Printer Friendly

Diagnosis and genotyping of pseudorabies virus by nested-PCR and restriction enzyme analysis/Diagnostico e genotipagem do virus da pseudoraiva por nested-PCR e analise de restricao enzimatica.

INTRODUCAO

A pseudoraiva (PR) e uma enfermidade de grande importancia na suinocultura em razao de elevados prejuizos que causa na cadeia produtiva da industria suina, seja por danos diretos nas granjas, seja tambem por barreiras sanitarias. O agente etiologico da enfermidade e o virus da pseudoraiva (PrV), tambem denominado herpesvirus suino 1, um membro da familia Herpesviridae, subfamilia Alphaherpesvirinae, que possui apenas um sorotipo (MURPHY et al., 1995). A transmissao do virus geralmente ocorre por via oronasal. O suino e o hospedeiro natural do PrV, mas o virus pode infectar outros animais domesticos como caes e bovinos. A intensidade dos sinais clinicos e a mortalidade dependem da idade do hospedeiro, e a infeccao latente e sempre estabelecida apos a recuperacao do animal (METTENLEITER et al., 1999).

Apesar de o virus possuir apenas um sorotipo, diferentes genotipos do PrV podem ser identificados pela analise por endonucleases de restricao, e a identificacao dos genotipos e importante para estudos epidemiologicos (KLUGE et al., 1999). O metodo baseado em analise de polimorfismos de fragmentos de restricao (RFLP) com a enzima BamHI foi descrito previamente e provou ser capaz de dividir o PrV em quatro genotipos. Os genotipos I e II estao distribuidos mundialmente, e os genotipos III e IV estiveram restritos a Dinamarca e Tailandia, respectivamente, e nao foram mais relatados (CHRISTENSEN, 1995).

No Brasil, foram identificados os genotipos 1 e II, por meio do RFLP (PIATTI et al., 2001; SCHAEFFER et al., 2006). O Rio Grande do Sul (RS) manteve-se sem relato da PR durante 49 anos, ate o foco de 2003, causado por um virus pertencente ao genotipo II. Analises de RFLP permitiram detectar que este era o mesmo tipo genomico presente no Estado de Santa Catarina, que ainda nao havia completado seu programa de erradicacao na epoca do surto no RS (SILVA et al., 2005). O mesmo metodo identificou amostras do genotipo I no Estado do Parana, um tipo incomum no Brasil, mas presente na Argentina, o que indica a possivel introducao desse genotipo por animais com o virus latente daquele pais (SCHAEFER et al., 2006).

O metodo de analise por restricao enzimatica de genoma completo com BamHI e util na diferenciacao do PrV, mas muito complexo, pois requer isolamento do virus, processos de ultracentrifugacao para purificacao do DNA e eletroforese de temperatura controlada que pode durar ate 20 horas. Alem da boa qualidade da amostra para evitar contaminacoes e destruicao do virus, e necessario que este esteja ativo, ja que o PrV nao pode ser isolado quando se encontra em latencia (POMERANZ et al., 2005).

A deteccao do virus, no estado latente ou replicativo, pela PCR, e uma ferramenta importante no controle da doenca (YOON et al., 2005; YOON et al., 2006; SAMI et al., 2007). Essa metodologia foi sugerida no plano de erradicacao da PR no Brasil elaborado pelo Ministerio da Agricultura, Pecuaria e Abastecimento (BRASIL, 2007) e recomendada pela Organizacao Mundial de Saude Animal (OIE, 2008).

O objetivo deste trabalho foi associar as tecnicas de nested-PCR e a analise de restricao enzimatica, visando a obtencao de um metodo rapido e sensivel para deteccao e caracterizacao genotipica do PrV.

MATERIAL E METODOS

Amostras

Vinte amostras do PrV isoladas nas Regioes Sul e Sudeste do Brasil previamente genotipadas (PIATTI et al., 2001; SILVA et al., 2005) e a estirpe padrao Shope foram multiplicadas em celulas PK-15 (Tabela 1). A estirpe padrao Shope, genotipo I, foi utilizada como controle positivo em todos os testes descritos neste trabalho. O DNA total foi extraido por meio do kit comercial Wizard[R] Genomic DNA Purification (Promega, EUA) e armazenado a -20[degrees]C, para utilizacao na nested-PCR e genotipagem. Amostras do genotipo III e IV nao foram utilizadas por terem sido descritas exclusivamente na Dinamarca, onde a PR ja foi erradicada, e na Tailandia, tambem livre de novos focos com esses genotipos nos ultimos anos (CHRISTENSEN, 1995).

Alem das amostras de virus isolados ja genotipados, 75 amostras de cerebro de suino foram utilizadas para avaliacao da nested-PCR em material clinico. Vinte e cinco dessas amostras eram provenientes de focos de PR e outras 50 amostras foram colhidas de animais abatidos em frigorifico e provenientes de granjas sem historico de PR. Todas as amostras positivas foram submetidas previamente ao isolamento viral e a soroneutralizacao viral segundo metodo descrito pela OIE (2008). As amostras negativas foram submetidas apenas a soroneutralizacao.

Analise in silico dos sitios de restricao enzimatica

A restricao enzimatica para o gene codificante da glicoproteina E foi baseada nas sequencias obtidas por FONSECA JR. et al. (2009), que foram submetidas ao programa pDraw32 (KJELD, 2006), para a escolha de uma enzima de restricao que clivasse os amplicons e diferenciasse os genotipos. Os iniciadores desenhados com o intuito de flanquear a regiao do polimorfismo e a enzima Btgl foram escolhidos para a utilizacao na nested-PCR seguida da restricao enzimatica. A enzima Hphl foi selecionada no mesmo programa para ser o controle da restricao enzimatica para garantir que a reacao de digestao nao sofria inibicao.

Vested-PCR

Os iniciadores externos gE-E-F (5'-CCAACGACACGGGCCTCTAC-3') e gE-E-R (5'-CGAGCGTGTAGTCCCAGGTG-3') e internos gE-I-R (5'-GCGTTCGTGTGCACCTCCT-3') e gE-I-F (GGGGACACGTTCGACCTGAT) foram desenhados com o auxilio do do programa Primer3 (ROZEN & SKALETSKY, 1998). A nested-PCR foi realizada nas seguintes condicoes: a primeira reacao de 20 [micro]L continha cinco pmoles de cada iniciador (gE-E-F e gEE-R), 1.5U de Taq polimerase (GoTaq, Promega, Estados Unidos), tampao GoTaq 5x, MgCl 1.9 mmol [L.sup.-1], 4% DMSO e DNTP a 200 [micro]mol [L.sup.-1] e 2 [[micro]L.sup.2] de DNA. Os ciclos da reacao foram os seguintes: desnaturacao a 95[degrees]C por cinco minutos, 35 ciclos de 95[degrees]C por 50s, 58[degrees]C por 40s, 72[degrees]C por 50s e extensao a 72[degrees]C, por cinco minutos. A segunda reacao foi realizada como a seguir: iniciadores gE-I-F e gE-I-R e solucoes de 20 [micro]L com 6 pmoles de cada iniciador, 1.0U de Taq polimerase (GoTaq), Tampao GoTaq 5x, 1.5mmol [L.sup.-1] Mg[Cl.sub.2], 4 % DMSO, 200(mol [L.sup.-1] DNTP e 2 [micro]L da reacao externa. As temperaturas e os tempos da reacao foram: 95[degrees]C por cinco minutos, 15 ciclos de 95[degrees]C por 40s, 64[degrees]C por 40s, 72[degrees]C por 40s, 20 ciclos de 95[degrees]C por 40s, 59[degrees]C por 40s, 72[degrees]C por 40s e extensao a 72[degrees]C, por tres minutos. O fragmento amplificado esperado de 317pb foi visualizado em gel de agarose a 1,5% e corado com brometo de etideo (0,5 [micro]g [mL.sup.-1]), sob luz ultravioleta.

Especificidade analitica

Amostras dos genotipos I e II de PrV (Tabela 1), amostra vacinal Bartha, herpesvirus bovino 1 (devido a proximidade filogenetica) e de Streptococcus suis foram utilizadas para o teste de especificidade. O DNA dessas amostras foi extraido pelo mesmo metodo descrito anteriormente.

Sensibilidade analitica

Uma suspensao do isolado de campo F3303 ([10.sup.5-3] [TCID.sub.50] [mL.sup.-1]) foi diluida em serie, na base 10 ate [10.sup.-7]. Cada diluicao foi utilizada para contaminar 10 amostras de cerebro de suinos negativos na sorologia e provenientes de uma granja sem historico de PR. O DNA dessas amostras contaminadas foi extraido como citado anteriormente. A diluicao com 10 resultados positivos foi repetida 21 vezes para a determinacao da sensibilidade analitica, com nivel de confianca de 95% (CAULCUTT & BODDY, 1983).

Amostras clinicas

A nested-PCR foi utilizada nas 75 amostras de cerebro de suino descritas anteriormente para confirmacao da sensibilidade e especificidade analitica do teste, como sugerido por ESPY et al. (2006), permitindo a verificacao dos resultados positivos e negativos, bem como de reacoes inespecificas. O teste de precisao da analise foi realizado com a repeticao por 10 dias de uma amostra positiva, uma amostra contaminada no limite de deteccao e uma amostra negativa. Os resultados foram analisados pelo teste Kappa (GART & BUCK, 1966).

Restricao enzimatica

Os produtos internos da amplificacao do gene da glicoproteina E obtidos na nested-PCR (317 pb) foram digeridos com a enzima de restricao BtgI, de acordo com as instrucoes do fabricante (New England, EUA). Todos os amplicons tambem foram submetidos a outra reacao de restricao com HphI (New England, EUA). A amostra padrao Shope foi utilizada como controle positivo para se verificar o corte dos amplicons derivados dos isolados do genotipo I. O DNA digerido foi fracionado por eletroforese, em gel de agarose a 1,5%, corado com brometo de etideo (0,5 [micro]g [mL.sup.-1]) e visualizado sob luz ultravioleta.

Comparacao da nested-PCR com PCR convencional

A comparacao entre a nested-PCR e a PCR convencional descrita por BASCUNANA et al. (1997) foi realizada a partir de amostras negativas contaminadas com diluicoes da amostra viral F3303 no mesmo processo definido no item Sensibilidade Analitica. A mistura para a reacao foi constituida de: 7,5 pmoles de cada iniciador (gBI GAACCTGACGCTGCTGGAGGACCGACCG e gBIIAGGCCCTGGAAGAAGTGGCGATGCATGC), 1.5U de Taq polimerase (GoTaq, Promega, EUA), Tampao GoTaq 5x, Mg[Cl.sub.2] 1.5mmol [L.sup.-1], 4% de DMSO, DNTP 200 [micro]mol [L.sup.-1], 2 [micro]L de DNA. Os ciclos da reacao foram os seguintes: desnaturacao a 95[degrees]C por cinco minutos, 35 ciclos de 95[degrees]C por 40s, 59[degrees]C por 40s, 72[degrees]C por 40s e extensao a 72[degrees]C por cinco minutos.

RESULTADOS

A nested-PCR descrita teve sensibilidade analitica de [10.sup.-1,3] [TCID.sub.50] [mL.sup.-1] correspondente ao menor titulo que obteve 10 reacoes positivas e sucesso nas 21 repeticoes. Na comparacao com a PCR convencional, a nested-PCR foi 100 vezes mais sensivel (Tabela 2). Todas as amostras de PrV foram amplificadas pela nested-PCR, exceto a amostra vacinal Bartha, por ser deletada para o gene da glicoproteina E. Nao houve amplificacao inespecifica quando foi utilizada amostra do DNA de herpesvirus bovino. Tambem nao houve amplificacao para amostras de S. suis, agente causador de uma doenca neurologica semelhante a PR.

O teste de verificacao da acuracia da nestedPCR teve resultados compativeis com os obtidos no isolamento viral e a soroneutralizacao viral em amostras clinicas com um valor de Kappa igual a 1,0, nivel de confianca de 95%, significando concordancia de 100% entre os testes. Todas as amostras positivas pela nested-PCR foram identificadas como pertencentes ao genotipo II. Nao houve amplificacao do fragmento de gE ou formacao de bandas inespecificas nas 50 amostras negativas testadas.

Polimorfismos de nucleotideo unico foram detectados nos genotipos I e II. A enzima BtgI, selecionada na analise computacional das sequencias, teve sua eficiencia confirmada nos testes de laboratorio com duas bandas formadas para o genotipo I (uma banda com 217pb e outra com 100pb) e apenas uma banda de 317pb para o genotipo II. A enzima HphI clivou os produtos da nested-PCR de ambos os genotipos em fragmentos de 54, 129 e 134pb. O fragmento menor nao foi detectado no gel, e os dois ultimos apareceram como apenas um em razao da semelhanca nos tamanhos (Figura 1).

DISCUSSAO

A rapida deteccao e a caracterizacao de agentes infecciosos sao essenciais para os programas de defesa sanitaria animal. Uma doenca como a PR, listada pela OIE, pode causar grandes impactos nas granjas acometidas, assim como gerar barreiras sanitarias relevantes para a suinocultura. O tempo gasto para realizacao do teste descrito neste trabalho foi de no maximo dois dias, bem inferior aos metodos descritos anteriormente, que podiam levar ate sete dias entre o isolamento viral e a eletroforese (PIATTI et el., 2001; SCHAEFFER et al., 2006). A enzima selecionada clivou seletivamente o polimorfismo encontrado nas analises de bioinformatica, permitindo diferenciar os genotipos virais I e II com precisao. A nested-PCR foi 100 vezes mais sensivel do que uma PCR convencional descrita na literatura (BASCUNANA et al. (1997).

[FIGURE 1 OMITTED]

A caracterizacao genotipica do PrV por analise de restricao enzimatica foi utilizada por varios autores em estudos epidemiologicos, sendo o metodo baseado na restricao do genoma completo do PrV com BamHI, com variacoes no metodo de purificacao do DNA viral, o mais utilizado (CHRISTENSEN, 1987; CHRISTENSEN, 1988; NISHIMORI et al., 1987, YAMADA et al., 1992; CHRISTENSEN, 1995; PIATTI et al., 2001; SILVA et al., 2005; SCHAEFER et al., 2006). Isolados de campo foram identificados por esse mesmo metodo como derivados de amostras vacinais na Polonia e Hungria (CHRISTENSEN et al., 1992). Isolados britanicos foram discriminados por amplificacao de um fragmento longo do gene da glicoproteina D e posterior digestao por BamHI (BANKS, 1993). Em outro estudo, um algoritmo quantitativo foi desenvolvido para estimar a similaridade de isolados e amostras vacinais a partir das bandas geradas no gel apos restricao enzimatica do DNA viral (WEIGEL & SCHERBA, 1997). Os metodos de sequenciamento, apesar de serem mais acessiveis, possuem custo relativamente alto quando comparado a digestao enzimatica, alem de serem tecnicamente mais elaborados. Alem disso, no caso de virus muito conservados, como os herpesvirus, podem nao oferecer mais do que dois grandes grupos em suas arvores filogeneticas se as amostras forem muito proximas (GOLDBERG et al., 2003). A combinacao da nested-PCR com a restricao enzimatica e mais vantajosa por ser mais rapida, apresentar menor custo, ser simples e ainda poder ser utilizada em qualquer laboratorio com o minimo de equipamentos de biologia molecular.

Outras PCRs descritas na literatura, porem nao comparadas com as amostras deste trabalho, tem relatos de sensibilidade por volta de [10.sup.15] [TCDI.sub.50] [mL.sup.-1] (LEE et al., 2007; PEREZ & ARCE, 2009), o que e 100 vezes menos sensivel do que quando a reacao e realizada pela metodologia com a etapa de nested padronizada neste trabalho. Alem disso, outra nested-PCR, tambem baseada em gE, obteve acuracia de apenas 57,5% em cerebros de suinos (YOON, 2005). Os resultados de sensibilidade obtidos por esses autores sao diferentes quando comparados aos deste trabalho, provavelmente em razao da regiao de amplificacao da PCR, de reagentes utilizados ou do metodo de extracao, caracteristicas que geralmente alteram o desempenho da PCR (ESPY et al., 2006).

A nested-PCR descrita neste trabalho demonstrou ser confiavel para o diagnostico da PR, podendo ser utilizada como padrao na deteccao do PrV A tecnica tambem pode ser util como metodo auxiliar em programas de erradicacao como metodo confirmatorio em casos de animais unicos reativos, ou seja, individuos que sejam positivos no metodo de triagem (ELISA para glicoproteina B), porem negativos no ELISA para diferenciacao de animais vacinados (BASCUNANA et al., 1997).

CONCLUSAO

O metodo usual de genotipagem do PrV pode demorar ate sete dias, ja que o isolamento viral e necessario. Alem da alta sensibilidade, detectando ate [10.sup.-1,3] [TCID.sub.50] [mL.sup.-1] de virus nas amostras clinicas, o teste descrito foi relativamente mais rapido, com resultados em dois dias. O desenvolvimento dessa metodologia para diferenciacao do PrV e muito relevante para estudos epidemiologicos, podendo desse modo identificar os fluxos de infeccao nos rebanhos brasileiros, nos ultimos surtos relatados, bem como estabelecer estrategias de prevencao de novos focos da doenca.

Recebido para publicacao 20.06.09 Aprovado em 20.01.10

AGRADECIMENTOS

Agradecimentos a FAPEMIG e ao LANAGRO/MGMAPA, pelo suporte financeiro ao trabalho, a EMBRAPA Suinos e Aves, ao CEDISA e ao IPVDF, pelo fornecimento das amostras clinicas.

REFERENCIAS

BANKS, M. DNA restriction fragment length polymorphism among british isolates of Aujeszky's disease virus: use of the polymerase chain reaction to discriminate among strains. British Veterinary Journal v.149, p.155-163, 1993.

BASCUNANA, C.R. et al. Detection of pseudorabies virus genomic sequences in apparently uninfected "single reactor" pigs. Veterinary Microbiology v.55, p.37-47, 1997. Disponivel em: <http://www.sciencedirect.com/ science?_ob = ArticleURL&_udi = B6TD6-3RJG23M5&_user=4741058&_rdoc=1&_fmt=&_orig=search&_sort=d& _docanchor=&view = c&_searchStrId=1173676688& _rerunOrigin = google&_acct = C000064697&_ve rsion = 1 & _urlVersion = 0& _userid = 474 1 0 58&md5=317a777fa5b760fba0f809959771cad5>. Acesso em: 10 mar. 2009. doi:10.1016/S0378-1135(96)01316-8.

BRASIL. Instrucao Normativa 8 de tres de abril de 2007. Aprova as Normas para o Controle e a Erradicacao da Doenca de Aujeszky (DA) em suideos domesticos, a serem observadas em todo o territorio nacional. Diario Oficial da Uniao, Secao 1, Pagina 1, 10/04/2007.

CAULCUTT, R.; BODDY, R. Statistic for analytical chemists. Londres: Chapman and Hall, 1983. 256p.

CHRISTENSEN, L.S. et al. Restriction fragment pattern (FP) analysis of genomes from Danish isolates of suid herpesvirus 1 (Aujeszly's disease virus). Archives of Virology, v.97, p.215224, 1987. Disponivel em: <http://www.springerlink.com/ content/m18p338844442121/>. Acesso em: 10 mar. 2009. d oi: 10.1007/BF01314422.

CHRISTENSEN, L.S. Comparison by restriction fragment pattern analysis and molecular characterization of some European isolates of suid herpesvirus 1: a contribution to strain differentiation of European isolates. Archives of Virology, v.102, p.39-47, 1988. Disponivel em: <http:// www.springerlink.com/content/xh4j848x2488g212/>. Acesso em: 20 jan. 2010. doi: 10.1007/BF01315561.

CHRISTENSEN, L.S. et al. Characterization of field isolates of suid herpesvirus 1 (Aujeszky's disease virus) as derivates of attenuated vaccine strains. Archives of Virology v.124, p.225-234, 1992. Disponivel em: <www.springerlink.com/index/ P0R7V54G4456X8L6.pdf>. Acesso em: 21 jan. 2009. doi: 10.1007/BF01309804

CHRISTENSEN, L.S. Population biology of suid herpesvirus 1. APMIS, supl.48, p.1-48 1995.

ESPY, M.J. et al. Real-Time PCR in clinical microbiology: applications for routine laboratory testing. Clinical Microbiology Reviews, v.19, n.1, p.165-256, 2006. Disponivel em: <http://cmr.asm.org/cgi/content/abstract/19/1/165>. Acesso em: 15 mar. 2009. doi: 10.1128/CMR.00022-06.

FONSECA Jr., A.A. et al. Molecular epidemiology of Brazilian pseudorabies viral isolates. Veterinary Microbiology, 2009. Online. Obtido via base de dados Pubmed. Disponivel em: <http://www.sciencedirect.com/ science?_ob = ArticleURL&_udi = B6TD6-4X9NV5N5&_user = 474 1 05 8& _rdoc=1&_fmt = &_orig = search&_sort = d& _docanchor = &view = c& _acct = C000064697&_version=1&_urlVersi on=0&_userid=4741058&md5=e96ab7267f869fe988bab633f905743e>. Acesso em: 25 set. 2009. doi:10.1016/j.vetmic.2009.09.018.

GART, J.J.; BUCK, A.A. Comparison of a screening test and a reference test in a epidemiologic studies. American Journal of Epidemiology, v.83, n.1, p.593-602, 1966. Disponivel em: <http://aje.oxfordjournals.org/cgi/pdf_extract/83/3/593>. Acesso em: 08 jan. 2009.

GOLDBERG, T.L. Application of phylogeny reconstruction and character-evolution analysis to inferring patterns of directional microbial transmission. Preventive Veterinary Medicine v.61, n.59-70, 2003. Disponivel email: <http// linkinghub.elsevier.com/ retrieve/pii/S0167587703001612>. Acesso em: 10 mar. 2009. doi:10.1016/S0167-5877(03)00161-2

KJELD, O. 2006. Pdraw32. Disponivel em: http:// www.acaclone.com/. On line. Acesso em: 10 jan. 2009.

KLUGE, J.P. et al. Pseudorabies (Aujeszk's disease). In: STRAW, B.E. et al. (eds). Diseases of swine. 8.ed. Ames, Iowa: Iowa State University, 1999. p.147-160.

LEE, C. S. et al. Multiplex PCR for the simultaneous detection of pseudorabies virus, porcine cytomegalovirus, and porcine circovirus in pigs. Journal of Virological Methods, v.139, n.1, p.39-43, 2007. Disponivel em: <http://linkinghub.elsevier.com/retrieve/ pii/S0166093406003132>. Acesso em: 29 mar. 2009. doi:10.1016/ j.jviromet.2006.09.003

METTENLEITER, T.C. Aujeszky's disease (pseudorabies) virus: the virus and molecular pathogenesis--state of the art, june 1999. Veterinary Research v.31, p.99-115, 2000. Disponivel em: <http:// linkinghub.elsevier.com/retrieve/pii/S0166093406003132>. Acesso em: 20 jan. 2010. doi:10.1016/j.jviromet.2006.09.003.

MURPHY, F.A. et al. Virus Taxonomy. Classification and nomenclature of viruses. Sixth report of the international Commitee on Taxonomy of Viruses. Archives of Virology v.10, p.120-121,1995. Disponivel em: <http:// www.springerlink.com/content/rm81150778g49n1l/>. Acesso em: 20 jan. 2010. doi: 10.1007/BF01309873

NISHIMORI, T. et al. Restriction endonuclease analysis of Aujeszky's disease viruses isolated in Japan. Japonese Journal of Veterinary Science v.49, n.2, p.365-367, 1987.

OIE, World Organization for Animal Health. Manual of diagnostic tests and vaccinesfor terrestrial animal. 6.ed. Paris, 2008. 1343p. Disponivel em: <http://www.oie.int/eng/ normes/mmanual/A_summry.htm>. Acesso em: 19 jan. 2010.

PEREZ, L.J.,;HEIDY, H.D. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples. Brazilian Journal of Microbiology v.40, n.3, p.433-438, 2009. Disponivel em: <http://www.scielo.br/ scielo.php?script = sci_arttext&pid = S151783822009000300002&lng=en&nrm=iso&tlng=en>. Acesso em: 28 out. 2009. doi: 10.1590/S1517-83822009000300002.

PIATTI, R.M. et al. Characterization of Aujeszky's disease virus isolates from south and southeast Brazil by RFLP analysis. Brazilian Journal of Microbiology v.32, p.144-146, 2001. Disponivel em: <http://www.scielo.br/scielo.php?pid=S151783822001000200015&script=sci_arttext>. Acesso em: 10 mar. 2009. doi: 10.1590/S1517-83822001000200015.

POMERANZ et al. Molecular biology of pseudorabies virus: impact on neurovirology and veterinary medicine. Microbiology Molecular Biology Reviews v.69, n.3, p. 462-500, 2005. Disponivel em: <http//:mmbr.asm.org/cgi/content/ abstract/69/3/462>. Acesso em: 21 mar. 2009. doi:10.1128/ MMBR.69.3.462-500.2005.

ROZEN, S.; SKALETSKY, H.J. Primer3. Code available at http://www.bioinformatics.nl/cgi-bin/primer3plus/ primer3plus.cgi. Acesso em: 12 dez. 2008.

SAMI, L. et al. Simultaneous detection of three porcine viruses by multiplex PCR. Acta Veterinaria Hungarian, v. 55, n 2, 267-276, 2007. Disponivel em: <linkinghub.elsevier.com/ retrieve/pii/S0166093406003132>. Acesso em: 16 jun. 2009. doi:10.1016/j.jviromet.2006.09.003.

SILVA, A.D. et al. Caracterizacao antigenica e molecular de oito amostras do virus da doenca de Aujeszky isoladas no estado do Rio Grande do Sul em 2003. Pesquisa Veterinaria Brasileira v.25, n.1, p.21-24, 2005. Disponivel em: <http:/ /www.scielo.br/pdf/bjm/v37n3/v37n3a35.pdf>. Acesso em: 08 jan. 2009. doi: 10.1590/S0100-736X2005000100005.

SCHAEFER, R. et al. Characterization of Aujeszky's disease virus isolated from South Brazil in the last twenty years by restriction enzyme analysis. Brazilian Journal of Microbiology v.37, n.3, p.390-394, 2006. Disponivel em: <http://www.scielo.br/pdf/bjm/v37n3/v37n3a35.pdf>. Acesso em: 17 set. 2008. doi: 10.1590/S1517-83822006000300035.

YAMADA, S. et al. Characterization of Japanese isolates of Aujeszky's disease virus by restriction endonuclease cleavage patterns, virulence in mice and thymidine kinase activity. Journal of Veterinary Medical Science, v.54, n.3, p.541-549, 1992. Disponivel em: <http://www.journalarchive.jst.go.jp/ jnlpdf.php?cdjournal=jvms1991&cdvol = 54 &noissue=3&startpage=523&lang=en&from=jnltoc. Acesso em: 20 jan. 2010. doi: nao informado.

YOON, H.A. et al. Molecular survey of latent pseudorabies virus infection in nervous tissues of slaughtered pigs by nested and real-time PCR. Journal of Microbiology, v.43, n.5, p.430-436, 2005. Disponivel em: <http://www.msk.or.kr/jsp/ view_old_journalD.jsp?paperSeq=2279>. Acesso em: 14 mai. 2009. doi: nao informado.

YOON, H.A. et al. Investigation of pseudorabies virus latency in nervous tissues of seropositive pigs exposed to field strain. Journal of Veterinary Medical Science, v.68, n.2, p.143-148, 2006. Disponivel em: <http://www.jstage.jst.go.jp/ article/jvms/68/2/68_143/_article>. Acesso em: 14 mai. 2009.

WEIGEL, R.M.; SCHERBA, G. Quantitative assessment of genomic similarity from restriction fragment patterns. Preventive Veterinay Medicine, v.32, p.95-110, 1997. Disponivel em: <http://linkinghub.elsevier.com/retrieve/pii/ S0167587796011348>. Acesso em: 14 mai. 2009. doi:10.1016/ S0167-5877(96)01134-8.

Antonio Augusto Fonseca Jr. (I) Marcelo Fernandes Carmagos (I) Regia Maria Feltrin D'Ambros (II) Alexandre Carvalho Braga (III) Janice Ciacci-Zanella (IV) Marcos Bryana Heinemann (V) Romulo Cerqueira Leite (V) Jenner Karlisson Pimenta dos Reis (V)

(I) Laboratorio Nacional Agropecuario, MAPA. Av. Romulo Joviano, sn, CP 50, 33600-000, Pedro Leopoldo, MG, Brasil. E-mail: augustofj@yahoo.com.br. * Autor para correspondencia.

(II) Instituto de Pesquisas Veterinarias Desiderio Finamor (IPVDF), Fepagro, Eldorado do Sul, RS, Brasil.

(III) Centro de Diagnostico em Sanidade Animal, Concordia, SC, Brasil.

(IV) Laboratorio de Sanidade, EMBRAPA Suinos e Aves, Concordia, SC, Brasil.

(V) Laboratorio de Retroviroses, Escola de Veterinaria, UFMG, Belo Horizonte, MG, Brasil.
Tabela 1--Amostras-padrao e de isolados brasileiros de
PrV utilizadas no estudo.

Virus        Isolado de            Origem            Caracteristicas

Shope          Bovino     ATCC; Hungria                  Padrao
Nova Prata     Bovino     RS                             Isolado
031            Suino      Coronel Vivida--PR *           Isolado
673            Suino      M. Candido Rondon--PR *        Isolado
936            Suino      Santa Rosa--PR *               Isolado
Piau           Suino      Igarape--MG                    Isolado
3288           Suino      Seara--SC                      Isolado
3293           Suino      Xanxere--SC                    Isolado
3303           Suino      Toledo--PR                     Isolado
3308           Suino      Rio do Sul--SC                 Isolado
3333           Suino      Desconhecido--SC               Isolado
3338           Suino      Ipumirim--SC                   Isolado
3380           Suino      Concordia--SC                  Isolado
3356           Suino      Concordia--SC                  Isolado
3370           Suino      Concordia--SC                  Isolado
3319           Suino      Concordia--SC                  Isolado
EVI-192/03     Suino      Ponte Preta--RS                Isolado
EVI-193/03     Suino      Erechim--RS                    Isolado
EVI-011/03     Suino      Pinheirinho do Vale--RS        Isolado

Virus        Ano de isolamento   Genotipo

Shope              1942             I
Nova Prata         1956             II
031                1984             I
673                1984             I
936                1983             I
Piau               1984             I
3288               2002             II
3293               1983             II
3303               1984             I
3308               1989             II
3333               2002             II
3338               1983             II
3380               1986             II
3356               1988             II
3370               1984             II
3319               1989             II
EVI-192/03         2003             II
EVI-193/03         2003             II
EVI-011/03         2003             II

* Refere-se ao Estado do Parana.

Tabela 2--Comparacao da sensibilidade analitica da
nested-PCR e PCR convencional para PrV.

Concentracao     Numero de    Numero de amostras positivas
[MATHEMATICAL    repeticoes
EXPRESSION NOT
REPRODUCIBLE
IN ASCII]

                              Nested PCR   PCR gB *

[10.sup.4,3]         10           10          10
[10.sup.3,3]         10           10          10
[10.sup.2,3]         10           10          10
[10.sup.1,3]         10           10          10
[10.sup.0,3]         10           10          8
[10.sup.-1,3]        10           10          2
[10.sup.-2,3]        10           3           0

* PCR descrita por BASCUNANA et al., 1997.
COPYRIGHT 2010 Universidade Federal de Santa Maria
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Fonseca, Antonio Augusto, Jr.; Carmagos, Marcelo Fernandes; D'Ambros, Regia Maria Feltrin; Braga, Al
Publication:Ciencia Rural
Date:Apr 1, 2010
Words:4253
Previous Article:Productivity and technological quality of sugarcane ratoon subject to the application of plant growth regulator and liquid fertilizers/Produtividade...
Next Article:Epidemiology of dogs behavioral problems in Brazil: a survey between small animals veterinary practitioners/Epidemiologia de problemas...
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters