (Oreochromis niloticus) genome by fluorescent in situ hybridization of repetitive DNAs to metaphase chromosomes--a review. Aquaculture 231:37-49. DOI https://doi.org/10.1016/j.aquaculture.2003.08.017

Naranjo G., Ortiz D.R., Chavez M.A., Manjunatha B., Tirado J.O., Mu-oz D., Kundapur R.R. & Ravi M. 2015. Optimization of detection of sexual genotype through microsatellites in populations of Nile Tilapia (Oreochromis niloticus) from the breeding pools. Der Pharma Chemica 7(10):536-542.

Romana-Eguia M.R.R., M. Ikeda, Z.U. Basiao & N. Taniguchi. 2004. Genetic diversity in farmed Asian Nile and red hybrid tilapia stocks evaluated from microsatellite and mitochondrial DNA analysis. Aquaculture 236(1-4):131-150. DOI https:// doi.org/10.1016/j.aquaculture.2004.01.026

Ruiz, R.L. 2012. Estado de la acuicultura en el Peru. Revista AquaTIC. 37: 99-106.

Shirak A, E. Seroussi, N. Zilberman, et al. 2007. Mapping of candidate genes for sex determination in tilapias. Aquaculture. 272(1):S271. DOI https://doi.org/10.1016/j.aquaculture.2007.07.093

Sun Y.L., D.N. Jiang, S. Zeng,et al.2014. Screening and characterization of sex-linked DNA markers and marker-assisted selection in the Nile Tilapia (Oreochromis niloticus). Aquaculture 433:19-27. DOI https://doi.org/10.1016/j. aquaculture.2014.05.035

Zhu H., Liu Z., Lu M., et al. 2016. Screening and identification of a microsatellite marker associated with sex in Wami tilapia, Oreochromis urolepis hornorum. J. Genet 95(2):283-289. DOI https://doi.org/10.1007/s12041-016-0653-y.

Monica Arqueros, Linda Sanchez-Tuesta y Zulita Prieto*

Centro Experimental de Genetica, Facultad de Ciencias Biologicas, Universidad Nacional de Trujillo, Peru. Tel. 5144-474835.

* Autora para la correspondencia:

Email Monica Arqueros: arqueros.monica@.gmail.com

Email Linda Sanchez-Tuesta: santues2686@hotmail.com

Email Zulita Prieto: zprieto@unitru.edu.pe

Presentado: 04/01/2017

Aceptado: 22/09/2017

Publicado online: 28/10/2017

Informacion sobre los autores:

MA que realizo la parte experimental. LS-T realizo la parte experimental. ZP realizo el diseno experimental y planificacion; MA, LS-T, ZP revisaron y aprobaron el manuscrito.

Los autores no incurren en conflictos de intereses.

Fuentes de financiamiento: El presente trabajo se realizo gracias al financiamiento del canon minero otorgado a la Universidad Nacional de Trujillo.

Leyenda: Figura 1. Electroforesis en gel de agarosa 1% de la extraccion de ADN de muestras de aleta caudal de Oreochromis niloticus.

Leyenda: Figura 2. Fragmentos amplificados por PCR de microsatelites en Oreochromis niloticus. A. UNH190, UNH136, UNH123. B. UNH123, UNH190, UNH995, GM189, GM271, [beta]-actin (gen endogeno). Marcador 100bp, las flechas indican el tamano de fragmento del marcador.

Leyenda: Figura 3. Microsatelites UNH en Oreochromis niloticus "tilapia gris y roja". A. Control de amplificacion secuencia de un gen endogeno [beta]-actin. B. UNH136. C. UNH106. D. UNH995. Marcador de DNA 100bp, las flechas indican el tamano de fragmento de las muestras.

Leyenda: Figura 4. Marcadores SCAR en muestras de aleta caudal de hembras y machos de Oreochromis niloticus gris y roja. A. SCAR-5F/ 5R-Y. B. SCAR-5F-X/5R. Marcador de DNA 100bp.

Leyenda: Figura 5. Marcador SCAR en muestras de aleta caudal de machos y hembras de Oreochromis niloticus. A. SCAR5F-X/5R: G1 YY (Progenie), Go YY (Padres: macho y hembra YY), G1XY (Progenie), Go XX (Madre), Go XY (Padre). B. SCAR-5F/ 5R-Y, G1 YY (Progenie), Go YY (Padres: macho y hembra YY), G1XY (Progenie), Go XX (Madre), Go XY (Padre).
Tabla 1. Resultados de la temperatura de hibridacion (Tm) y el
tamano de fragmento amplificado con microsatelites y SCAR en
Oreochromis niloticus. (*) Se incluye los resultados de otros
autores como referencia (Letras y numeros en cursiva).

Marcadores  Secuencia de cebadores segun      Temperatura  Tamano de
                autores citados *                de        Fragmento
                                              Hibridacion  Amplificado
                                                (Tm)         (bp)
                                              ([grados]C)

UNH190      F:TGT CTG GAC GCG CTT TTG T           55          178
            R:CGC GAT CGA GCA TTC TAA
UNH123      F:ATC ATC ACA GAC AGA TTA GA          50          151
            R:GAT TGA GAT TTC ATT CAA G
UNH136      F:TGT GAG AAT TCA CAT ATC ACT A       55          172
            R:TAC TCC AGT GAC TCC TGA
UNH106      F:GTC TCT TTC TCT GTC ACA AG          55          154
            R:CCT TCA GCA TCC GTA TAT
UNH115      F:ACC TTC ATC TCG GTC AG              58          143
            R:TCA AGC AGC TGA TTT TT
UNH995      F:CCA GCC CTC TGC ATA AAG AC          55          172
            R:GCA GCA CAA CCA CAG TGC TA
GM180       F:CGG CGG CGA CTT GTA GTG TAA         61          171
            R:GGA CGG TCT GGC GAG GAC
GM271       F:GCA GCT GGA TCA GTC TCT G           50          702
            R:TGG GAA GTC GTT CAT ACA AAG
B ACTIN     F:GGC ATC ACA CCT TCT ACA ACG A       61          715
            R:ACG CTC TGT CAG GAT CTT CA
SCAR 5RY    TTA CAG CAG CAC CCA GAG TCA T         53          280
Marker 5F   TAA ATT AAT GAC ATT TCA GTT ATG
SCAR 5FX    CTG GTT TGC AAT AGT TAG GGT GCT       63          903
Marker 5R   CAG AAA TGT AGA CGC CCA GGT ATC

Marcadores  Secuencia de cebadores segun            Cebadores
                autores citados (*)                y fragmento
                                                  amplificado segun
                                                  autores citados (*)

                                                Referencias

UNH190      F:TGT CTG GAC GCG CTT TTG T         GenBank:
            R:CGC GAT CGA GCA TTC TAA           G12342
UNH123      F:ATC ATC ACA GAC AGA TTA GA        Brinez et al.
            R:GAT TGA GAT TTC ATT CAA G         2011 G12276
UNH136      F:TGT GAG AAT TCA CAT ATC ACT A     G12288
            R:TAC TCC AGT GAC TCC TGA
UNH106      F:GTC TCT TTC TCT GTC ACA AG        Brinez et al.
                                                 2011
            R:CCT TCA GCA TCC GTA TAT           Lamprea et al
                                                 2004
                                                 G12259
UNH115      F:ACC TTC ATC TCG GTC AG            Lee et al 2004
            R:TCA AGC AGC TGA TTT TT            G12268
UNH995      F:CCA GCC CTC TGC ATA AAG AC        Carleton et al,
            R:GCA GCA CAA CCA CAG TGC TA        2002 G68274
GM180       F:CGG CGG CGA CTT GTA GTG TAA       BV005346
            R:GGA CGG TCT GGC GAG GAC
GM271       F:GCA GCT GGA TCA GTC TCT G         Lee et al 2004
            R:TGG GAA GTC GTT CAT ACA AAG       Cnaani &kocher
                                                 2008 BV005386
B ACTIN     F:GGC ATC ACA CCT TCT ACA ACG A     Jimenez et al
            R:ACG CTC TGT CAG GAT CTT CA        2011
SCAR 5RY    TTA CAG CAG CAC CCA GAG TCA T       Sun et al. 2014
Marker 5F   TAA ATT AAT GAC ATT TCA GTT ATG
SCAR 5FX    CTG GTT TGC AAT AGT TAG GGT GCT     Sun et al. 2014
Marker 5R   CAG AAA TGT AGA CGC CCA GGT ATC

Marcadores  Secuencia de cebadores segun            Cebadores
                autores citados (*)                y fragmento
                                                  amplificado segun
                                                  autores citados (*)

                                                        Tm
                                                   ([grados]C)

UNH190      F:TGT CTG GAC GCG CTT TTG T
            R:CGC GAT CGA GCA TTC TAA
UNH123      F:ATC ATC ACA GAC AGA TTA GA                 55
            R:GAT TGA GAT TTC ATT CAA G
UNH136      F:TGT GAG AAT TCA CAT ATC ACT A
            R:TAC TCC AGT GAC TCC TGA
UNH106      F:GTC TCT TTC TCT GTC ACA AG
            R:CCT TCA GCA TCC GTA TAT                    50
UNH115      F:ACC TTC ATC TCG GTC AG                    55-60
            R:TCA AGC AGC TGA TTT TT
UNH995      F:CCA GCC CTC TGC ATA AAG AC
            R:GCA GCA CAA CCA CAG TGC TA
GM180       F:CGG CGG CGA CTT GTA GTG TAA                55
            R:GGA CGG TCT GGC GAG GAC
GM271       F:GCA GCT GGA TCA GTC TCT G
            R:TGG GAA GTC GTT CAT ACA AAG               55-60

B ACTIN     F:GGC ATC ACA CCT TCT ACA ACG A
            R:ACG CTC TGT CAG GAT CTT CA
SCAR 5RY    TTA CAG CAG CAC CCA GAG TCA T                60
Marker 5F   TAA ATT AAT GAC ATT TCA GTT ATG
SCAR 5FX    CTG GTT TGC AAT AGT TAG GGT GCT              60
Marker 5R   CAG AAA TGT AGA CGC CCA GGT ATC

Marcadores  Secuencia de cebadores segun      Cebadores y fragmento
               autores citados (*)              amplificado segun
                                                 autores citados (*)

                                                  Tamano de
                                                 Fragmento (bp)

UNH190       F:TGT CTG GAC GCG CTT TTG T             167
             R:CGC GAT CGA GCA TTC TAA
UNH123       F:ATC ATC ACA GAC AGA TTA GA          145-208
             R:GAT TGA GAT TTC ATT CAA G             197
UNH136       F:TGT GAG AAT TCA CAT ATC ACT A         173
             R:TAC TCC AGT GAC TCC TGA
UNH106       F:GTC TCT TTC TCT GTC ACA AG          130-240
             R:CCT TCA GCA TCC GTA TAT               130
                                                     134
UNH115       F:ACC TTC ATC TCG GTC AG              168 / 182
             R:TCA AGC AGC TGA TTT TT                149
UNH995       F:CCA GCC CTC TGC ATA AAG AC          219 / 236
             R:GCA GCA CAA CCA CAG TGC TA            170
GM180        F:CGG CGG CGA CTT GTA GTG TAA           174
             R:GGA CGG TCT GGC GAG GAC
GM271        F:GCA GCT GGA TCA GTC TCT G           121 a 125
             R:TGG GAA GTC GTT CAT ACA AAG          96 a 110
                                                      117
B ACTIN      F:GGC ATC ACA CCT TCT ACA ACG A          135
             R:ACG CTC TGT CAG GAT CTT CA
SCAR 5RY     TTA CAG CAG CAC CCA GAG TCA T            293
Marker 5F    TAA ATT AAT GAC ATT TCA GTT ATG
SCAR 5FX     CTG GTT TGC AAT AGT TAG GGT GCT          925
Marker 5R    CAG AAA TGT AGA CGC CCA GGT ATC
COPYRIGHT 2017 Universidad Nacional Mayor de San Marcos
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:TRABAJOS ORIGINALES
Author:Arqueros, Monica; Zulita Prieto Sanchez-Tuesta, Linda
Publication:Revista peruana de biologia
Date:Oct 1, 2017
Words:5915
Previous Article:Aspectos biologicos de Archaeoprepona demophon muson (Fruhstorfer, 1905) (Lepidoptera: Nymphalidae, Charaxinae) en la Amazonia peruana.
Next Article:Mamiferos y aves silvestres usados por los pobladores de la cuenca del rio abujao (Ucayali, Peru).
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |