Printer Friendly

Determination of Qnr allele frequencies in Fluoroquinolone resistant Pseudomonas aeruginosa isolated from burn wounds.

Byline: Kashmala Rafiq, Khola Ahmad, Naheed Ahmad, Madiha Gohar, Muhammad Ahmad Shehzad and Muhammad Qamar Saeed

Abstract

Effective treatment of burn wound infections is precluded by high prevalence of nosocomial infections coupled with high resistance rates against commonly used antimicrobials. Pseudomonas aeruginosa is an important nosocomial pathogen in burn infections due to high morbidity and mortality associated with it. We analyzed fluoroquinolone resistant Pseudomonas aeruginosa for the presence of Qnr gene, owing to high genetic mobility of this plasmid-borne gene. Bacteria were isolated from burn wound patients from Pak-Italian ModernBurn Center, Nishter Hospital Multan. Fluoroquinolone resistant isolates were selected and PCR-based assay was designed to determine the frequencies of different alleles. QnrB was found in highest number of isolates (10.8%) followed by QnrD (6%). We could not find any QnrC positive sample. As far as we could search, this is the first report on detection of Qnr gene in Pseudomonas aeruginosa from Pakistan.

Keywords: Pseudomonas aeruginosa, Qnr Gene, Pentapeptide Repeat Protein, Fluoroquinolone, Antibiotic Resistance

Introduction

Around 0.3 million people die annually because of burn wounds around the globe with nosocomial infections contributing in 50% of these deaths.1 Gram negative, non-spore forming organism, Pseudomonas aeruginosa is responsible for 10-20% hospital acquired infections and causes 40-75% mortality in burn patients.2 Broad spectrum antimicrobial drugs, fluoroquinolones (FQn), are commonly suggested against pseudomonal infections.3 Misuse of FQn has led to an increase in bacterial resistance due to chromosomal mutation in DNA gyrase (gyr A and gyr B genes) and topoisomerase IV or changes in expression of genes controlling transport of FQns.4 Another important acquired mechanism of FQn resistance is Qnr genes. They code pentapeptide repeat proteins which inhibit the action of FQn against bacterial DNA gyrase and topoisomerase IV.5 Qnr genes are classified as QnrA, QnrB, QnrC, QnrD and QnrS which differ 70% or more on the basis of nucleotide sequence.6

Owing to importance of Qnr based resistance in this pathogen, current study was designed to investigate presence of Qnr gene and determine relative frequencies of its alleles in FQn resistant isolates. Pseudomonas aeruginosa was isolated from burn wound infections. PCR based analysis of FQn resistant organisms was carried out to detect presence of Qnr alleles. Amongst all Qnr alleles, Qnr-B allele was found in highest number of isolates.

Methods

A total of 150 burn wound aspirates were collected by sterile syringes from 50 burn patients of both sexes (Male and Female) with an age range of 1.5 to 65 years during November 2016 to March 2017 at Pak Italian Modern Burn Center (PIBC), Nishtar hospital Multan. Aspirates were transported in sterile tubes containing Tryptic Soy Broth (TSB) within an hour to Microbiology lab of Institute of Pure and Applied Biology (IPAB) Bahauddin Zakariya University, Pakistan. They were cultured for 6h and streaked on Cetrimide Agar (CA) for isolation of Pseudomonas aeruginosa. A series of conventional biochemical tests such as oxidative fermentative, oxidase, nitrate reduction, arginine decarboxylase and indole test was performed for confirmation of isolated colonies of Pseudomonas aeruginosa.7 Identified colonies were streaked onto Muller Hinton Agar plates containing 8ug/mL of Levofloxacin to select FQn resistant isolates as per CLSI instructions.8 Resistant colonies were directly transferred into PCR tubes.

PCR was performed for detection of qnr genes. The list of Primers are shown in the table. For each sample, 50ul PCR mix (25ul Taq polymerase, 5ul reverse and 5ul forward primers, 9ul de-ioni zed water, inoculum) was prepared. All this process was performed in ice box. For each primer (QnrA, QnrB, QnrC, QnrD, QnrS) amplification was executed as: single initial denaturation and bacterial lysis at 95AdegC for 10 minutes, followed by 35 cycles of denaturation at 95AdegC for 40 seconds, annealing temperature for QnrA, QnrB was 54AdegC, QnrC 50AdegC, QnrD 52AdegC, and QnrS 51AdegC, elongation at 72AdegC for 40 seconds followed by single final elongation at 72AdegC for 10 minutes. Amplified PCR products were analyzed on 1.5% agarose gel by using gel electrophoresis technique and examined under the UV transilluminator. SYBR-safe (Thermo-fisher, S33102) was used for visualization of DNA instead of ethidium bromide.

Table-1: (Quinolone Resistant Primers (OLIGO/macrogen).

Primer###Forward Primer###Reverse Primer###Size(bp)

QnrA###ATTTCTCACGCCAGGATTTG###TGCCAGGCACAGATCTTGAC###574

QnrB###CTCTGGCRYTNGTYGGCGAA###TTYGCBGYYCGCCAGTCGAA###505

QnrC###GGGTTGTACATTTATTGAATCG###CACCTACCCATTTATTTTCA###307

QnrD###CGAGATCACTTTACGGGGAATA###AACAAGCTGAAGCGCCTG###583

QnrS###ACTGCAAGTTCATTGAACAG###GATCTAAACCGTCGAGTTCG###433

Resuls

Purpose of this study was to analyse the presence of Qnr genes in FQn resistant isolates of P. aeruginosa. In this regard, 83 strains of P. aeruginosa were collected as FQn resistance isolates from 50 burn patients. All (n=83) clinical isolates were subjected for PCR based assay. Qnr allele frequencies were found to be 3(3.6%), 9(10.8%), 0%, 5(6%) and 2(2.4%) for QnrA, QnrB, QnrC, QnrD and QnrS respectively. We found one isolate that carried both QnrA and QnrB alleles. Current study was designed to examine the prevalence of Qnr genes in LEV resistant P. aeruginosa. Pseudomonal infections such as skin and soft tissue infections, burn and surgical wound infections are very difficult to treat because this pathogen has acquired intrinsic, adaptive as well as genetic resistance against all classes of antimicrobial drugs such as [beta]-lactam, carbapenem, aminoglycoside and fluoroquinolones.9

Similar study was conducted in South China. It was reported that QnrA gene was detected in single FQnr isolate of P. aeruginosa. For this purpose, 256 isolates were tested against QnrA, QnrB, QnrC, QnrD and QnrS genes. It was reported that these genes (QnrB, QnrC, QnrD and QnrS) were not present in a single isolate of P. aeruginosa.4 The results of current study were in accordance with results obtained by Marjani in Iraq.10 Presence of QnrS and QnrA gene was reported in 21% and 13.1% clinical isolate of P. aeruginosa. It was also reported that QnrS and QnrA genes were present within same isolate. In 2015, it was reported that 24% FQnr isolates of P. aeruginosa were positive for QnrS gene.10

Conclusion

To the best of our knowledge, this is the first report detailing prevalence of Qnr genes in a commonly encountered nosocomial pathogen such a Pseudomonas aeruginosa.Further genetic and biochemical studies are required to understand dynamics of the spread of this allele.

Recommendations

Qnr mediated resistance phenotype is generally plasmid mediated therefore highly prone to be transferred to other related pathogens through horizontal gene transfer.4 Nonetheless, such screenings are advisable on routine basis from infection control perspective.

Disclaimer: None to declare.

Conflict of Interest: None to declare.

Funding Sources: Funding form annual Research Grant of Bahauddin Zakariya University, Multan, Pakistan.

References

1. WHO. WHO | Burns [Online] 2016 [Cited 2016 Nov 30]. Available from: URL: http://www.who.int/mediacentre/factsheets/fs365/en/

2. Hassuna NA, Mohamed AHI, Abo-Eleuoon SM, Rizk HAWA. High prevalence of multidrug resistant Pseudomonas aeruginosa recovered from infected burn wounds in children. Arch Clin Microbiol 2015; 6: 1-7

3. Linder JA, Huang ES, Steinman MA, Gonzales R, Stafford RS. Fluoroquinolone prescribing in the United States: 1995 to 2002. Am J Med 2005; 118: 259-68.

4. Yang X, Xing B, Liang C, Ye Z, Zhang Y. Prevalence and fluoroquinolone resistance of pseudomonas aeruginosa in a hospital of South China. Int J Clin Exp Med 2015; 8: 1386-90.

5. Tran JH, Jacoby GA, Hooper DC. Interaction of the Plasmid-Encoded Quinolone Resistance Protein QnrA with Escherichia coli Topoisomerase IV. Antimicrob Agents Chemother 2005; 49: 30502.

6. Cayci YT, Coban AY, Gunaydin M. Investigation of plasmid-mediated quinolone resistance in Pseudomonas aeruginosa clinical isolates. Indian J Med Microbiol 2014; 32: 285-9.

7. Forbes B, Sahm D, Weissfeld A. Gram-Negative Bacilli and Coccobacilli (MacConkey-Positive, Oxidase-Positive). In: Tille PM, 12th ed. Bailey and Scott's Diagnostic Microbiology, Elsevier, 2014; pp 340-50

8. Patel JB. Performance standards for antimicrobial susceptibility testing: 25th ed. Clinical and Laboratory Standard Institute, 2015; pp 52-3

9. Obritsch MD, Fish DN, MacLaren R, Jung R. Nosocomial Infections Due to Multidrug-Resistant Pseudomonas aeruginosa: Epidemiology and Treatment Options. Pharmacother J Hum Pharmacol Drug Ther 2005; 25: 1353-64.

10. Al-Marjani M, Kadhim AA, Kinani YA. Ciprofloxacin resistance in Staphylococcus aureus and Pseudomonas aeruginosa isolated from patients in Baghdad. Int J Pharm Sci Res 2015; 6: 382-5.
COPYRIGHT 2019 Knowledge Bylanes
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Journal of Pakistan Medical Association
Article Type:Report
Geographic Code:9PAKI
Date:Feb 28, 2019
Words:1457
Previous Article:Common balance measures and fall risk scores among older adults in Pakistan: Normative values and correlation.
Next Article:Does lumbar mobilization help stroke patients to improve functional outcomes?
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |