Printer Friendly

Development and Comparison of In-house Line Probe Assay (LiPA) and SVBR Green Real-time PCR Regarding the Detection of Periodontal Pathogens.

Introduction

As a polymicrobial infection, periodontal disease disturbs tissues supporting and investing the teeth and alveolar bone, and can eventually bring about dental loss. The chronic periodontal diseases are common in the middle-aged and the elderly, while the aggressive periodontal diseases are rampant particularly among youths (30-years-old) (1-3). The prevalence of periodontal diseases in America and developing countries has been estimated about 35 and 50-55%, respectively (4).

During the formation of periodontal disease, the normal oral microbiome shifts gradually from facultative gram-positive bacteria into anaerobic gram-negative ones (1,5,6). Aggregatibacter actinomycetemcomitans (Aa) (formerly Actinobacillus actinomycetemcomitans) and Porphyromonas gingivalis (Pg) are the major pathogenic bacteria species in the etiology of periodontal diseases, whereas the normal oral flora related to the disease are Prevotella intermedia (Pi), Tannerella forsythia (Tf) and Treponema denticola (Td) (7-9).

It is necessary to evaluate microbial composition In human periodontal pockets for the diagnosis and treatment of periodontal diseases (10). Currently, there are various methods to detect the odontopathogen bacteria In saliva or plaque (11). In a former study, conventional PCR and Real-time PCR were developed and compared for detection of Aa and Tf The SYBR green Real-time PCR was tenfold more sensitive than the conventional PCR (7). Multiplex PCR and Real-time PCR are powerful and efficient tools in detecting concurrently bacterial strains In periodontal samples (12,13). However, multiplex PCR has several drawbacks, including complexity, low amplification efficiency, and poor universality (14). Likewise, the use of Real-time PCR was also complicated with expensive equipment and reagents (15). As a diagnostic molecular method, Line Probe Assay (LiPA) is based on a DNA strip that allows for a rapid and simultaneous identification of the target DNA sequences. In-house and commercially available line probe assays are currently being used to detect the members of the Mycobacterium tuberculosis Complex (MTC) and their drug-resistant strains (16-19), and also for genotyping Noroviruses (20), human papillomavirus (HPV) in cervical scrapes (21) and Hepatitis C virus (22-27). The aim of the present study was to design and apply the Line Probe Assay for a rapid screening of several prominent oral pathogens including Aa, Pi, Tf, Pg and Td bacteria.

Materials and Methods

Strains and DNA extraction

The genome of wild-type bacteria of Aa (ATCC 700 685D-5), Tf (ATCC 43037D-5), Td (ATCC 35405D-5), Pg (ATCC 33277D-5) and Pi (ATCC 25611D-5) was used as positive control. The bacterial species including Staphylococcus aureus (ATCC 25923), Bacillus subtilis (ATCC 6051), Shigella sonnei (ATCC 92 90), Escherichia coli (E. coli) (ATCC 25922), Enterococcus faecalis (ATCC 29212), Pseudomonas aeruginosa (AT CC 27853), Klebsiella pneumoniae (ATCC 7881), Yersinia enterocolitica (PTCC 1480), Yersinia pseudotuberculosis (PTCC 1244), Proteus vulgaris (PT CC 10 79) and Citrobacter freundii (PTCC 1499) were used as negative control. The bacterial genomes were extracted using EZ-10 spin Column Genomic DNA Kit (DNP[TM] kit (Bio Basic Inc., Canada)); the purity of the genomes was subsequently evaluated. The extracted genomes were quantified using a Picodrop Spectrophotometer (Picodrop, UK) according to the manufacturer's instructions.

Primers and probes

NCBI deposited sequences of J 6S rRNA gene of the target bacteria were downloaded and aligned by CLC Main Workbench software version 7.5 (accession numbers are not shown). A pair of broad range universal bacterial primers was selected to amplify a 466-bp region: Forward primer 5'-TCCTACGGGAGGCAGCA GT-3'and reverse primer 5'-GGACTACCAGGGTAT CTAATCCTGTT-3' (28).

The 466 bp region of the 16S rRNA alignment was designated to design specific probes for each of the five target bacteria through the use of CLC Main Workbench software version 7.5 (Table 1). Confirming the specificity of the designed probes, the sequences were compared against the NCBI nucleotide databases. The biotinylated and non-biotinylated forms of the universal primers and the probes containing 5' poly (T) sequences were commercially synthesized.

PCR and cloning

PCR experiments were conducted in a volume of 25 [MICRO]L, consisting of 1X PCR buffer (Fermentas, GmbH, Germany), 2 mM Mg[Cl.sub.2], 0.2 mM dNTPs, 0.5 [micro]M of the non-biotinylated universal bacterial primers, 50 ng of genomic DNA (each of the five target bacteria) and 1 unit Taq DNA polymerase (Fermentas, GmbH, Germany). Amplification was carried out for 35 cycles in the PCR program as follows: Initial denaturation at 94[degrees]C for 4 min, denaturation at 94[degrees]C for 30 s, annealing temperature at 54[degrees]C for 30 s, extension time at 72 [degrees]C for 1 min and final extension for 10 min. The 466 bp PCR products of 16S rRNA genes (each of the five bacteria) were cloned in plasmid vector by use of InsTA clone PCR cloning kit (Fermentas, Lithuania) according to the manufacturer's instruction. The recombinant plasmids were transformed into Ca[Cl.sub.2] competent E. coli Top10 F' strain. The confirmed recombinant plasmids containing 16S rDNA insert of Aa, Tf, Td, Pg and Pi were named pTZ-agg, pTZ-tan, pTZ-tre, pTZ-p or and pTZ-pre, respectively. The plasmids were subjected to PCR same as above except for the fact that biotinylated primers were used. The biotinylated PCR products were stored at -20 [degrees]C until use in LiPA experiment.

Preparation of the LiPA strips

The probes (Table 1), the biotinylated universal primers (Conjugate control) and the PCR products from non-biotinylated universal primers (Amplification control), were prepared with concentrations of 2.5 pmol/[micro]d; they were then spotted onto SensiBlot[TM] Plus Nylon membranes (Fermentas GmbFI, Germany) employing a 96-well Dot-Slot Blotter (Cleaver, UK) according to the manufacturer protocol. Fixation of the spotted membranes was done through baking at 80 [degrees]C for 30 min. Furthermore, the spots were UV cross-linked with 100-150 [micro]J/[cm.sup.2] on the nylon membranes. The prepared membranes were sliced into 60x7 mm strips and stored at -20[degrees]C until use.

Prehybridization, hybridizations, and color development

The prepared stripes were prehybridized in 2X SSC buffer as blocking solution [1X SSC: 0.15 MNaCl (Hi-Media, India) and 0.015 M Sodium Citrate (Appli-Chem GmbH, Germany)] and 0.1% SDS (Cinnagen, Iran) at 50[degrees]C for 30 min. Each prehybridized strip was transferred to a 14 ml polystyrene conical bottom test tube containing 2 ml hybridization buffer (2X SSC 0.1% SDS). Adding 10 [micro]l of the single-stranded biotinylated PCR products, hybridization was accomplished in an orbital shaker at 50[degrees]C and 80 rpm for 1-2 hr. Washing the strips twice with 2X SSC and 0.1% SDS for 5 min at 22[degrees]C was followed by washing twice with 1X SSC and 0.1% SDS for 15 min at A2[degrees]C. The hybridized strips were developed via Biotin Chromogenic Detection Kit (Fermentas GmbH, Germany) according to the manufacturer instructions. All steps were performed at 22[degrees]C with moderate shaking on an orbital platform shaker. Primarily, the strips were treated with 2 ml blocking/washing buffer for 5 min and then blocked in 2 ml of the blocking solution for 30 min. Next, the strips were immersed in 2 ml of diluted Streptavidin-AP conjugate for 30 mm. After washing with blocking/washing buffer and incubating with detection buffer for 10 min, enzymatic reaction and color development was performed. The strips were incubated in 2 ml of fresh substrate solution [5-Bromo, 4-Choloro, 3-Indolylphosphate (BCIP) and Nitro-blue-tetrazolium (NBT)] in a dark place. The blue-purple precipitate was produced after 20-30 min of incubation. After discarding the substrate solution, the strips were rinsed with Milli-Q water to stop the enzymatic reaction. Lastly, the strips were interpreted through inspecting the blue-purple bands corresponding to controls and bacterial species.

Analytical sensitivity and specificity

A 10 ng/[micro]l concentration (2.76x[10.sup.9] copies) of the positive control plasmids (pTZ-agg, pTZ-tan, pTZ-tre, pTZ-por and pTZ-pre) was used to prepare a 10-fold serial dilution of each. The dilutions were subjected to PCR amplification using the biotinylated primers. The specific PCR products were detected through the use of the designed in-house LiPA as previously mentioned. The last dilutions demonstrating relevant blue-purple bands on the strips were specified as the lower detection limit of the assay. In order to determine the specificity, four different mixtures of the positive control were prepared as shown in table 2. After that, each mixture was subjected to the designed LiPA according to the above description. For further investigation of the probability of non-target genes detection in other organisms, the genome of negative control bacteria (Klebsiella pneumonia ATCC 7881, E. coli ATCC 25922, Bacillus subtilis ATCC 6051, Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, Streptococcus penumoniea ATCC 700669 and Neisseria meningitides ATCC13060) was studied by the designed assay.

Artificially contaminated blood samples

Artificially infected blood samples were used in order to compare the in-house Line Probe Assay and SYBR Green Real-Time PCR concerning the detection of periodontal pathogens. For this purpose, a normal human EDTA-treated whole blood sample was utilized. The sample was distributed into thirty micro tubes (200 [micro]l/tube) which were subsequently spiked with the genomic DNA of the five periodontal pathogens as follows: The tubes were inoculated with 1 [micro]g/200 [micro]l final concentration of the genomic DNA of each pathogen. Moreover, ten blood samples (not spiked with DNA) were used as negative control. The artificially contaminated samples and the negative control samples were kept at 4 [degrees]C for 96 hr. Then, forty samples were subjected to DNA extraction using EZ-10 spin Column Genomic DNA Kit (DNP[TM] kit (Bio Basic Inc., Canada). The DNA samples were examined by the in-house Line Probe Assay as mentioned above. Also, SYBR Green Real-time PCR was employed to detect the pathogens in the samples. ABI 7500 Fast Real-Time Amplification system (ABI, USA) and SY-BR[R] Premix Ex Taq[TM] II (TAKARA, Japan) were utilized in all experiments. Each extracted DNA and the negative control were subjected to the SYBR Green Real Time PCR to detect each of the five periodontal pathogens, separately. Additionally, the purified genomic DNAs were used as positive control. The reaction tubes were prepared in a final volume of 20 [micro]l, containing 2 [micro]l of extracted genomic DNA as a template, 2 [micro]l of 2X master mix and 0.4 M of each of the forward and reverse primers (Table 3). The thermal cycling program was a 10 min activation of Taq polymerase at 95 [degrees]C by 40 cycles of PCR (denaturation at 95[degrees]C for 15 s, annealing and extension at 60[degrees]C for 1 min). Finally, to verity the correct product by its specific melting temperature (Tm), a melting curve analysis of the amplified DNA was performed at 54 to 95[degrees]C and a temperature increase rate of 0.2[degrees]C/sec was considered in this test.

Statistical analysis

The online Clinical Calculator 1 was used to calculate the clinical sensifivity and specificity of the LiPA and the SYBR Green Real- time PCR (http://vassarstats.net/clinl.html). Clinical sensitivities of the assays were compared by McNemar's test using an online calculator (https://graphpad.com/quickcalcs/mcNemarl/).

Results

LiPA setting up

A 466 bp region from the 16s rRNA gene of the five target bacteria was amplified and visualized on gel agarose. The PCR product lengths were the same regardless of the bacterial species (Figure 1). In preparing the positive control plasmids, the 466 bp PCR products were separately cloned in pTZ57RIT plasmid. The PCR and sequencing of the inserts confirmed the recombinant plasmids (pTZ-agg, pTZ-tan, pTZ-tre, pTZ-por and pTZ-pre). In the setup of the in-house LiPA, each target gene was minutely detected. In all strips, one universal probe was used to detect bacterial 16S rRNA gene (Ampli control) and a conjugate control (Conj control) to confirm biotin and streptavidin reaction. In all runs, bands corresponding to Ampli control and Conj control showed blue-purple precipitate; however, in negative control cases (without DNA) only the band of Conj control was visualized. In addition, in each experiment, only the blue-purple precipitate related to the applied specific biotinylated product was produced (Figure 2).

Analytical sensitivity and specificity results

Sensitivity results showed that the last dilution of the positive control plasmids (pTZ-agg, pTZ-tan, pTZ-tre, pTZ-por and pTZ-pre), generating a blue-purple precipitate on the strips, was a 10 fg dilution. Accordingly, the LOD of the test was determined 10 fg or 2760 copies of each of the five target genes. To determine the specificity, the in-house LiPA was performed on four different mixtures of the positive control plasmids. In each experiment, only signals corresponding to the specific biotinylated products were produced (Figure 3). Using the negative control bacterial genomes in the in-house LiPA, only bands pertaining to Ampli control and Conj control indicated the blue-purple precipitate on the strip.

Results of artificially contaminated blood samples

The results of performing the LiPA on the DNA extracted from the spiked and non-spiked blood samples were inspected based on the relevant bands on the strips. In SYBR Green Real-time-PCR, a sample is considered positive when the amplification plot crosses the threshold value. The amplification plot of Aa contaminated samples exceeded the threshold baseline at a Ct value of 10-18, whereas the amplification plot of the negative control samples did not exceed the threshold baseline. Figures 4A, C, E, G, I show the Ct values of amplification plot related to the five periodontal pathogens. To ensure that the amplification plot obtained for the artificially contaminated sample was precise enough, Tm analyses of the assays were performed (Figures 4B, D, F, H, J). Table 4 illustrates the diagnostic sensitivity and specificity of the in-house LiPA and McNemar p-value when the SYBR Green Real-time PCR was used as gold standard. All the negative samples in the periodontal pathogen DNA (non-spiked samples) of the LiPA were also negative in SYBR Green Real-time PCR assay. Comparison of the results indicated no significant difference between the two methods (p-value=0.4795 for Aa, Pi and Td and 1 for Pg and Tf).

Discussion

In this study, 16S rRNA-based in-house LiPA was designed and applied so as to detect five major putative periodontal pathogens. 16S rRNA is an important housekeeping gene that shares a high degree of similarity in different bacterial species. Using CLC Main Workbench software, the unique regions of the gene in each target bacterium were found and used as species-specific probe. Culture-based methods are technique-sensitive, time-consuming and expensive. In addition, they require a great amount of expertise and are difficult to perform, rendering such methods inappropriate for routine bacterial screening in the periodontal identification (29). Nowadays, the PCR method has become a powerful tool for the identification of various organisms, particularly those showing problems with regard to phenotypic methods.

Bacterial 16S rRNA genes contain the interspersion of more- and less-conserved sequences; hence their application as a diagnostic gene in molecular detection is reasonable. The more distinct regions can be used to discriminate the bacterial taxa, while the conserved regions present universal sequences in annealing the PCR primers (30). Several studies have demonstrated the usefulness of 16S rRNA-based PCR detection of periodontal bacteria in subgingival samples. 16S rRNA PCR methods are more sensitive than culture-based approaches and less cross-reactive compared with DNA probe detection (7,11,31,32).

In this study, a pair of broad range universal bacterial primers was used (28) to amplify the 16s rRNA gene of five target bacteria. The sequence alignment was used to identify a specific region of each 16S rRNA gene, hence a candidate for specific probe. The preparation, hybridization, and development of the strips were subsequently performed.

In a previous study, to genotype Hepatitis C Virus (HCV) types and subtypes, the suitability of the workflow was shown, particularly the use of Biotin Chromogenic detection kit for the development of the strips (33). This is the first time that some of the most important periodontal pathogens are evaluated by an in-house line probe assay. With the in-house LiPA, the extracted DNA of artificially contaminated blood samples was evaluated and the results were compared with the SYBR Green Real-time PCR. It was concluded that there is concordance between results of the LiPA and that of SYBR Green Real-time PCR as far as detecting the five periodontal pathogens is concerned. Aberle et al compared LiPA detecting drug-resistant Hepatitis B Virus (HBV) strains with sequence analysis (34). They obtained results concordant with sequence analysis with 48 of 56 serum samples from HBV-infected patients undergoing lamivudine therapy. Several studies have proposed LiPA as a screening test with low turnaround time, especially in low-resource regions (35,36). For example, Albert et al showed its usefulness for rapid screening of MDR-TB in Uganda (35). Melchers et al applied LiPA to detect and genotype 16 different Human Papillomaviruses (HPV) types simultaneously, where it was shown that the method was sensitive, specific, simple, and fast. Also, they proposed HPV-LiPA to mass screen the cervical samples for routine analyses and patient management (37).

Conclusion

To screen periodontal pathogens, a simple, inexpensive and accurate method is required, so a reliable, sensitive, specific and economic detection assay was developed and applied in this study. LiPA provides the possibility of evaluating more species without the need for gel agarose electrophoresis step and can, therefore, be a useful candidate for research and diagnostic purposes of oral microbiology.

Acknowledgement

This study was conducted with the contributions of the members of the Research Council of the Islamic Azad University (Qom branch). The staff of microbiology laboratory is also sincerely appreciated.

References

(1.) Hyvarinen K, Laitinen S, Paju S, Hakala A, Suominen-Taipale L, Skumik M, et al. Detection and quantification of five major periodontal pathogens by single copy gene-based real-time PCR. Innate Immun 2009;I5(4): 195-204.

(2.) Sheiham A, Netuveli GS. Periodontal diseases in Europe. Periodontol 2000 2002;29(1):I04-121.

(3.) Brown LJ, Loe H. Prevalence, extent, severity and progression of periodontal disease. Periodontol 2000 I993;2: 57-71.

(4.) Chala S, Abouqal R, Abdallaoui F. Prevalence of apical periodontitis and factors associated with the periradicular status. Acta odontol Scand 2011;69(6):355-359.

(5.) Slots J. The predominant cultivable microflora of advanced periodontitis. Scand J Dent Res I977;85(2):1 14-121.

(6.) Haffajee AD, Cugini MA, Tanner A, Pollack RP, Smith C, Kent RL Jr, et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. J Clin Periodontol 1998;25(5):346-353.

(7.) Soleimani M, Zolfaghari MR, Morovvati A. Development and comparison of conventional PCR and SYBR green real time PCR for detection of aggregatibacter actinomycetemcomitans and Tannerella for sythensis. Jundishapur J Microbiol 2013;6(8):e6757.

(8.) Slots J, Ting M. Actinobacillus actinomycetemcomitans and porphyromonas gingivalis in human periodontal disease: occurrence and treatment. Periodontol 2000 1999; 20(1):82-121.

(9.) Kozarov EV, Corn BR, Shelburne CE, Dunn WA Jr, Progulske-Fox A. Human atherosclerotic plaque contains viable invasive actinobacillus actinomycetemcomitans and porphyromonas gingivalis. Arterioscler Thromb Vasc Biol 2005;25(3):e17-e8.

(10.) Suzuki N, Yoshida A, Saito T, Kawada M, Nakano Y. Quantitative microbiological study of subgingival plaque by real-time PCR shows correlation between levels of tannerella forsythensis and fusobacterium spp. J Clin Microbiol 2004;42(5):2255-2257.

(11.) Ashimoto A, Chen C, Bakker I, Slots J. Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol Immunol 1996; 11 (4):266-273.

(12.) Maeda H, Fujimoto C, Haruki Y, Maeda T, Kokeguchi S, Petelin M, et al. Quantitative real-time PCR using Taq-Man and SYBR Green for actinobacillus actinomycetemcomitans, porphyromonas gingivalis, prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol Med Microbiol 2003;39(1):81-86.

(13.) Coffey J, Choudhry M, Shlossman M, Makin IRS, Singh VK. Multiplex real-time PCR detection and relative quantification of periodontal pathogens. Clin Exp Dent Res 2016;2(3): 185-192.

(14.) Wen D, Zhang C. Universal multiplex PCR: a novel method of simultaneous amplification of multiple DNA fragments. Plant Methods 2012;8(1):32.

(15.) Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. Biotechniques 2005;39(1):75-85.

(16.) Ling DI, Zvverling AA, Pat M. GenoType MTBDR assays for the diagnosis of multidrug-resistant tuberculosis: a meta-analysis. Eur Re.spir.1 2008:32(5):1 165-1174.

(17.) Abe C, Ogata H, Kavvata K, Hiraga T, Takashima T, Suetake T. [Detection of rifampin-resistant Mycobacterium tuberculosis by line probe assay (LiPA)]. Kekkaku 2000;75(10):575-581. Japanese.

(18.) Naidoo P, du Toil E, Dunbar R, Lombard C, Caldwell J, Detjen A, et al. A comparison of multidrug-resistant tuberculosis treatment commencement times in MDRTB-Plus line probe assay and Xpert(R) MTB/RIF-based algorithms in a routine operational setting in Cape Town. PLoS One 2014;9(7):e103328.

(19.) Ritter C, Lucke K, Sirgel FA, Warren RW, van Helden PD, Bottger EC, et al. Evaluation of the AID TB resistance line probe assay for rapid detection of genetic alterations associated with drug resistance in Mycobacterium tuberculosis strains. J Clin Microbiol 2014;52 (3):940-946.

(20.) Menton JF, Kearney K, Morgan JG. Development of a real-time RT-PCR and reverse line probe hybridisation assay for the routine detection and genotyping of noroviruses in Ireland. Virol J 2007;4:86.

(21.) Wang J, Bakkers J, Melchers WJ. [Genotyping of human papillomavirus genotyes in cervical scrapes by line probe assay]. Zhonghua Shi Van He Lin Chuang Bing Du Xue Za zZhi 1999;13(1):9-12. Chinese.

(22.) Noppompanth S, Sablon E, De Nys K, Lien TX, Brouwer J, Van Brussel M, et al. Genotyping hepatitis C viruses from Southeast Asia by a novel line probe assay tliat simultaneously detects core and 5' untranslated regions. J Clin Microbiol 2006;44(11):3969-3974.

(23.) Andonov A, Chaudhary RK. Subtyping of hepatitis C virus isolates by a line probe assay using hybridization. J Clin Microbiol 1995;33(1):254-256.

(24.) Avo AP, Agua-Doce 1, Andrade A, Padua E. Hepatitis C virus subtyping based on sequencing of the C/El and NS5B genomic regions in comparison to a commercially available line probe assay. J Med Virol 20I3;85(5):815-822.

(25.) Cai Q, Zhao Z, Liu Y, Shao X, Gao Z. Comparison of three different HCV genotyping methods: core, NS5B sequence analysis and line probe assay. Int J Mol Med 2013;31(2):347-352.

(26.) Comanor L, Elkin C, Leung K, Krajden M, Kronquist K, Nicolas K, et al. Successful HCV genotyping of previously failed and low viral load specimens using an HCV RNA qualitative assay based on transcription-mediated amplification in conjunction with the line probe assay. J Clin Virol 2003;28(1): 14-26.

(27.) Liu CH, Liang CC, Liu CJ, Lin CL, Su TH, Yang HC, et al. Comparison of abbott realTime HCV genotype 11 with versant line probe assay 2.0 for Hepatitis C virus genotyping. J Clin Microbiol 2015;53(5): 1754-1757.

(28.) Nadkarni MA, Martin FE, Jacques NA, Hunter N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002;148(Pt l):257-266.

(29.) Baehni P, Guggenheim B. Potential of diagnostic microbiology for treatment and prognosis of dental caries and periodontal diseases. Crit Rev Oral Biol Med 1996;7 (3):259-277.

(30.) Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol 2008;74(8):2461-2470.

(31.) Geevarghese A, Baskaradoss JK, Al Dosari A. Application of 16s RRNA in identifying oral microflora-a review of literature. World Appl Sci J 2012;17(10):1303-1307.

(32.) Hutter G, Schlagenhauf U, Valenza G, Horn M, Burgemeister S, Claus H, et al. Molecular analysis of bacteria in periodontitis: evaluation of clone libraries, novel phylotypes and putative pathogens. Microbiology 2003; 149 (Pt l):67-75.

(33.) Majidzadeh-A K, Morovvati A, Soleimani M, Langeroudi AG, Merat S, Jabbari H. Development and application of an In-house line probe assay for Hepatitis C virus genotyping. Hepat Mon 2013;13(5):e6767.

(34.) Aberle SW, Kletzmayr J, Watschinger B, Schmied B, Vetter N, Puchhammer-Stockl E. Comparison of sequence analysis and the INNO-LiPA HBV DR line probe assay for detection of lamivudine-resistant hepatitis B virus strains in patients under various clinical conditions. J Clin Microbiol 2001;39(5): 1972-1974.

(35.) Albert H, Bwanga F, Mukkada S, Nyesiga B, Ademun JP, Lukyamuzi G, et al. Rapid screening of MDR-TB using molecular line probe assay is feasible in Uganda. BMC Infect Dis2010;10:41.

(36.) Barnard M, Gey van Pittius NC, van Helden PD, Bosnian M, Coetzee G, Warren RM. The diagnostic performance of the genoType MTBDRpIus version 2 line probe assay is equivalent to that of the Xpert MTB/RIF assay. J Clin Microbiol 2012;50(11):3712-3716.

(37.) Melchers WJ, Bakkers JM, Wang J, de Wilde PC, Boonstra H, Quint WG, et al. Short fragment polymerase chain reaction reverse hybridization line probe assay to detect and genotype a broad spectrum of human papillomavirus types. Clinical evaluation and follow-up. Am J Pathol 1999;155(5): 1473-1478.

Mohammad Soleimani (*) and Mohammad Reza Zolfaghari

Department of Microbiology, Qom Branch, Islamic Azac J University, Qom, Iran

(*) Corresponding author: Mohammad Soleimani, Ph.D., Department of Microbiology, Oom Branch, Islamic Azad University, Oom, Iran

Tel: +98 251 7780001

Fax: +98 2S17780001

E-mail: soleimanidor@yahoo.com

Received: 26 Aug 2017

Accepted: 24 Dec 2017
Table 1. The specific probes for each of the five target bacteria used
in the study

Bacterium                 Probe name  Position  Probe sequence (5'-3')

A. actinomycetemcomitans  Agg-p       617-632   CTTTAGGGAGGGGTAG
P. gingivalis             Por-p       736-751   TTGCCATACTGCGACT
P. intermedia             Pre-p       662-667   GTGCACGCAACGTATG
T. forsythia              Tan-p       655-670   TATAGATGAAGTAGGC
T. denticola              Tre-p       674-689   ATCACGGAGGGGAAAC

Bacterium                 Length (bp)  Reference

A. actinomycetemcomitans  16           This study
P. gingivalis             16           This study
P. intermedia             16           This study
T. forsythia              16           This study
T. denticola              16           This study

Table 2. Different mixtures of the positive control prepared in order
to determine the specificity

           pTZ-agg         pTZ-por         pTZ-pre

Mixture 1  10 ng/[micro]l  10 ng/[micro]l  0
Mixture 2  10 ng/[micro]l  10 ng/[micro]l  10 ng/[micro]l
Mixtures   10 ng/[micro]l  10 ng/[micro]l  10 ng/[micro]l
Mixture 4  10 ng/[micro]l  10 ng/[micro]l  10 ng/[micro]l

           pTZ-tan         pTZ-tre

Mixture 1  0               0
Mixture 2  0               0
Mixtures   10 ng/[micro]l  0
Mixture 4  10 ng/[micro]l  10 ng/[micro]l

Table 3. Characteristics of the primer pairs utilized in the study

Bacterium                 Target gene  Primer nanre     Position

                                       F-Aggrega- hbpA  2614-2634
A. actinomycetemcomitans  hbpA         R Aggrega- hhpA  2774-2756
                                       F- Porphy-fimA   296-313
P. gingivalis             fimA         R- Porphy-fimA   457- 438
                                       F- Pre 16        357-375
P. intermedia             I6S i-RNA    R- Pre 16        637-618
                                       F- Tan-16        469- 490
T. forsythia              16S I-RNA    R- Tan-16        718-700
                                       F- Tre-16        266-284
T. dcnticola              I6S rRNA     R- Tre-16        438-414

Bacterium                 Primer sequence            Reference

                          AGACCCAATGCAAAAGTAACG
A. actinomycetemcomitans  GCAGTTCTGGGCTGAATTG        (V)
                          ACAGCAGGAAGCCATCAA
P. gingivalis             GCAGTCAGTTCAGTTGTCAA       Unpublished data
                          GAGGCAGCAGTGAGGAATA
P. intermedia             GCAAGGTAGATGTTGAGCAC       Unpublished data
                          GCATGTACCTTGTGAATAAGCA
T. forsythia              CTTCGCAATCGGAGTTCTG        (7)
                          CAAGGCAACGATGGGTATC
T. dcnticola              CTGCAAAAGAATTTTACAACCTTTC  Unpublished data

Table 4. Comparison of SYBR Green Real-time PCR and in-house LiPA
concerning the detection of DNA extracted from artificially
contaminated blood samples

SYBR Green Real- time PCR+            SYBR Green Real time PCR-  Total

A. actinomycetemcomitans
LiPA+                       27(67.5)   1(2.5)                    28
LiPA-                        1(2.5)   11(27.5)                   12
Total                       28        12                         40
P. intermedia
LiPA+                       27(67.5)   1(2.5)                    28
LiPA-                        1(2.5)   11(27.5)                   12
Total                       28        12                         40
T. denticola
LiPA+                       28(70)     1(2.5)                    29
LiPA-                        1(2.5)   10(25)                     11
Total                       29        11                         40
P. gingivalis
LiPA+                       29(72.5)   0                         29
LiPA-                        1(2.5)   10(25)                     11
Total                       30        10                         40
T. forsythia
LiPA+                       29(72.5)   0                         29
LiPA-                        0        11(27.5)                   11
Total                       29        11                         30

SYBR Green Real- time PCR+  Diagnostic sensitivity

A. actinomycetemcomitans
LiPA+
LiPA-                        96.4%
Total
P. intermedia
LiPA+
LiPA-                        96.4%
Total
T. denticola
LiPA+
LiPA-                        96.5%
Total
P. gingivalis
LiPA+
LiPA-                        96.6%
Total
T. forsythia
LiPA+
LiPA-                       100%
Total

SYBR Green Real- time PCR+  Diagnostic specificity  McNemar p-value

A. actinomycetemcomitans
LiPA+
LiPA-                        91.6%                  0.4795
Total
P. intermedia
LiPA+
LiPA-                        91.6%                  0.4795
Total
T. denticola
LiPA+
LiPA-                        90.9 %                 0.4795
Total
P. gingivalis
LiPA+
LiPA-                       100 %                   1
Total
T. forsythia
LiPA+
LiPA-                       100%                    1
Total
COPYRIGHT 2019 Avicenna Research Institute
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Original Article
Author:Soleimani, Mohammad; Zolfaghari, Mohammad Reza
Publication:Avicenna Journal of Medical Biotechnology (AJMB)
Article Type:Report
Date:Jan 1, 2019
Words:4672
Previous Article:Characterization of Monoclonal and Polyclonal Antibodies Recognizing Prostate Specific Antigen: Implication for Design of a Sandwich ELISA.
Next Article:Expression and Activity of Platelet Endothelial Nitric Oxide Synthase Are Decreased in Patients with Coronary Thrombosis and Stenosis.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters