Printer Friendly

Development of a novel multiplex type-specific quantitative realtime PCR for detection and differentiation of infections with human papillomavirus types HPV2, HPV27, and HPV57.

Abstract

Introduction: The present study describes the development and evaluation of the first multiplex type-specific quantitative realtime PCR (RT-PCR), enabling simple, rapid, sensitive, and specific concurrent detection and differentiation of human papillomavirus (HPV) types HPV2, 27, and 57 in a single PCR reaction.

Results: The HPV2/27/57 multiplex RT-PCR with a dynamic range of seven orders of magnitude (discriminating 10 to [10.Sup.8] viral genome equivalents/reaction) has an analytical sensitivity of at least 10 viral copies of each targeted HPV type/reaction, and no cross-reactivities were observed among the included targets. All three primer/probe combinations were efficient in amplifying 500 copies of targeted DNA in a background of [10.Sup.8], [10.Sup.7], 500, 100, and 10 copies of non-targeted viral DNA/reaction, and the performance of the HPV2/27/57 multiplex RT-PCR was additionally not affected by the presence of background human genomic DNA.

When testing DNA isolates obtained from fresh-frozen tissue specimens of various children's warts, the results of the HPV2/27/57 multiplex RT-PCR were completely in line with the results of the conventional Low-risk Alpha-PV PCR.

Conclusion: The newly developed HPV2/27/57 multiplex RT-PCR is an appropriate test for use in routine clinical laboratory settings and for studies focusing on the molecular epidemiology, pathogenesis, and natural history of HPV2/27/57-related lesions.

Keywords: human papillomavirus types HPV2, HPV27, and HPV57, detection, differentiation, multiplex type-specific quantitative real-time PCR, development

Received: 3 October 2016 | Returned for modification: 19 October 2016 | Accepted: 3 November 2016

Introduction

Human papillomavirus (HPV) types 2, 27, and 57, clustering within the species Alphapapillomavirus (Alpha-PV) 4, are etiologically associated with more than 65% of verrucae vulgares or common warts, the most frequent HPV-associated benign lesions of the skin, with the highest prevalence in children and immunosuppressed patients (1-9, 11, 12). Two other Alpha-PV types, HPV6 and HPV11, are in contrast the main etiological agents of condylomata acuminata or anogenital warts, the most frequent HPV-related benign lesion in the anogenital region of both sexes. However, common warts caused by HPV2, HPV27, and HPV57 can also frequently be found in the anogenital region, especially in children, as a result of autoinoculation from common warts from other parts of the body or infection transmitted from common warts of their parents or household members, and could be clinically misdiagnosed as condylomata acuminata (11-19). Such a misdiagnosis could have potential serious consequences because the appearance of new wart(s) in a child's anal or genital region can be considered an indicator of sexual abuse and can potentially trigger legal action against the parents or household members. Thus, although routine detection of HPV types present in tissue specimens or swabs of both condylomata acuminata (anogenital warts) and verrucae vulgares (common warts) is not generally recommended, it could be very helpful in some clinical circumstances and/or for legal purposes, especially in children. However, to be used for such purposes, diagnostic test(s) for detecting and distinguishing HPV types causing condylomata acuminata versus verrucae vulgares should be highly reliable and accurate.

In addition to in situ hybridization methods (20-22), several conventional broad-spectrum polymerase chain reactions (PCR)--which enable detection and differentiation of HPV types that are etiologically associated with condylomata acuminata and verrucae vulgares by subsequent laborious and time-consuming typing of PCR products using agarose gel electrophoresis, hybridization on strips/microtiter wells, and direct Sanger sequencing--have been described previously (23-31). Because in situ hybridization and conventional PCRs are suboptimal methods, de Koning et al. (32) and Schmitt et al. (33) developed broad-spectrum HPV typing bead-based xMAP Luminex suspension arrays, which are able to detect and differentiate 23 and 19 HPV types, respectively, that are most frequently found in common warts, including HPV2, HPV27, and HPV57. In addition, Kohler et al. (7) developed a multiplex type-specific quantitative real-time PCR (RT-PCR), which enables detection and differentiation of infections with HPV27 and HPV57. However, to the best of our knowledge, no quantitative real-time PCR allowing simultaneous amplification and differentiation of HPV2, HPV27, and HPV57 has been developed so far.

This study describes the development and analytical and clinical evaluation of a novel multiplex type-specific quantitative RTPCR, allowing rapid, sensitive, and specific concurrent detection and differentiation of infections with HPV2, HPV27, and HPV57 in a single PCR reaction. The HPV2/27/57 multiplex RT-PCR was evaluated on a collection of fresh-frozen tissue specimens of condylomata acuminata and verrucae vulgares, obtained from children in a routine clinical laboratory setting.

Materials and methods

To determine the most suitable viral genomic region(s) for designing a multiplex RT-PCR, enabling reliable detection and differentiation of infections with HPV2, HPV27, and HPV57, ten complete genome sequences of targeted HPV types retrieved from the Gen-Bank database (accession nos. X55964, EF117890, EF117891, EF362754, EF362755, X74473, AB211993, X55965, U37537, and AB361563) were aligned using the MAFFT v6.846 algorithm (34), as described previously (35). After evaluating the multiple alignment of complete HPV2, HPV27, and HPV57 genome sequences, the HPV L2 gene was selected as the most appropriate target region. Type-specific RT-PCR primers and hydrolysis probes (Table 1), allowing amplification of 144-, 145-, and 157-bp fragments of the respective L2 genes, were designed using Vector NTI Advance V11 software (Thermo Fisher Scientific, Carlsbad, CA) and subsequently revised for thermodynamic features of primer/probe and the potential of binding to non-targeted DNA sequences using the web-based applications NetPrimer (PREMIER Biosoft International, Palo Alto, CA), Primer3 Plus (36), BLAST (National Center for Biotechnology Information, US National Library of Bethesda, MD), and MFEprimer-2.0 (37). As shown in Table 1, primer combinations 2-27F(59.8)/2R(59.2), 2-27F(59.8)/27R(57.6), and 57F(57.8)/57R(57.9) were used to amplify targeted regions of HPV2, HPV27, and HPV57, respectively. Type-specific hydrolysis probes--HPV2-Po(68.25), HPV27-Po(68.55), and HPV57-Po(65.34) (Table 1)--hybridized completely (100%) only with targeted HPV types and presented several (up to seven) nucleotide mismatches with non-targeted nucleotide sequences, enabling reliable discrimination between infections with HPV2, HPV27, and HPV57 (Fig. 1).

In order to optimize the amplification conditions and to evaluate the sensitivity, specificity, and efficiency of the HPV2/27/57 multiplex RT-PCR, plasmid standards containing viral sequences with binding sites of type-specific primers and probes were generated as follows. Three respective sense primers--HPV2-L2FW (5'-CCCATTGTGTGATATTTGC-3'), HPV27-L2-FW (5'-CACCCTCATTGGCTTATTA-3'), and HPV57-L2-FW (5'-CGTCTGCTGCAGTAGTGTAC-3')--were used in combination with the consensus antisense primer HPV2, 27,57-L2-RW (5'-TGACATAGACATCCGTACTGA-3') to amplify 1,730-, 1,599-, and 1,580-bp fragments of HPV2, 27, and 57, respectively. The obtained PCR amplicons were purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into plasmid vectors with the TOPO XL PCR Cloning Kit (Thermo Fisher Scientific). Plasmid HPV2/27/57 DNA was purified using the QIAprep Spin Miniprep Kit (Qiagen), verified by direct Sanger sequencing and quantified at 260 nm using a NanoDrop ND-2000c spectrophotometer (NanoDrop Technologies, Oxfordshire, UK). The quantified plasmids contained 1.31 x [10.Sup.10], 3.30 x [10.Sup.10], and 2.59 x [10.Sup.10] copies of HPV2, 27, and 57 DNA per[mu]l respectively, and were subsequently serially diluted, as described previously (38). All commercially available reagents were used according to the manufacturers' instructions.

The HPV2/27/57 multiplex RT-PCR was performed in a 96-well plate on a LightCycler 480 Instrument II using a LightCycler 480 Probes Master kit (Roche Diagnostics, Mannheim, Germany). The RT-PCR protocol was designed following the manufacturer's instructions and adjusted to (i) characteristics of targeted nucleotide sequences and synthesized primers/probes and (ii) estimated length of RT-PCR amplicons. The thoroughly optimized reaction mixture consisted of 10 [mu]l of 2 x LightCycler 480 Probes Master (Roche Diagnostics), 0.5 [mu]M of each RT-PCR primer (Table 1), with the exception of the 2-27F(59.8) primer, which was used in a concentration of 1 [mu]M, 0.1 [mu]M of each probe, 5 [mu]l of template DNA (50-100 ng of DNA extracted from clinical samples and 1 x 10--1 x [10.Sup.8] DNA copies/reaction of plasmid standards), and PCR-grade water up to the final reaction volume of 20 [mu]l. The amplification of targeted nucleotide sequences was performed as follows: (i) initial denaturation of template DNA at 95 [degrees]C for 10 min (temperature transition rate of 4.4 [degrees]C/s), (ii) followed by 40 amplification cycles consisting of three incubation steps: 95 [degrees]C for 10 s (4.4 [degrees]C/s), 60 [degrees]C for 30 s (2.2 [degrees]C/s), and 72 [degrees]C for 1 s (4.4 [degrees]C/s; fluorescent signal acquisition), and (iii) a final cooling step at 2.2 [degrees]C/s to 40 [degrees]C with a 30 s hold. Since type-specific hydrolysis probes were labeled with three different 5' fluorophores (TEX, YAK, and FAM; Table 1), real-time monitoring of the fluorescent signal was performed on 610, 560, and 530 nm channels, indicating amplification of HPV2, HPV27, and HPV57, respectively. In addition, due to the slight overlap of the emission spectra of the dyes, the software's color compensation function was applied during the analysis of all RTPCR experiments. Moreover, the specificity of all HPV2/27/57 RTPCR amplicons was further confirmed by direct Sanger sequencing with the same primers as used for the RT-PCR, as described previously (39).

The performance of the HPV2/27/57 multiplex RT-PCR in the routine clinical laboratory setting was evaluated on 35 fresh-frozen tissue samples, obtained from the same number of children, 2 to 18 years old, with common warts (10 samples) and anogenital warts (25 samples) that were referred to the Laboratory for Molecular Microbiology and Slovenian HIV/AIDS Reference Centre, Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, in the last 10 years.

The tissue samples were first processed for total DNA extraction with a QIAamp DNA Mini Kit (Qiagen) and spectrophotometric analysis of eluted DNA, as described previously (40). Up to 100 ng of extracted DNA was used for downstream PCR analyses.

The integrity of the extracted DNA was determined by the quantitative RT-PCR, enabling amplification of the 150-bp fragment of human beta-globin gene. Briefly, the beta-globin RT-PCR was performed on a LightCycler 2.0 Instrument (Roche Diagnostics) using a QuantiTect SYBR Green PCR + UNG Kit (Qiagen). The reaction mixture consisted of 12.5 [mu]l of 2 x QuantiTect SYBR Green PCR Master mix, 0.5 [mu]M of each primer (41), 5 [mu]l of extracted DNA, and PCR-grade water up to the final reaction volume of 25[mu]l The amplification of human DNA was performed as follows: (i) initial denaturation of template DNA at 95 [degrees]C for 15 min (temperature transition rate of 20 [degrees]C/s), (ii) followed by 45 amplification cycles consisting of three incubation steps: 94 [degrees]C for 15 s (20 [degrees]C/s), 60 [degrees]C for 20 s (20 [degrees]C/s), and 72 [degrees]C for 20 s (2 [degrees]C/s; fluorescent signal acquisition at 530 nm), (iii) a melting curve analysis, consisting of three incubation steps: 95 [degrees]C for o s (20 [degrees]C/s), 50 [degrees]C for 30 s (20 [degrees]C/s), and 95 [degrees]C for o s (0.1 [degrees]C/s), and (iv) a final cooling step at 20 [degrees]C/s to 40 [degrees]C with a 30 s hold. Testing triplicates of 10-fold serially diluted standards of commercially available human DNA (Human Genomic DNA; Promega, Madison, WI), spanning from 100 ng to 1 pg of DNA per reaction, showed that the beta-globin RT-PCR had a sensitivity of at least 10 pg of human DNA per reaction. The correlation coefficient (R(2)) of the standard curve estimated from amplification of human DNA standards over six orders of magnitude and the efficiency of human DNA amplification (E) were estimated at 0.996 and 91.4%, respectively. Only beta-globin-positive DNA isolates (melting peaks between 80.5 and 81.5 [degrees]C) were considered adequate for further analyses.

To detect low-risk Alpha-PVs associated with various mucosal and cutaneous warts, a PCR protocol targeting an approximately 190-bp fragment of the E1 gene of HPV2, HPV3, HPV6, HPV7, HPV10, HPV11, HPV13, HPV27, HPV28, HPV29, HPV32, HPV40, HPV42, HPV43, HPV44, HPV57, HPV74, HPV77, HPV78, HPV91, HPV94, HPV117, and HPV125 was performed, as described elsewhere (31), and HPV types were subsequently determined by direct Sanger sequencing of all eligible PCR products, as described previously (39). Furthermore, a FRET-based HPV6/11 RT-PCR (40), enabling reliable detection and differentiation of 25.3, 42.9, and 43.4 DNA copies of HPV11 and prototypic and non-prototypic HPV6 genomic variants, respectively, was additionally used to determine the causal agents of condylomata acuminata.

Results

Testing replicates of 10-fold serially diluted plasmids containing targeted fragments of HPV2, HPV27, and HPV57 in concentrations spanning from 1 x [10.Sup.8] to 1 x 10 DNA copies per reaction, in a background of 100 ng of Human Genomic DNA, showed that the HPV2/27/57 multiplex RT-PCR is able to detect at least 10 viral copies of each targeted HPV type per a single reaction (Fig. 2; A1, B1, C1). The dynamic range of HPV2/27/57 multiplex RT-PCR was seven orders of magnitude for all targeted HPV types, enabling reliable discrimination of 10 to [10.Sup.8] viral genome equivalents per a single reaction. The correlation coefficients (R(2)) of standard curves estimated from amplification of plasmid standards containing fragments of HPV2, HPV27, and HPV57 were 0.999, 0.999, and 0.998, respectively. The amplification efficiencies (E) were estimated at 95.2, 92.0, and 92.2% for HPV2, HPV27, and HPV57, respectively, and the performance of the HPV2/27/57 multiplex RT-PCR was not affected by the presence of background human genomic DNA. In addition, as shown in Fig. 2 (A2, B2, and C2), no cross-reactivities of HPV27/HPV57, HPV2/HPV57, and HPV2/HPV27 were observed when using primer/probe combinations targeting HPV2, HPV27, and HPV57, respectively. Moreover, all three primer/probe combinations were efficient in amplifying 500 copies of targeted DNA in a background of 1 x [10.Sup.8], 1 x [10.Sup.7], 500, 100, and 10 copies of nontargeted viral DNA per reaction (Fig. 2; A3, B3, C3).

As shown in Table 2, the targeted fragment of human betaglobin gene was successfully amplified from all 35 DNA isolates obtained from fresh-frozen tissue specimens of condylomata acuminata and verrucae vulgares. HPV2, HPV27, and HPV57 were detected in 7/10 (70.0%) tested verrucae vulgares using both Low-risk Alpha-PV PCR and HPV2/27/57 multiplex RT-PCR; and in all seven HPV-positive cases both PCRs identified the same HPV type (Table 2; samples nos. 1-7). The results of both PCRs were additionally completely concordant when testing different warts from the anogenital region, since HPV2, HPV27, and HPV57 were detected in 13/25 (52.0%) tested samples, irrespective of the method used. Furthermore, in seven condylomata acuminata that were previously HPV6-positive using Low-risk Alpha-PV PCR, the presence of HPV6 was confirmed with the HPV6/11 RT-PCR and all seven samples tested HPV2/27/57-negative using the HPV2/27/57 multiplex RT-PCR (Table 2, samples nos. 24-30). Using the PCR protocols mentioned above, Alpha-PV DNA was absent in three and five samples of tested verrucae vulgares and condylomata acuminata, respectively (Table 2, samples nos. 8-10 and nos. 31-35, respectively).

Discussion

Verrucae vulgares or common warts constitute the most frequent benign HPV-associated skin condition, especially in children and immunosuppressed patients (5, 6). Most common warts resolve spontaneously within several months, have a benign nature, and are successfully treated with various regimens or procedures such as cryotherapy, salicylic acid, and topical and intralesional immunotherapy (42). Although they are more prevalent in children, the etiology of common warts does not differ according to patient's age group; common warts are most frequently associated with infections with three HPV genotypes: HPV2, HPV27, and HPV57 (1-12). In contrast, the etiology of warts found in the anogenital region differs between children and adults. Sexually transmitted HPV6 and HPV11 are by far the most common HPV types identified in warts in the anogenital region of adult patients of both genders because the great majority of these warts are indeed condylomata acuminata and only rarely verrucae vulgares (11, 12, 16-18, 43). In contrast, up to two-thirds of warts found in the anogenital region of children are actually verrucae vulgares, which are most frequently etiologically associated with infections with HPV2, HPV27, and HPV57 (13-15, 19). Even though both HPV6 and HPV11 are associated with a small proportion of warts found in the anogenital region of children, the routes of transmission of condylomata acuminata in this population are mostly non-sexual, including vertical transmission and indirect transmission through contaminated objects or surfaces, and are only rarely a result of sexual abuse (13-15, 19).

For years, warts identified in the anogenital region of patients of all ages (including children) referred to our molecular diagnostics laboratory had first been tested for the presence of Alpha-PVs using the Low-risk Alpha-PV PCR (31), with a turnaround time of at least 370 min, including the analysis of PCR products using direct Sanger sequencing. Although very sensitive and specific, Low-risk Alpha-PV PCR is quite laborious, has a long turnaround time, and is therefore inappropriate for use in a routine clinical laboratory setting. The newly developed HPV2/27/57 multiplex RT-PCR is able to specifically detect at least 10 viral copies per a single reaction of each targeted HPV type, irrespective of potentially high concentrations of other HPV types present in a sample (concurrent HPV infection with several HPV types), and its performance is also not affected by the presence of a high background of human genomic DNA. Furthermore, HPV2/27/57 multiplex RTPCR has a relatively short turnaround time of approximately 70 min, rendering it appropriate for routine diagnostics. Therefore, when testing warts found in the anogenital region of a child, the HPV2/27/57 multiplex RT-PCR recently became the method of choice in our laboratory. HPV2/27/57-negative children's warts are subsequently tested for the presence of HPV6 and HPV11 using the HPV6/11 RT-PCR (40), and when both of these RT-PCRs are negative the conventional Low-risk Alpha-PV PCR is used as a supportive method due to its ability to detect several other cutaneous and mucosal wart-associated Alpha-PV types (31). In contrast, because more than 90% of warts identified in the anogenital region of adult patients are etiologically associated with sexually transmitted HPV6 and HPV11 (11, 12, 16-18, 43), when testing this patient population the method of choice in our laboratory is the HPV6/11 RT-PCR (40), followed in the case of a negative result by HPV2/27/57 multiplex RT-PCR and Low-risk Alpha-PV-PCR (31). Alpha-PV-negative wart tissue samples are additionally tested in our laboratory for research purposes only for the presence of several Gamma- and Mu-PVs that cause sporadic cutaneous warts (7, 9, 11, 12, 26, 44, 45). All HPV-negative warts identified in the anogenital region of patients of all ages and both sexes are additionally tested in our laboratory for the presence of molluscum contagio-sum virus (MCV) using the MCV FRET RT-PCR (45) because, due to the similar clinical appearance of lesions, up to 10% of molluscum contagiosum lesions can be misdiagnosed as condylomata acuminata or verrucae vulgares and vice versa (45-48).

Because HPV2, HPV27, and HPV57 are associated with a large fraction of verrucae vulgares in immunosuppressed patients, in which they often occur ubiquitously and confluently, Senger et al. provided a basis for the development of virus-like particle-based vaccines against cutaneous Alpha-PVs (49, 50). Our HPV2/27/57 multiplex RT-PCR could therefore be additionally applicable for large epidemiological studies of the etiology of common warts in immunosuppressed patients and for potential evaluation of the efficacy of the future vaccine(s) against HPV2, HPV27, and HPV57.

In contrast to previously described conventional PCRs (23-30), which amplify up to 835-bp fragments of HPV DNA, the HPV2/27/57 multiplex RT-PCR targets significantly shorter HPV DNA fragments (144-157-bp), also rendering it very appropriate for HPV typing in archival tissue specimens (51). Furthermore, the majority of conventional broad-spectrum PCRs are not suitable for detecting viral targets present in low concentrations, and Sanger sequencing of PCR products hinders the identification of concurrent HPV infections. Namely, in sporadic cases of common warts concurrent infections with two or more HPV types can be identified, including their well-known etiological agents, such as HPV1, HPV2, HPV4, HPV7, HPV27, HPV57, and HPV65 (3, 7, 10, 26, 32).

Because one of the surrogate markers for determining the etiology of common warts is the estimation of the viral load of each HPV type present in the lesion of question (7, 35, 52), HPV2/27/57 multiplex RT-PCR can be used in combination with other quantitative HPV type-specific RT-PCRs to identify the HPV type with the highest HPV viral load and consequently the highest probability of being a "true" etiological agent of the investigated common wart.

In conclusion, the newly developed HPV2/27/57 multiplex RTPCR, which enables simple, rapid, sensitive, and specific concurrent detection and differentiation of infections with HPV2, HPV27, and HPV57 in a single PCR reaction, is an appropriate test for use in routine clinical laboratory settings and for studies focusing on the molecular epidemiology, pathogenesis, and natural history of HPV2/27/57-related lesions.

Funding

This study was funded by the Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana. The study was partially supported by the European Union's Seventh Framework Program for research, technological development, and demonstration under the CoheaHr project (grant agreement no. HEALTH-F3-2013-603019).

Conflicts of interest

The authors have no conflicts of interest to declare.

Acknowledgement

The authors would like to thank our clinical colleagues--Vesna Breznik, Sarah Dobnik, Vlasta Dragos, Andreja Komac, Petra Meglic, Bostjan Mlakar, Kristina Nikolajevic, Katarina Planinc Pustovrh, Ruzica Preveden, Marija Rebolj Stare, Mirjam Rogl Butina, Ursula Salobir Gajsek, Mojca Simoncic Godnic, Janja Smid, Mateja Starbek Zorko, Andreja Stolfa, Vesna Tlaker Zunter, Janez Tomazic, and Lina Virnik Kovac--for collecting clinical samples of common warts and anogenital warts. In addition, we would like to thank Robert Kroselj, Blanka Kusar, Petra Markocic, Anja Ostrbenk, Tina Stamol, and Sonja Vuletic for their invaluable technical assistance in detecting infections with HPV and molluscum contagiosum virus.

References

(1). Rubben A, Krones R, Schwetschenau B, Grussendorf-Conen El. Common warts from immunocompetent patients show the same distribution of human papillomavirus types as common warts from immunocompromised patients. Br J Dermatol. 1993; 128:264-70.

(2). Jabtonska S, Majewski S, Obalek S, Orth G. Cutaneous warts. Clin Dermatol. 1997; 15:309-19.

(3). Rubben A, Kalka K, Spelten B, Grussendorf-Conen El. Clinical features and age distribution of patients with HPV2/27/57-induced common warts. Arch Dermatol Res. 1997; 289:337-40.

(4). Majewski S, Jablonska S. The role of HPVs in benign and malignant cutaneous proliferations. Papillomavirus Report. 2003; 14:1-10.

(5). Bouwes Bavinck JN, Euvrard S, Naldi L, Nindl I, Proby CM, Neale R, et al. Keratotic skin lesions and other risk factors are associated with skin cancer in organtransplant recipients: a case-control study in The Netherlands, United Kingdom, Germany, France, and Italy. J Invest Dermatol. 2007; 127:1647-56.

(6). van Haalen FM, Bruggink SC, Gussekloo J, Assendelft WJ, Eekhof JA. Warts in primary schoolchildren: prevalence and relation with environmental factors. Br J Dermatol. 2009; 161:148-52.

(7). Kohler A, Meyer T, Stockfleth E, Nindl I. High viral load of human wart-associated papillomaviruses (PV) but not beta-PV in cutaneous warts independent of immunosuppression. Br J Dermatol. 2009; 161:528-35.

(8). Cardoso JC, Calonje E. Cutaneous manifestations of human papillomaviruses: a review. Acta Dermatovenerol Alp Pannonica Adriat. 2011; 20:145-54.

(9). de Koning MN, Khoe LV, Eekhof JA, Kamp M, Gussekloo J, ter Schegget J, et al. Lesional HPV types of cutaneous warts can be reliably identified by surface swabs. J Clin Virol. 2011; 52:84-7.

(10). Bruggink SC, de Koning MN, Gussekloo J, Egberts PF, ter Schegget J, Feltkamp MC, et al. Cutaneous wart-associated HPV types: prevalence and relation with patient characteristics. J Clin Virol. 2012; 55:250-5.

(11). Cubie HA. Diseases associated with human papillomavirus infection. Virology. 2013; 445:21-34.

(12). Doorbar J, Egawa N, Griffin H, Kranjec C, Murakami I. Human papillomavirus molecular biology and disease association. Rev Med Virol. 2015; 25:2-23.

(13). Syrjanen S, Puranen M. Human papillomavirus infections in children: the potential role of maternal transmission. Crit Rev Oral Biol Med. 2000; 11:259-74.

(14). Marcoux D, Nadeau K, McCuaig C, et al. Pediatric anogenital warts: a 7-year review of children referred to a tertiary-care hospital in Montreal, Canada. Pediatr Dermatol. 2006; 23:199-207.

(15). Aguilera-Barrantes I, Magro C, Nuovo GJ. Verruca vulgaris of the vulva in children and adults: a nonvenereal type of vulvar wart. Am J Surg Pathol. 2007; 31:529-35.

71

(16). Aubin F, Pretet JL, Jacquard AC, Saunier M, Carcopino X, Jaroud F, et al. Human papillomavirus genotype distribution in external acuminata condylomata: a large French national study (EDiTH IV). Clin Infect Dis. 2008; 47:610-5.

(17). Garland SM, Steben M, Sings HL, James M, Lu S, Railkar R, et al. Natural history of genital warts: analysis of the placebo arm of 2 randomized phase III trials of a quadrivalent HPV (types 6, 11, 16, 18) vaccine. J Infect Dis. 2009; 119:805-14.

(18). Komlos KF, Kocjan BJ, Kosorok P, Luzar B, Meglic L, Potocnik M, et al. Tumorspecific and gender-specific pre-vaccination distribution of human papillomavirus types 6 and 11 in anogenital warts and laryngeal papillomas: a study on 574 tissue specimens. J Med Virol. 2012; 84:1233-41.

(19). Varma S, Lathrop E, Haddad LB. Pediatric condylomata acuminata. J Pediatr Adolesc Gynecol. 2013; 26:e121-2.

(20). Nuovo GJ, Lastarria DA, Smith S, Lerner J, Comite SL, Eliezri YD. Human papillomavirus segregation patterns in genital and nongenital warts in prepubertal children and adults. Am J Clin Pathol. 1991; 95:467-74.

(21). Anderson KM, Perez-Montiel D, Miles L, Allen CM, Nuovo GJ. The histologic differentiation of oral condylomata acuminatum from its mimics. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003; 96:420-8.

(22). Purdie KJ, Surentheran T, Sterling JC, Bell L, McGregor JM, Proby CM, et al. Human papillomavirus gene expression in cutaneous squamous cell carcinomas from immunosuppressed and immunocompetent individuals. J Invest Dermatol. 2005; 125:98-107.

(23). Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. The use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells. 1989; 7:209-14.

(24). Shamanin V, Delius H, de Villiers E. Development of a broad spectrum PCR assay for papillomaviruses and its application in screening lung cancer biopsies. J Gen Virol. 1994; 75:1149-56.

(25). Forslund O, Antonsson A, Nordin P, Stenquist B, Hansson BG. A broad range of human papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. J Gen Virol. 1999; 80:2437-43.

(26). Harwood CA, Spink PJ, Surentheran T, Leigh IM, de Villiers EM, McGregor JM, et al. Degenerate and nested PCR: a highly sensitive and specific method for detection of human papillomavirus infection in cutaneous warts. J Clin Microbiol. 1999; 37:3545-55.

(27). Lai JY, Doyle RJ, Bluhm JM, Johnson JC. Multiplexed PCR genotyping of HPVs from plantaris verrucae. J Clin Virol. 2006; 35:435-41.

(28). Jeney C, Takacs T, Sebe A, Schaff Z. Detection and typing of 46 genital human papillomaviruses by the L1F/L1R primer system based multiplex PCR and hybridization. J Virol Methods. 2007; 140:32-42.

(29). Lei YJ, Gao C, An R, Shi Q, Chen JM, Yuan YK, et al. Development of a multiplex PCR method for detecting and typing human papillomaviruses in verrucae vulgaris. J Virol Methods. 2008; 147:72-7.

(30). Sasagawa T, Mitsuishi T. Novel polymerase chain reaction method for detecting cutaneous human papillomavirus DNA. J Med Virol. 2012; 84:138-44.

(31). Odar K, Kocjan BJ, Hosnjak L, Gale N, Poljak M, Zidar N. Verrucous carcinoma of the head and neck--not a human papillomavirus-related tumour? J Cell Mol Med. 2014; 18:635-45.

(32). de Koning MN, ter Schegget J, Eekhof JA, Kamp M, Kleter B, Gussekloo J, et al. Evaluation of a novel broad-spectrum PCR-multiplex genotyping assay for identification of cutaneous wart-associated human papillomavirus types. J Clin Microbiol. 2010; 48:1706-11.

(33). Schmitt M, de Koning MN, Eekhof JA, Quint WG, Pawlita M. Evaluation of a novel multiplex human papillomavirus (HPV) genotyping assay for HPV types in skin warts. J Clin Microbiol. 2011; 49:3262-7.

(34). Katoh K, Toh H. Parallelization of the MAFFT multiple sequence alignment program. Bioinformatics. 2010; 26:1899-900.

(35). Hosnjak L, Kocjan BJ, Pirs B, Seme K, Poljak M. Characterization of two novel gammapapillomaviruses, HPV179 and HPV184, isolated from common warts of a renal-transplant recipient. PLoS One. 2015; 10:e0119154.

(36). Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012; 40:e115.

(37). Qu W, Zhou Y, Zhang Y, Lu Y, Wang X, Zhao D, et al. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity. Nucleic Acids Res. 2012; 40:W205-8.

(38). Kocjan BJ, Poljak M, Seme K. Universal ProbeLibrary based real-time PCR assay for detection and confirmation of human papillomavirus genotype 52 infections. J Virol Methods. 2010; 163:492-4.

(39). Kocjan BJ, Poljak M, Seme K, Potocnik M, Fujs K, Babic DZ. Distribution of human papillomavirus genotypes in plucked eyebrow hairs from Slovenian males with genital warts. Infect Genet Evol. 2005; 5:255-9.

(40). Kocjan BJ, Seme K, Poljak M. Detection and differentiation of human papillomavirus genotypes HPV-6 and HPV-11 by FRET-based real-time PCR. J Virol Methods. 2008; 153:245-9.

(41). van Duin M, Snijders PJ, Schrijnemakers HF, Voorhorst FJ, Rozendaal L, Nobbenhuis MA, et al. Human papillomavirus 16 load in normal and abnormal cervical scrapes: an indicator of CIN II/III and viral clearance. Int J Cancer. 2002; 98:590-5.

(42). Sterling J. Treatment of warts and molluscum: what does the evidence show? Curr Opin Pediatr. 2016; 28:490-9.

(43). Majewski S, Jablonska S. Human papillomavirus-associated tumors of the skin and mucosa. J Am Acad Dermatol. 1997; 36:659-85.

(44). Ure AE, Forslund O. Characterization of human papillomavirus type 154 and tissue tropism of gammapapillomaviruses. PLoS One. 2014; 9:e89342.

(45). Hosnjak L, Kocjan BJ, Kusar B, Seme K, Poljak M. Rapid detection and typing of Molluscum contagiosum virus by FRET-based real-time PCR. J Virol Methods. 2013; 187:431-4.

(46). Hanson D, Diven DG. Molluscum contagiosum. Dermatol Online J. 2003; 9:2.

(47). Tyring SK. Molluscum contagiosum: the importance of early diagnosis and treatment. Am J Obstet Gynecol. 2003; 189:12-6.

(48). Trama JP, Adelson ME, Mordechai E. Identification and genotyping of molluscum contagiosum virus from genital swab samples by real-time PCR and pyrosequencing. J Clin Virol. 2007; 40:325-9.

(49). Senger T, Becker MR, Schadlich L, Waterboer T, Gissmann L. Identification of B-cell epitopes on virus-like particles of cutaneous alpha-human papillomaviruses. J Virol. 2009; 83:12692-701.

(50). Senger T, Schadlich L, Textor S, Klein C, Michael KM, Buck CB, et al. Virus-like particles and capsomeres are potent vaccines against cutaneous alpha HPVs. Vaccine. 2010; 10;28:1583-93.

(51). Kocjan BJ, Hosnjak L, Poljak M. Detection of alpha human papillomaviruses in archival formalin-fixed, paraffin-embedded (FFPE) tissue specimens. J Clin Virol. 2016; 76 Suppl 1:S88-97.

(52). Bzhalava D, Johansson H, Ekstrom J, Faust H, Moller B, Eklund C, et al. Unbiased approach for virus detection in skin lesions. PLoS One. 2013; 8:e65953.

(1)Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, Ljubljana, Slovenia. * Corresponding author: mario.poljak@mf.uni-lj.si

Table 1 | Nucleotide sequences of primers and hydrolysis probes
designed for amplification of partial L2 genes of HPV2, HPV27,
and HPV57.

Primer/probe        Nucleotide sequence (5'--3')
2-27F(59.8)(b)         TACCTGCCCCCCAGACATT
2R(59.2)              GGAATGTACCCAGTACGCCC
27R(57.6)            AGGAATATACCCGGTACGTCC
57F(57.8)             GCAAGCAGGCTGGAACG
57R(57.9)            GGTATGTAGCCTGTGCGTCC
HPV2-PO(68.25)   TEX-CCCAAGAGTGGAACAGAACACTTTAGCA-BBQ
HPV27-PO(68.55)  YAK-CTAGGGGTCTTCTTTGGCGGTCTTG-BBQ
HPV57-PO(65.34)  FAM-TTCGGTGGCCTCGGTATAGGTACT-BBQ
Primer/probe          Nucleotide position(a)
2-27F(59.8)(b)   HPV2 (4,386--4,404), HPV27 (4,359--4,377)
2R(59.2)                 HPV2 (4,529--4,510)
27R(57.6)                HPV27 (4,503--4,483)
57F(57.8)                HPV57 (4,327--4,343)
57R(57.9)                HPV57 (4,483--4,464)
HPV2-PO(68.25)           HPV2 (4,407--4,434)
HPV27-PO(68.55)          HPV27 (4,432--4,456)
HPV57-PO(65.34)          HPV57 (4,425--4,448)
Primer/probe       Amplicon size
2-27F(59.8)(b)     HPV2 (144-bp)
2R(59.2)           HPV27 (145-bp)
27R(57.6)
57F(57.8)          HPV57 (157-bp)
57R(57.9)
HPV2-PO(68.25)
HPV27-PO(68.55)
HPV57-PO(65.34)

Legend/abbreviations: (a)Nucleotide positions of primers and probes
were compared to HPV2, HPV27, and HPV57 reference sequences
(Gen Bank accession nos. X55964, X74473, and X55965, respectively),
which were adjusted to start with a first nucleotide of respective
E6 genes. (b)A single sense primer was used to amplify targeted regions
of two HPV types (HPV2 and HPV27).

HPV2-P0(68.25)   C C C A A G A G T G G A A C A G A A C A C T T T A G C A

HPV2a-X55964     * * * * * * * * * * * * * * * * * * * * * * * * * * * *
HPV2-EF117890    * * * * * * * * * * * * * * * * * * * * * * * * * * * *
HPV2-EF117891    * * * * * * * * * * * * * * * * * * * * * * * * * * * *
HPV2-EF362754    * * * * * * * * * * * * * * * * * * * * * * * * * * * *
HPV2-EF362755    * * * * * * * * * * * * * * * * * * * * * * * * * * * *
HPV27-X74473     T * * * * * G C * A * * * * * A * * * * * C * * G * * *
HPV27b-AB211993  T * * * * * G C * * * * * * * A * * * * * C * * G * * *
HPV57-X55965     A * * T * * G * * * * * * * * * G * * * * A * * * * * T
HPV57b-U37537    A * * T * * G * * * * * * * * * G * * * * A * * * * * T
HPV57c-AB361563  A * * T * * G * * * * * * * * * G * * * * A * * * * * T

HPV27-P0(68.55)  C T A G G G G T C T T C T T T G G C G G T C T T G
HPV2a-X55964     T * * * * T * * G * * T * * * * * G * * * * * A *
HPV2-EF117890    T * * * * T * * G * * T * * * * * G * * * * * A *
HPV2-EF117891    T * * * * T * * G * * T * * * * * G * * * * * A *
HPV2-EF362754    T * * * * T * * G * * T * * * * * G * * * * * A *
HPV2-EF362755    T * * * * T * * G * * T * * * * * G * * * * * A *
HPV27-X74473     * * * * * * * * * * * * * * * * * * * * * * * * *
HPV27b-AB211993  * * * * * * * * * * * * * * * * * * * * * * * * *
HPV57-X55965     * * G * * * * * * * * T * * C * * T * * C * * C *
HPV57b-U37537    * * * * * * * * * * * T * * C * * T * * C * * C *
HPV57c-AB361563  * * * * * * * * * * * T * * C * * T * * C * * C *

HPV57-P0(65.34)  T T C G G T G G C C T C G G T A T A G G T A C T
HPV2a-X55964     * * T * * G * * T * * A * * * * * * * * C * * C
HPV2-EF117890    * * T * * G * * T * * A * * * * * * * * C * * C
HPV2-EF117891    * * T * * G * * T * * A * * * * * * * * C * * *
HPV2-EF362754    * * T * * G * * T * * A * * * * * * * * C * * *
HPV2-EF362755    * * T * * G * * T * * A * * * * * * * * C * * C
HPV27-X74473     * * T * * C * * T * * T * * * * * * * * C * * *
HPV27b-AB211993  * * T * * C * * T * * T * * * * * * * * C * * *
HPV57-X55965     * * * * * * * * * * * * * * * * * * * * * * * *
HPV57b-U37537    * * * * * * * * * * * * * * * * * * * * * * * *
HPV57c-AB361563  * * * * * * * * * * * * * * * * * * * * * * * *

Figure 1 | Schematic diagram showing hybridization of HPV2, HPV27, and
HPV57 type-specific hydrolysis probes to respective L2 gene sequences.
The figure was obtained from a multiple sequence alignment of
type-specific hydrolysis probes and complete genome sequences of
respective HPV types that were retrieved from the GenBank database
(GenBank accession numbers are provided next to all full genome
sequences included). Dots show the nucleotide positions of hydrolysis
probes identical to the targeted regions of HPV2, HPV27, and HPV57.

Table 2 | Clinical samples of condylomata acuminata and verrucae
vulgares used to evaluate the performance of the HPV2/27/57 multiplex
RT-PCR in the routine clinical laboratory setting.

Patient no.  Age (years)  Beta-globin RT-PCR(a)  Low-risk

 1                9           positive              HPV2
 2                5           positive              HPV2
 3               10           positive              HPV27
 4               12           positive              HPV27
 5                7           positive              HPV57
 6               13           positive              HPV57
 7               14           positive              HPV57
 8               18           positive            negative
 9               12           positive            negative
10               13           positive            negative
11                4           positive              HPV2
12                8           positive              HPV2
13                5           positive              HPV2
14                6           positive              HPV2
15                9           positive              HPV2
16                7           positive              HPV2
17                6           positive             HPV57
18               11           positive             HPV57
19                4           positive             HPV57
20                5           positive             HPV57
21                8           positive             HPV57
22                5           positive             HPV57
23               12           positive             HPV57
24                5           positive             HPV6
25                8           positive             HPV6
26                6           positive             HPV6
27                7           positive             HPV6
28                7           positive             HPV6
29                4           positive             HPV6
30                3           positive             HPV6
31                5           positive            negative
32                7           positive            negative
33                2           positive            negative
34                3           positive            negative
35                4           positive            negative

Patient no.  HPV6/11 RT-PCR(c)  HPV2/27/57 multiplex RT-PCR

 1             negative                HPV2
 2             negative                HPV2
 3             negative                HPV27
 4             negative                HPV27
 5             negative                HPV57
 6             negative                HPV57
 7             negative                HPV57
 8             negative              negative
 9             negative              negative
10             negative              negative
11             negative                HPV2
12             negative                HPV2
13             negative                HPV2
14             negative                HPV2
15             negative                HPV2
16             negative                HPV2
17             negative                HPV57
18             negative                HPV57
19             negative                HPV57
20             negative                HPV57
21             negative                HPV57
22             negative                HPV57
23             negative                HPV57
24               HPV6                negative
25               HPV6                negative
26               HPV6                negative
27               HPV6                negative
28               HPV6                negative
29               HPV6                negative
30               HPV6                negative
31             negative              negative
32             negative              negative
33             negative              negative
34             negative              negative
35             negative              negative

Legend/abbreviations: (a)The integrity of the extracted DNA was
determined by the quantitative RT-PCR, enabling amplification of
the 150-bp fragment of human beta-globin gene. (b)A previously
published Low-risk Alpha-PV PCR (31) was used to detect Alpha-PVs
that are most frequently associated with various mucosal and
cutaneous warts. (c)A FRET-based HPV6/11 RT-PCR (40), enabling
reliable detection and differentiation of HPV11 and prototypic and
non-prototypic HPV6 genomic variants, respectively, was used to
determine the causal agents of condylomata acuminata. Tissue samples
obtained from patients nos. 8-10 and 31-35 were
additionally tested for the presence of Gamma/Mu-PVs and/or MCV
(data not shown).
COPYRIGHT 2016 Association of Slovenian Dermatovenerologists
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Hosnjak, Lea; Komlos, Kristina Fujs; Kocjan, Bostjan J.; Seme, Katja; Poljak, Mario
Publication:Acta Dermatovenerologica Alpina, Pannonica et Adriatica
Date:Oct 1, 2016
Words:6174
Previous Article:The first 25 years of acta dermatovenerologica alpina, pannonica et adriatica.
Next Article:Microbiological characteristics of perianal streptococcal dermatitis: a retrospective study of 105 patients in a 10-year period.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |