Printer Friendly

Development of a DNA microarray-based identification system for commercially important Korean oyster species.

ABSTRACT The correct identification of oyster species is essential for both aquaculture and taxonomic study, but it has often been a challenging task due to enormous morphological variation in shell morphs with ecophenotypic origins. The difficulty of species identification based entirely on shell characters has raised the need for developing an accurate, rapid tool for the identification and discrimination of oyster species. In this study, a DNA microarray-based identification system was established for eight commercially important oyster species (Crassostrea ariakensis, Crassostrea gigas, Crassostrea sikamea, Crassostrea nippona, Crassostrea angulata, Ostrea circumpicta, Ostrea denselamellosa, and Saccostrea kegaki). Sixteen species- specific probes developed in this study unambiguously distinguished eight target oyster species with no false-positive or false- negative signals. Of the eight oyster species examined, three Crassostrea species, C. angulata, C. gigas, and C. sikamea, which are indistinguishable by morphology, could be precisely identified using species-specific hybridization probes. The DNA microarray-based identification system developed in this study offers a very effective and reliable tool for eight oyster species, most of which are of commercial value and/or ecological significance in the macrobenthic community of offshore marine environments.

KEY WORDS: DNA microarray, molecular identification, oyster, Crassostrea, Ostrea, mitochondrial cox1

INTRODUCTION

Oysters are benthic marine bivalves that are distributed worldwide along the nearshore marine and estuarine habitats of temperate, subtropical, and tropical areas (Ruesink et al. 2005). They have a significant impact on coastal ecosystems in diverse ways by maintaining water quality and nutrient cycling (by filtering water) and providing habitats for other nearshore-dwelling organisms (Ruesink et al. 2005, Stunz et al. 2010). Oysters have long been considered as among the most economically important molluscs, and the magnitude of the oyster fishery market has continuously increased during the last decades (Crosse et al. 2006). The annual production in Korea was nearly 25,000 metric tons, and the export value exceeded more than US$80 million in 2011 (Food, Agriculture, Forestry and Fisheries 2012). Although oysters have drawn much public attention due to their economic and ecological significance, extremely high variation in shell characters affected by environmental conditions often precludes correct identification of the species, making species-level taxonomy further complicated (Harry 1985, Tack et al. 1992, Wang et al. 2004). In the last few decades, molecular sequence data have been extensively utilized as powerful genetic markers for species identification and discrimination of some taxonomically complicated oyster species. These molecular approaches include direct comparison of specific target gene sequences between congeneric species [mitochondrial (mt) 16S rDNA sequences for Crassostrea spp. (Banks et al. 1993, O'Foighil et al. 1995)], combined methodological approaches of mt cox1 sequencing and polymerase chain reaction (PCR) restriction fragment length polymorphism of internal transcribed spacer 1 (ITS1) sequences (Camara et al. 2008, Hong et al. 2012), and development of a multiplex species-specific PCR assay using mt cox1 sequences (Wang & Guo 2008) and cox1 and 16S barcoding (Liu et al. 2011).

Ten species of oysters belonging to the family Ostreidae have been reported in Korea (Lee & Min 2002, Hong et al. 2012). Of these, Crassostrea gigas (Thunberg), Crassostrea nippona (Seki), Crassostrea ariakensis (Fujita & Wakiya), and Ostrea denselamellosa (Lischke) represent aquaculture species that are of commercial value, and these are the most abundantly found oyster species in the Korean sea coast (Lee et al. 2000). Very recently, a molecular survey using mtDNA cox1 and nuclear ITS1 confirmed the occurrence of the Kumamoto oyster species Crassostrea sikamea (Amemiya) in Korea, which is indistinguishable from the Pacific oyster Crassostrea gigas using shell morphology alone (Hong et al. 2012). There have also been some reports concerning the relationships among certain commercially important oyster species (C. gigas, C. nippona, C. ariakensis, and O. denselamellosa) using various molecular markers [Lee et al. 2000 (mt cox1 and 16S), Kim et al. 2009 (nuclear ITS1, ITS2)]. Despite noticeable development in molecular approaches for oyster taxonomy and species identification, development of a rapid and accurate identification system for these oyster species is still needed. In the present study, a DNA microarray chip was developed for reliable identification of certain oyster species including those that are of commercial value and/or ecological importance: C. ariakensis, C. gigas, C. sikamea, C. nippona, Crassostrea angulate (Lamarck), Ostrea circumpicta (Pilsbry), O. denselamellosa, and Saccostrea kegaki (Torigoe & Inaba).

MATERIALS AND METHODS

Sampling and Molecular Techniques

Oyster specimens representing seven target species were sampled from intertidal and/or subtidal zones of the Korean coast (Table 1). Species identification for the oyster samples (a total of 51 specimens) was made on the basis of shell morphology first and then confirmed by determining their mt cox1 sequences. The voucher specimens used in this study were deposited in the Marine Mollusk Bio-Resources Bank of Korea (http://www.mmrbk.org). Total genomic DNA was extracted using a tissue kit (Qiagen. Hilden, Germany) according to the manufacturer's instructions. In addition to the oyster species sampled from Korea, total genomic DNA from four individuals of the Portuguese oyster Crassostrea angulata were also included in subsequent molecular analyses. The target gene fragment of partial mtDNA cox1 was PCR amplified using a universal primer set (LC01490: 5'-GGTCAACAAATCA TAAAGATATTGG-3', HCO2198: 5'-TAAACTTC AGGGTGACCAAAAAATCA-3') (Folmer et al. 1994) or oyster-specific primers designed from sequence alignment of diverse oyster species in this study: Ost_CO1_F (forward: 5'-ATRTCHACWAAYCAYTTRGAYATTGG-3') and Ost_CO1_R (reverse: 5'-ATWCCRAAYCCHGGAAGAAT AAG-3'). PCR reactions were performed in a 50 [micro]l reaction volume consisting of 10 units of Taq polymerase (Roche, Basel, Switzerland), 2.5 mM deoxynucleotide triphosphate mixture, 2.5 mM Mg[Cl.sub.2], and 20 pmole of each primer with the following amplification conditions: one cycle of the initial denaturation step at 94[degrees]C for 2 min, followed by 35 cycles of denaturation at 94[degrees]C for 30 sec, primer annealing at 45[degrees]C for 30 sec, and elongation at 72[degrees]C for 1 min, with a final extension step at 72[degrees]C for 10 min. The PCR-amplified target gene fragment was purified using a QIAquick Gel Extraction Kit (Qiagen), following the manufacturer's protocol. The sequencing reaction was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA), and the reaction products were electrophoresed using an ABI 3730XL DNA analyzer.

Designing Species-Specific Probes

The 640-bp homologous mtDNA cox1 partial gene sequences were prepared from 12 oyster species (eight species were obtained from direct sequencing in the present study and the remaining four were retrieved from the GenBank Database), and then were multiple aligned using CLUSTAL X (Thompson et al. 1997). Sixteen species-specific oligonucleotide probes (two probes were selected for each of the eight species) ranging from 23 to 25 bp in size were designed with an in-house program at the optimum hybridization temperature for species identification of the eight target oyster species. Details of the species-specific probes used in this study are shown in Table 2.

Construction of DNA Microarray

The 5' end of all oligonucleotide probes was amine (NH2)-modified and tailed with poly T (10-mer) (Bioneer, Daejeon, Republic of Korea) at a concentration of 100 pmol/[micro]l Probe solution (5 [micro]l) was mixed with 5 [micro]l of spotting buffer solution containing 3x saline sodium citrate (SSC) and 1.5 M betaine at a ratio of 1:1. Each of the species-specific probes was transferred to 384-well plates and spotted onto aldehyde-coated slides under a temperature of 25[degrees]C and relative humidity of 70% for 12 h using a pin array system (Cartesian Technology, Irvine, CA). After spotting, the slides were washed in 0.1 % sodium dodecyl sulfate for 5 min, followed by two additional washes in distilled water and incubation in 250 ml of sodium borohydride solution (containing 0.625 g NaB[H.sub.4] 187.5 ml phosphate-buffered saline, and 62.5 ml ethanol) for 5 min. The slides were then washed twice with distilled water and centrifuged at 800 rpm for 5 min. The microarray layout for the species-specific oligo probes used is shown in Figure 1.

PCR Amplification, Microarray Hybridization, and Image Analysis

For labeling fluorescent dye to target genomic DNA, the oyster-specific primers (Ost_CO1_F and Ost_CO1_R) were labeled with cyanine-3 (Cy3) at the 5' end, and PCR amplification for the targeted mtDNA cox1 region was conducted using a 2720 Thermal Cycler (Applied Biosystems). The PCR reactions were performed in a 20 [micro]l reaction mixture containing 6 [micro]l of sterile double-distilled water, 10 [micro]l PreMix Taq (Ex Taq version 2.0; Takara Bio, Shiga, Japan), 1 [micro]l of each primer, and 1 [micro]l of the template DNA under the following cycling conditions: denaturation for 2 min at 94[degrees]C, 38 cycles of 1 min at 94[degrees]C, 1 min at 45[degrees]C, and 1 min 30 sec at 72[degrees]C, with a final extension of 10 min at 72[degrees]C. The Cy3-labeled PCR products were directly hybridized to the microarray in 90 [micro]l of the hybridization buffer without additional purification. The Cy3-labeled PCR product (10 [micro]l) was denatured and mixed with 90 [micro]l of the hybridization buffer (3x SSC and 0.3% sarcosyl) and 0.5 [micro]l of a position marker modified with Cy3. The hybridization was carried out at 58[degrees]C for 1 h in a hybridization oven (FINEPCR, Seoul, Republic of Korea). After incubation, the hybridized microarrays were washed for 5 min at room temperature with 1x SSC and 0.1% sarcosyl solution followed by 1x SSC and 0.1x SSC. Finally, the microarrays were dried by centrifugation at 800 rpm for 5 min. The intensity of the hybridization signal for the DNA microarrays was measured using a Genepix 4000B Microarray Scanner (Axon Instruments, Union City, CA) at a photomultiplier tube gain of 530 with 99% laser power. The fluorescence signal intensity of each probe was calculated using Genepix 4.1 software (Axon Instruments) after correcting for background noise by subtracting the local background median value from the median value of the probe.

RESULTS AND DISCUSSION

Sequence Divergence among Oyster Species

A total of 25 mt cox1 haplotypes were found in 51 samples of the eight species of the family Ostreidae. Uncorrected (p) pairwise genetic distances among the mt haplotypes discovered in this study are shown in Table 3. The maximum interspecific distance was observed between Crassostrea ariakensis and Ostrea circumpicta (denoted by CARI and OCI1/OCI2; 25.42%). The minimum interspecific distance (2.31%) was found between CAN1 (Crassostrea angulata) and CGI1 (Crassostrea gigas). This value was clearly higher (nearly 2.5 times) than the maximum value of intraspecific distance (0.92%) found between the haplotypes CAN1 and CAN4 in C. angulate, indicating the existence of a 'barcode gap' between inter- and intraspecific divergence in this target gene fragment. Therefore, this sequence information could be used for the development of a microarray-based identification system for these oyster species.

Hybridization Patterns of the Oyster Species Using DNA Microarrays

The multiple sequence alignment for the oyster cox1 gene fragments of 12 oyster species included eight species for which the target gene sequence was directly determined in this study. Sixteen species-specific probes were designed from regions that are conserved within the same species, but distinct among different species; thus, providing species specificity. All of the eight oyster species had a specific hybridization pattern and could be identified using two or three species-specific probes. The resulting DNA microarray images are presented in Figure 2. To confirm reliability of the selected probe, microarray assays were conducted three times, and the average values of signal intensity were calculated for each of the probes. Detailed information on the signal intensity of specific probes across the examined oyster species is shown in Figure 3. Throughout the present study, all of the 16 species-specific probes unambiguously distinguished eight target oyster species with no false-positive or false-negative signals.

DNA Microarray-Based Identification of Crassostrea Species

The development and application of effective molecular markers for oyster species has been considered as an essential task in multiple fields of oyster research because oyster shell characters are very sensitive to environmental factors of their habitats (Wang & Guo 2008). Thus, species identification based on shell characters alone may often lead to taxonomic errors including misidentification of the species, making oyster taxonomy further complicated (Harry 1985, Tack et al. 1992, Wang et al. 2004, Lam & Morton 2006). Taxonomic confusion can be more serious when an introduced (or cultured) species is similar to the native species with respect to shell morphology and vice versa. For instance, the identification of the Pacific oyster Crassostrea gigas and Portuguese oyster Crassostrea angulata have been the vigorous topic with much taxonomic confusion over the last several decades. Previously, they were treated as the same species based on a lack of clearly defined morphological distinction and low genetic differentiation detected from allozyme analyses (Mathers et al. 1974, Menzel 1974. Buroker et al. 1979). Nucleotide sequence analyses, however, have provided evidence suggesting that they are closely related but genetically distinct (O'Foighil et al. 1998, Huvet et al. 2000). Sequence differences of mtDNA cox1 between these two species ranged from 2.31% to 2.77%, although these values were the lowest among the interspecific pairwise sequence comparisons in this study. This result reconfirms previous assertions that they are genetically distinct, separate species. In addition, the Kumamoto oyster Crassostrea sikamea was first treated as a local form of C. gigas because these two species are morphologically indiscernible from each other in natural habitats and aquaculture farms (Hedgecock et al. 1993). Crassostrea sikamea and C. gigas, both having no clear morphological distinction, have been confirmed to be separate species from multiple lines of evidence including crossbreeding experiments (Banks et al. 1994), molecular data [mt 16S rDNA (Banks et al. 1993), allozymes (Banks et al. 1994), and mtDNA cox1 and nuclear ITS1 (Hong et al. 2012)]. Phylogenetic affinity among the aforementioned three Crassostrea species was also confirmed from phylogenetic analysis of mt cox1 sequences in earlier molecular analyses (Liu et al. 2011). Taken together, C. gigas, C. sikamea, and C. angulata are indistinguishable on morphological grounds but taxonomically separate species. Pairwise interspecific distances among five Korean Crassostrea species ranged from 2.31% to 15.56%, and the presence of a barcode gap (minimum value of interspecific distance was nearly 2.5 times higher than the maximum of intraspecific distance) enables developing a rapid, easy-to-use molecular identification system. The DNA microarray hybridization patterns developed in this study could distinguish five Crassostrea species, including C. gigas, C. sikamea, and C. angulata, with no false-positive or false-negative reactions. Unlike all other species that required only two species-specific probes, an additional C. angulata-specific probe (C.ang_4) was needed to distinguish it from C. gigas, along with two probes (C.gig_2 and C.gig_5), which are common to both C. angulata and C. gigas. Although there is considerable molecular evidence of genetic differentiation between northern and southern China populations of Crassostrea ariakensis [mtDNA 16S and cox1 (Wang et al. 2004); microsatellite marker (Xiao et al. 2010)], we were not able to use broad samples of Chinese populations in the analysis. Further analysis with broader population sampling over a wide geographic coverage would be necessary.

In conclusion, correct identification of oyster species, especially discrimination of closely related oyster species based on morphology alone, is a very challenging task because of due to enormous morphological variation particularly in shell morphs with ecophenotypic origins, often raising much taxonomic confusion. The DNA microarray-based identification system developed in this study offers a very effective and reliable tool for identification of eight oyster species, most of which are of commercial value in culture farms and/or of ecological significance in the macrobenthic community of offshore marine environments.

ACKNOWLEDGMENTS

We thank J.-S. Hong (Inha University) for providing Crassostrea sikamea genomic DNAs. This study was supported by a grant from the Marine Biotechnology Program (PJT200620, Genome Analysis of Marine Organisms and Development of Functional Applications and Marine Mollusk Resource Bank of Korea) funded by the Ministry of Oceans and Fisheries, Republic of Korea.

LITERATURE CITED

Banks, M. A., C. Waters, D. Hedgecock & R. C. Richmond. 1993. Discrimination between closely related Pacific oyster species (Crassostrea) via mitochondrial DNA sequences coding for large subunit rDNA. Mol. Mar. Biol. Biotechnol. 2:129-136.

Banks, M. A., D. J. McGoldrick, W. Boregeson & D. Hedgecock. 1994. Gametic incompatibility and genetic divergence of Pacific and Kumamoto oystes, Crassostreagigas and C. sikamea. Mar. Biol. 121:127-135.

Buroker, N. E., W. K. Hershberger & K. K. Chew. 1979. Population genetics of the family Ostreidae. I. Intraspecific studies of Crassostrea gigas and Saccostrea commercialis. Mar. Biol. 54:157-169.

Camara, M.. J. P. Davis, M. Sekino, D. Hedgecock. G. Li, C. J. Langdon & S. Evans. 2008. The Kumamoto oyster Crassostrea sikamea is neither rare nor threatened by hybridization in the northern Ariake Sea, Japan. J. Shellfish Res. 27:313-322.

Crosse, I., L. Rebordinos & E. Diaz. 2006. Species identification of Crassostrea and Ostrea by polymerase chain reaction amplification of the 5S rRNA gene. J. AO AC Int. 89:144-148.

Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit 1 from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3:294-299.

Harry, H. W. 1985. Synopsis of the supraspecific classification of living oysters (Bivalvia: Gryphaeidae and Ostreidae). Veliger 28:121-158.

Hedgecock, D., M. A. Banks & D. J. McGoldrick. 1993. The status of the Kumamoto oyster Crassostrea sikamea (Amemiya, 1928) in U.S. commercial brood stocks. J. Shellfish Res. 12:215-221.

Hong, J.-S., M. Sekino & S. Sato. 2012. Molecular species diagnosis confirmed the occurrence of Kumamoto oyster Crassostrea sikamea in Korean waters. Fish. Sci. 78:259-267.

Huvet, A., S. Lapegue, A. Magoulas & P. Boudry. 2000. Mitochondrial and nuclear DNA phylogeography of Crassostrea angulata, the Portuguese oyster endangered in Europe. Conserv. Genet. 1:251-262.

Kim, W.-J., J.-H. Lee, K.-K. Kim, Y.-O. Kim, B.-H. Nam, H. J. Kong & H. T. Jung. 2009. Genetic relationships of four Korean oysters based on RAPD and nuclear rDNA ITS sequence analyses. Korean J. Malacol. 25:41-49.

Lam, K. & B. Morton. 2006. Morphological and mitochondrial-DNA analysis of the Indo-West Pacific rock oysters (Ostreidae: Saccostrea species). J. Mollus. Stud. 72:235-245.

Lee, J. S. & D. K. Min. 2002. A catalogue of molluscan fauna in Korea. Korean J. Malacol. 18:93-217.

Lee, S. Y., D. W. Park, H. S. An & S. H. Kim. 2000. Phylogenetic relationship among four species of Korean oysters based on mitochondrial 16S rDNA and COI gene. Korean J. Syst. Zool. 16:203-211.

Liu, J., Q. Li, L. Kong, H. Yu & X. Zheng. 2011. Identifying the true oysters (Bivalvia: Ostreidae) with mitochondrial phylogeny and distance-based DNA barcoding. Mol. Ecol. Resour. 11:820-830.

Mathers, N. F., N. P. Wilkins & P. R. Walne. 1974. Phosphoglucose isomerase and esterase phenotypes in Crassostrea angulata and C. gigas. Biochem. Syst. Ecol. 2:93-96.

Menzel, R. W. 1974. Portuguese and Japanese oysters are the same species. J. Fish. Res. Board Can. 31:453-456.

Ministry for Food, Agriculture, Forestry, and Fisheries. 2012. 2011 Yearbook of fishery products export & import statistics. Sejong, Republic of Korea: MIFAFF. 544 pp.

O'Foighil, D., P. M. Gaffney & T. J. Hilbish. 1995. Differences in mitochondrial 16S ribosomal gene sequences allow discrimination among American [Crassostrea virginica (Gmelin)] and Asian [C. gigas (Thunberg), C. ariakensis Wakiya] oyster species. J. Exp. Mar. Biol. Ecol. 192:211-220.

O'Foighil, D., P. M. Gaffney, A. E. Wilbur & T. J. Hilbish. 1998. Mitochondrial cytochrome oxidase I gene sequences support an Asian origin for the Portuguese oyster Crassostrea angulata. Mar. Biol. 131:497-503.

Ruesink, J. L., H. S. Lenihan, A. C. Trimble. K. W. Heiman, F. Micheli, J. E. Byers & M. C. Kay. 2005. Introduction of non-native oysters: ecosystem effects and restoration implications. Annu. Rev. Ecol. Evol. Syst. 36:643-689.

Stunz, G. W., T. J. Minello & L. P. Rozas. 2010. Relative value of oyster reef as habitat for estuarine nekton in Galveston Bay. Texas. Mar. Ecol. Prog. Ser. 406:147-159.

Tack, J. F., E. Berghe & P. H. Polk. 1992. Ecomorphology of Crassostrea cucullata (Born, 1778) (Ostreidae) in a mangrove creek (Gazi, Kenya). Hydrobiologia 247:109-117.

Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin & D. G. Higgins. 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.

Wang, H., X. Guo, G. Zhang & F. Zhang. 2004. Classification of jinjiang oysters Crassostrea rivularis (Gould, 1861) from China, based on morphology and phylogenetic analysis. Aquaculture 242:137-155.

Wang, H. & X. Guo. 2008. Identification of Crassostrea ariakensis and related oysters by multiplex species-specific PCR. J. Shellfish Res. 27:481-487.

Xiao. J., J. F. Cordes, H. Wang. X. Guo & K. S. Reece. 2010. Population genetics of Crassostrea ariakensis in Asia inferred from microsatellite markers. Mar. Biol. 157:1767-1781.

JIYEON KIM, (1) DAEWUI JUNG, (1) WON SUN LEE (2) AND JOONG-KI PARK (1) *

(1) Division of EcoScience, Ewha Womans University, 52 Ewhayeodae-gil, Seodaemun-gu, Seoul 03760, Republic of Korea; (2) BioCore Co., Ltd., 31 Digital-ro, Guro-gu, Seoul 08511, Republic of Korea

* Corresponding author. E-mail: jkpark@ewha.ac.kr

DOI: 10.2983/035.034.0313

TABLE 1.
Geographic origins of the oyster samples used in this study.

                                       Number of              GenBank
                                      individuals            accession
Species         Geographic origin      examined    Genotype   numbers

Crassostrea     Fuqing city, Fujian        4       CAN1 (1)  KP067886
  angulata        province,
                China                              CAN2 (1)  KP067887
                                                   CAN3 (1)  KP067888
                                                   CAN4 (1)  KP067889
Crassostrea     Mangdeok-ri, Jinwol-       5       CAR1 (4)  KP067890
  ariakensis      myeon,
Crassostrea     Jeollanam-do                       CAR2 (1)  KP067891
  gigas         Jawol-myeon, Ongjin-       1       CGI1 (1)  KP067892
                  gun, Incheon
                Baega-ri, Deokjeok-        1       CGI1 (1)
                  myeon,
                Ongjin-gun. Incheon
                U-ido-ri, Docho-           3       CGI1 (3)
                  myeon,
                Sinan-gun,
                  Jeollanam-do
                Ayajin-ri. Toseong-        4       CGI1 (3)
                  myeon,
                Goseong-gun,                       CGI2 (1)  KP067893
                  Gangwon-do
                Pado-ri,                   1       CGI2 (1)
                  Sowon-myeon,
                Taean-gun,
                  Chungcheongnam-do
                Silmido Island,            2       CGI1 (2)
                  Muui-dong,
                Jung-gu, Incheon
                Sogeun-ri, Sowon-          2       CGI1 (1)
                  myeon,
                Taean-gun,                         CGI3 (1)  KP067894
                  Chungcheongnam-do
                Taean-eup.                 2       CGI1 (2)
                  Taean-gun,
                Chungcheongnam-do
                Punghwa-ri,                3       CGI1 (2)
                  Sanyang-eup.
                Tongyeong-si,                      CG14 (1)  KP067895
                  Gyeongsangnam-do
                Sangnae-ri.                5       CGI1 (4)
                  Haeryong-myeon.
                Suncheon-si,                       CGI5 (1)  KP067896
                  Jeollanam-do
Crassostrea     Nodae-ri,                  1       CNI1 (1)  KP067897
  nippona         Yokji-myeon,
                  Tongyeong-si,
                  Gyeongsangnam-do
                Geomun-ri,                 1       CNI1 (1)
                  Samsan-myeon,
                Yeosu-si,
                  Jeollanam-do
Crassostrea     Sangnae-ri,                7       CSI1 (3)  KP067898
  sikamea         Haeryong-myeon,
                Suncheon-si,                       CSI2 (1)  KP067899
                  Jeollanam-do                     CSI3 (1)  KP067900
                                                   CSI4 (1)  KP067901
                                                   CSI5 (1)  KP067902
Ostrea          Bomok-dong,                1       OCI1 (1)  KP067903
  circumpicta     Seogwipo-si,
                  Jeju-do
                Nodae-ri,                  2       OCI1 (1)
                  Yokji-myeon,
                Tongyeong-si,                      OCI2 (1)  KP067904
                  Gyeongsangnam-do
                Danghang-ri.               2       OCI3 (1)  KP067905
                  Nam-myeon.
                Namhae-gun,                        OCI4 (1)  KP067906
                  Gyeongsangnam-do
Ostrea          Nodae-ri,                  1       ODE1 (1)  KP067907
  densela-        Yokji-myeon,
  mellosa       Tongyeong-si.
                  Gyeongsangnam-do
                Jangbong-ri,               1       ODE2 (1)  KP067908
                  Bukdo-myeon.
                Ongjin-gun. Incheon
Saccostrea      Gangjeong-dong,            2       SKI1 (l)  KP067909
  kegaki          Seogwipo-si,
                Jeju-do                            SKE2 (1)  KP067910

TABLE 2.
Species-specific probe information for identification
of oyster species.

Probe             Sequence (5 -3)               Species

C.ari_4       GTTGGCGCTATTTCCATGGTCTATC   Crassostrea ariakensis
C.ari_5       GGTCTATCAAAGTCACATCATTTTT
Cgig_2        CAATTCTAAGCCTTCACCTTGCTGG   Crassostrea gigas,
C.gig_5       GCCTTCACCTTGCTGGTATTAGC       Crassostrea angulata
C.ang_4       ATGTCTAACATCGTAGAAAACGG     C. angulata
C.nip_4       TTAAGCCTACATTTGGCTGGTATTA   Crassostrea nippona
C.nip_5       GCTCTGTTTCCTTGATCAATTAAAG
C.sik_4       CAATTTTAAGTTTACACCTAGCTGG   Crassostrea sikamea
C.sik_5       TTATTGGCGCTGTTTCCCTGATCTA
0.cir_3       CCTCCACTATCAACTTTTTCATATC   Ostrea circumpicta
0.cir_4       CGATCAGTGGACGGTCATTTACTGG
0.den_3       CAAATATACGGTCAGTAGACGGCCA   Ostrea denselamellosa
0.den_4       CGGCCATTTATTAGCATTGTTTCCC
0.den_5       GACTTCCTTTTTATTGTTAACTACG
S.keg_1_AS    GTCAGGCACTTCTAGTATCAACGGG   Saccostrea kegaki
S.keg_5       CCATCTGTTAAGGTTGTTCCCATGG

TABLE 3.
Uncorrected (p) pairwise genetic distances among the mt
haplotypes discovered in this study.

               1       2       3       4       5       6       7

1     CAN1     --
2     CAN2   0.77      --
3     CAN3   0.77    0.31      --
4     CAN4   0.92    0.46    0.46      --
5     CAR1  14.48   14.48   14.48   14.64     --
6     CAR2  14.33   14.33   14.33   14.48   0.15      --
7     CGI1   2.31    2.47    2.47    2.62   14.18   14.02     --
8     CGI2   2.47    2.62    2.62    2.77   14.02   13.87    0.15
9     CGI3   2.47    2.62    2.62    2.77   14.33   14.18    0.15
10    CGI4   2.47    2.62    2.62    2.77   14.02   13.87    0.15
11    CGI5   2.47    2.62    2.62    2.77   14.02   13.87    0.15
12    CNI1  14.95   15.41   15.10   15.56   14.02   13.87   14.79
13    CSI1   9.09    8.94    8.63    8.78   14.18   14.02   10.02
14    CSI2   8.94    8.78    8.47    8.63   14.18   14.02    9.86
15    CSI3   9.24    9.09    8.78    8.94   14.33   14.18   10.17
16    CS14   8.94    8.78    8.78    8.63   14.02   13.87    9.86
17    CSI5   8.78    8.63    8.32    8.47   13.87   13.71    9.71
IS    OCI1  24.04   24.19   23.88   24.19   25.42   25.27   24.81
19    OCI2  24.04   24.19   23.88   24.19   25.42   25.27   24.81
20    OCI3  24.19   24.35   24.04   24.35   25.27   25.12   24.65
21    OCI4  23.88   24.04   23.73   24.04   25.27   25.12   24.65
22    ODE1  22.34   22.19   22.19   22.50   23.27   23.11   22.50
23    ODE2  22.50   22.34   22.34   22.65   23.42   23.27   22.65
24    SKE1  24.19   24.04   24.04   24.50   23.42   23.57   24.19
25    SKE2  24.04   23.88   23.88   24.35   23.57   23.73   24.04

               8       9      10      11      12      13      14

1     CAN1
2     CAN2
3     CAN3
4     CAN4
5     CAR1
6     CAR2
7     CGI1
8     CGI2     --
9     CGI3    0.31      --
10    CGI4    0.31    0.31      --
11    CGI5    0.31    0.31    0.31      --
12    CNI1   14.79   14.95   14.64   14.95     --
13    CSI1    9.86   10.17    9.86   10.17   14.64     --
14    CSI2    9.71   10.02    9.71   10.02   14.02    0.77      --
15    CSI3   10.02   10.32   10.02   10.32   14.48    0.15    0.92
16    CS14    9.71   10.02    9.71   10.02   14.79    0.46    0.92
17    CSI5    9.55    9.86    9.55    9.86   14.33    0.31    1.08
IS    OCI1   24.81   24.96   24.96   24.96   22.50   24.19   23.88
19    OCI2   24.81   24.96   24.96   24.96   22.50   24.19   23.88
20    OCI3   24.65   24.81   24.81   24.81   22.65   24.35   24.04
21    OCI4   24.65   24.81   24.81   24.81   22.65   24.04   23.73
22    ODE1   22.65   22.65   22.34   22.34   24.19   21.88   22.19
23    ODE2   22.80   22.80   22.50   22.50   24.04   22.03   22.34
24    SKE1   24.04   24.35   24.04   24.35   24.04   24.65   24.81
25    SKE2   23.88   24.19   23.88   24.19   24.19   24.50   24.65

              15      16      17      18      19      20      21

1     CAN1
2     CAN2
3     CAN3
4     CAN4
5     CAR1
6     CAR2
7     CGI1
8     CGI2
9     CGI3
10    CGI4
11    CGI5
12    CNI1
13    CSI1
14    CSI2
15    CSI3     --
16    CS14    0.62      --
17    CSI5    0.46    0.77      --
IS    OCI1   24.04   24.04   23.88     --
19    OCI2   24.04   24.04   23.88    0.15      --
20    OCI3   24.19   24.19   24.04    0.15    0.31      --
21    OCI4   24.19   23.88   23.73    0.15    0.31    0.31      --
22    ODE1   22.03   22.19   21.73   16.80   16.80   16.64   16.64
23    ODE2   22.19   22.34   21.88   16.95   16.95   16.80   16.80
24    SKE1   24.50   25.12   24.50   22.65   22.80   22.80   22.80
25    SKE2   24.35   24.96   24.35   22.50   22.65   22.65   22.65

              22      23      24      25

1     CAN1
2     CAN2
3     CAN3
4     CAN4
5     CAR1
6     CAR2
7     CGI1
8     CGI2
9     CGI3
10    CGI4
11    CGI5
12    CNI1
13    CSI1
14    CSI2
15    CSI3
16    CS14
17    CSI5
IS    OCI1
19    OCI2
20    OCI3
21    OCI4
22    ODE1     --
23    ODE2    0.15      --
24    SKE1   21.26   21.42     --
25    SKE2   21.11   21.26   0.15      --

CAN, Crassostrea angulata; CAR, Crassostrea ariakensis; CGI,
Crassostrea gigas; CNI, Crassostrea nippona; CSI,
Crassostrea sikamea; OCI, Ostrea circumpicta; ODE, Ostrea
denselamellosa; SKE, Saccostrea kegaki.
COPYRIGHT 2015 National Shellfisheries Association, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Kim, Jiyeon; Jung, Daewui; Lee, Won Sun; Park, Joong-ki
Publication:Journal of Shellfish Research
Article Type:Report
Geographic Code:9SOUT
Date:Dec 1, 2015
Words:4711
Previous Article:Toward selective breeding of a hermaphroditic oyster Ostrea chilensis: roles of nutrition and temperature in improving fecundity and synchrony of...
Next Article:Gender differences and short-term exposure to mechanical, thermic, and mechanical-thermic stress conditions on hemocyte functional characteristics...
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters