Printer Friendly

Determinacion microbiologica y molecular de Listeria sp. y Listeria monocytogenes en cerdas a nivel de una planta beneficiadora en EUA.

Microbiological and Molecular Detection of Listeria spp. and Listeria monocytogenes in a Cull Sows Process Plant in USA

RESUMEN

Con el objeto de comparar la tecnica de PCR multiple con el metodo microbiologico comercial para la determinacion de la presencia de Listeria spp. y Listeria monocytogenes en alimentos, se llevo a cabo un muestreo en una planta procesadora de cerdas de descarte ubicada en Estados Unidos de Norteamerica (EUA). A 160 cerdas sacrificadas, se le tomaron muestras de ganglios sub-iliacos, ganglios ileocecales, contenido cecal e hisopado de la superficie de las canales. Adicionalmente se tomaron muestras del ambiente de la planta y de cortes de carne. Un total de 708 muestras se procesaron con ambas tecnicas. Mediante tecnicas microbiologicas, el 5,2% resultaron positivas a Listeria spp. y el 0,14% a L. monocytogenes. Mediante la tecnica de PCR 4,1% resultaron positivas a Listeria spp. y 0,85% positivas a L. monocytogenes. No se observo diferencias significativas (P [mayor que o igual a] 0,05) entre estos valores. Se determino una incidencia del 1,9% de Listeria spp. en los hisopados de la superficie de las canales de las cerdas evaluadas. Por otro lado, se identifico L. monocytogenes, en el 5% de las muestras de cortes de carne. En relacion a los ganglios, los sub-iliacos presentaron 6,3% de incidencia a Listeria spp. y de 1,3% a L. monocytogenes no encontrandose en ganglios ileocecales. Para el contenido cecal la incidencia a Listeria spp. fue de 19% y para L. monocytogenes fue de 2,5%. En el ambiente el 4,2% de las muestras resultaron positivas a Listeria spp. y ninguna a L. monocytogenes. Al comparar los resultados logrados entre ambas tecnicas no hubo diferencia significativa entre los valores obtenidos con las muestras de los hisopados de las canales y la de los ganglios ileocecales. Si hubo diferencia significativa entre los resultados de contenido cecal P = 0,0168 < 0,05 y de los ganglios sub-iliacos P = 0,0038 < 0,05. La utilizacion de la tecnica de PCR multiple, permitio que los resultados se obtuvieran en 8 h, luego del segundo periodo de enriquecimiento de cada muestra, y con el metodo microbiologico convencional el procedimiento tomo 8 dias. La incorporacion de la metodologia molecular en el proceso de verificacion del status microbiologico en la industria de alimentos, resulta una mejora para la efectividad y la dinamica en los sistemas de seguridad alimentaria.

Palabras clave: Cerdos, Listeria spp., L. monocytogenes, PCR multiple, seguridad alimentaria, HACCP.

ABSTRACT

Listeria spp. and Listeria monocytogenes presence in a cull sows processor plant in USA, was evaluated by and PCR multiplex method. 160 cull sows were surveyed after slaughter. Samples were collected from sub-iliac node, iliocecal node, cecal content and carcass swabs. Additionally samples were taken from environment plant and from raw meat ready to be processed. A total of 708 samples were processed. Using traditional microbiology method were found 5.2% of samples positive to Listeria spp. and 0.14% to L. monocytogenes. With PCR multiplex 4.1% were positive to Listeria spp. and 0.85% to L. monocytogenes. There was not significant difference (P [greater than or equal to] 0.05) in the results obtained with PCR multiplex and traditional microbiology procedures. In relation with the raw material that leaves the slaughter area to be processed inside the same plant, Listeria spp. was observed in 1.9% swabs carcass, and 5% of raw sow meat sampled. Listeria spp. was identified in 6.3% and L. monocytogenes in 1.3% of subiliac nodes. It was not any iliocecal node positive to Listeria. Samples supposedly related with the infection source in the process plant, cecal content sample were 19% positive to Listeria spp. and 2.5% to L. monocytogenes. Environmental samples were 4.2% positive to Listeria spp. There were not differences between the conventional microbiology procedure and PCR multiplex technique for this pathogen when carcass swabs and ilicecal node were evaluated with both techniques. Differences were observed between the samples from cecal content and sub-iliac node P = 0.0168 < 0.05 and P = 0.0038 < 0.05 respectively. With the PCR multiplex technique, results were obtained in 8 hours after the second enrichment culture period of the each sample. With traditional microbiological it took 8 days. The incorporation of molecular methodology in the verification process for microbiological controls in the food industry, would allow an important improvement of the effectiveness and dynamics in the food safety systems implanted at the food industries.

Key words: Cull sows, Listeria spp., L. monocytogenes, PCRmultiplex, food safety, HACCP.

INTRODUCCION

Listeria monocytogenes es un patogeno oportunista relacionado con las enfermedades transmitidas por los alimentos (ETA), el cual tambien afecta a los animales [17]. Desde 1911 los cientificos han conocido de la infeccion en animales, por Listeria, y en 1.929 fue detectado el primer caso en humanos [33]. Hace veinte anos se desconocia que este patogeno podia ser transmitido por los alimentos. Esto cambio cuando en los Estados Unidos ocurrieron los brotes de 1981 y 1985, los cuales fueron causados por la ingestion de alimento contaminado con Listeria monocytogenes. En 1985 el alimento implicado fue queso blando mexicano, hecho con leche sin pasteurizar [30]. A nivel mundial L. monocytogenes ha sido descrito como uno de los principales y mas severos patogenos transmitidos por los alimentos [6, 10]. Es una bacteria Gram (+), no formadora de esporas. Su motilidad es debida a un flagelo polar, y puede crecer a temperaturas entre 0 y 42[grados]C, aunque son eliminadas por medio de la pasteurizacion. Tambien puede ser cultivada de medios con un amplio rango de pH, preferiblemente a pH neutro, por lo que puede encontrarse contaminando una gran variedad de alimentos [6, 15, 18]. Este genero esta dividido en 8 especies de las cuales solo L. monocytogenes es considerada como un peligro para el hombre cuando se encuentra en los alimentos. Esta especie esta subdividida en serotipos, siendo de importancia epidemiologica para los humanos la especie L. monocytogenes con serotipos conocidos como 1/2a, 1/2b y 4b. [7, 15, 29]. Todas las especies han demostrado ser positivas a la reaccion de la esculina, produciendo en estos medios un halo negro alrededor de las colonias, las cuales ademas se presentan como colonias lisas, convexas blancas con aspecto de vidrio rayado y con un diametro de entre 1 y 2,5 mm [1] (FIG. 2).

[FIGURA 2 OMITIR]

Entre los sindromes clinicos asociados a listeriosis se incluye la sepsis e infeccion localizada de los huesos, articulaciones, ojos, endocardio, cordon espinal, peritoneo y vesicula. Otras dos manifestaciones o sindromes propios y atribuibles son la meningoencefalitis y la granulomatosis infantiseptica [29].

Grandes esfuerzos en materia de prevencion se han venido realizando para el control de las enfermedades transmitidas por los alimentos (ETA) por parte de la industria y de las agencias Federales de los Estados Unidos de America [1]. El departamento encargado de los servicios de inspeccion y de seguridad alimentaria de EUA (Food Safety and Inspection Service, FSIS) reporta en el ano 2001, que la prevalencia de L. monocytogenes en canales y carne molida de cerdos, fue de 7,4%. Para el Departamento de Salud Publica de los Estados Unidos, la presencia de L. monocytogenes como ETA es de gran importancia, en los alimentos procesados listos para el consumo (Ready to eat food). La presencia de cualquier especie de Listeria en un alimento procesado, es indicativo de que su eliminacion no fue llevada a cabo de forma efectiva durante el procesamiento del alimento [15]. En Europa, segun la directriz 92/46/EC, L. monocytogenes no debe estar presente en 25 g de queso blando y los hallazgos positivos llevan a un reprocesamiento del producto. Asi mismo, en EUA y Canada tienen establecido dentro de su legislacion la "Cero tolerancia" para este patogeno. En funcion a dicha legislacion, para este agente en alimentos como leche y productos carnicos, tecnicas rapidas y altamente sensibles son necesarias para ser implementadas en su control a nivel de la industria, previos a la liberacion de estos productos a los consumidores. La implementacion de nuevos metodos es necesaria ya que las tecnicas microbiologicas convencionales toman de 5 a 7 dias para la deteccion e identificacion del genero Listeria y especie L. monocytogenes [23, 28]. Dentro del genero Listeria, la L. innocua es detectada en los alimentos con mayor frecuencia que L. monocytogenes, y crece mas rapido en medios de enriquecimiento selectivo. Esto pudiera permitir la obtencion de presuntos falsos positivos, especialmente cuando crecen en medios en los cuales no se puede observar diferencias entre L. monocytogenes y las otras especies [16, 22].

El avance de la biotecnologia ha permitido el desarrollo de nuevos metodos para la deteccion de este microorganismo en alimentos, los cuales proporcionan ventajas en cuanto a la eficiencia, sensibilidad y disminucion del tiempo de deteccion. Estos metodos rapidos, por estar basados en la determinacion de acidos nucleicos, tienen la potencialidad de ser altamente especificos, y de determinar entre organismos muy cercanamente relacionados geneticamente. Tal es el caso de la tecnica de Reaccion en cadena de la Polimerasa (PCR), una tecnologia molecular de amplificacion in vitro del ADN [2], que se utiliza ampliamente hoy en dia como un metodo rapido de diagnostico, mediante el cual es posible obtener al mismo tiempo, la identificacion de diferentes caracteristicas genotipicas, como por ejemplo genero y especie [24, 25].

Mediante estudios experimentales, realizados con la tecnica de hibridacion de ADN/ADN, se identificaron 5 grupos genomicos en Francia: L. monocytogenes, L. ivanovii (responsable de abortos en animales), L. innocua, L. welshimeri y L. seeligeri [18]. Se destaco que solo L. monocytogenes es la especie reconocida como patogena en humanos [15].

Estudios epidemiologicos han determinado que esta bacteria entra en la cadena de los alimentos por medio de los animales utilizados para el consumo humano, los cuales, actuando como reservorios y fuentes de infeccion, la introducen al ambiente por medio de la leche o sus heces.

Contaminaciones cruzadas por manejos impropios e inadecuada coccion de los alimentos contribuyen a la instauracion de una infeccion por este patogeno en humanos [3].

La resistencia de Listeria spp. a diferentes tipos de condiciones ambientales, hace que su control en los procesos de elaboracion de alimentos sea cada vez mas dificil. Esta bacteria representa uno de los principales patogenos relacionado con las ETA en los Estados Unidos. En Venezuela estudios recientes detectaron L. monocytogenes en atun fresco [20]. A nivel mundial son variados los grupos de alimentos que han sido implicados en brotes, teniendo entre ellos las carnes, los productos lacteos, los productos del mar y vegetales.

La Reaccion en Cadena de la Polimerasa (PCR), con su variante multiple, es una tecnica que ofrece la posibilidad de determinar la presencia de Listeria spp. y verificar la especie de L. monocytogenes al mismo tiempo, reduciendo el tiempo de deteccion y aumentando la especificidad del diagnostico. En la PCR multiple se tiene la ventaja de poder amplificar secuencias que codifiquen por ejemplo, diferentes genes de una misma especie o de diferentes especies a la vez, lo que implica reduccion de tiempo y del costo de la reaccion [13].

Los objetivos de este trabajo fueron:

-- Evaluar la presencia de Listeria spp. y L. monocytogenes en cerdas eliminadas como reproductoras (Cull sows) beneficiadas en un matadero utilizando las tecnicas microbiologicas tradicionales solas o en combinacion con la tecnica de la PCR, con su variante multiple, con el proposito de establecer el grado de beneficio que pudiera aportar a las industrias procesadoras de alimentos, la utilizacion de dicha tecnica, versus a la metodologia convencional en el diagnostico de Listeria spp. y L. monocytogenes.

-- Determinar la incidencia de Listeria spp. y L. monocytogenes, en la superficie de las canales de cerdas, cortes de carne y ambientes de un matadero especializado en el sacrificio y procesamiento de sus carnes, establecer el grado de beneficio que pudiera aportar a las industrias procesadoras de alimentos. Igualmente, evaluar diferentes procedimientos para la extraccion del ADN de Listeria spp. y las condiciones de riesgo sanitario relacionado con la cepa patogena de Listeria.

MATERIALES Y METODOS

El estudio se llevo a cabo en un matadero dedicado al sacrificio exclusivo de cerdas ubicado en el poblado de Water Town, del estado de Wisconsin-EUA. La planta tiene un sacrificio promedio de 500 cerdas por dia, cuyas carnes eran en su totalidad procesadas en la misma planta, para la obtencion de diferentes tipos de chorizos y salchichas.

Diseno de recoleccion de muestras

El tamano de la muestra fue obtenido con ayuda del programa estadistico WINEPISCOP [9]. Para la obtencion de la misma fueron considerados los siguientes valores en la opcion del programa tamano de la muestra:

-- Tamano de la poblacion en estudio 2000 cerdas.

-- Nivel de confianza de 95%.

-- Error aceptado 5%.

-- Prevalencia estimada 12%.

El programa arrojo un tamano de muestra de 151, el mismo fue llevado a 160 cerdas muestreadas.

Los procedimientos estadisticos se llevaron a cabo aplicando para ello el estadistico Z corregido, prueba de dos colas.

El muestreo se llevo a cabo cada dos semanas. Cada dia de toma de muestra se muestrearon 40 cerdas, evaluandose un total de 160 cerdas. Se considero cuatro tipos de muestras en cada una de las cerdas: ganglio ileocecal, ganglio subiliacos, hisopado (por medio de esponjas esteriles) de la superficie de la canal, y contenido cecal.

Para evaluar el ambiente de trabajo se tomaron cada dia de recoleccion, 12 muestras del ambiente, correspondientes a superficies del lugar de faenado (mesa de trabajo, piso, pared y correa transportadora de las visceras). Igualmente se colectaron 5 muestras de cortes de carne de la sala de desposte, durante los cuatro dias, para un total de 48 muestras del ambiente y 20 de carne.

Toma de muestra: Se conformaron tres equipos de trabajo, uno para tomar muestras de ganglios sub-iliacos, otro para los ganglios ileocecales y contenido cecal, y un tercer equipo para la toma de las muestras de carne, ambiente e hisopado de la canal. Cada dia, las 40 cerdas eran muestreadas en dos lotes de 20 cerdas, seleccionadas de forma consecutivas lo que permitio una mejor identificacion y correspondencia entre las muestras. El muestreo comenzaba tomando las primera 20 cerdas, a partir de las 6:00 a.m., al iniciar la matanza en la planta. Posteriormente, luego de un periodo de espera, se reiniciaba la toma de muestras a las 9:00 a.m. con las 20 cerdas restantes. La recoleccion de las muestras fue planificada para realizarse los dias martes y procesarlas el dia siguiente de la semana correspondiente.

El transporte de las muestras, desde la planta hasta el laboratorio, se realizo en cavas refrigeradas con hielo, y conservadas en cavas refrigeradas (4[grados]C) hasta el momento de su procesamiento.

Procedimiento microbiologico

Se utilizo el procedimiento microbiologico convencional para la deteccion de Listeria utilizado por la unidad de "Pre-Harvest Food Safety and Enteric Disease" del Centro Nacional de enfermedades animales en USA (Nacional Animal Disease Center, NADC) perteneciente al Departamento de Agricultura de los Estados Unidos (USDA), para el analisis de muestras provenientes de carnes rojas, muestras de la industrias avicola incluyendo los huevos, y para muestras proveniente del ambiente [17, 26, 32, 33], (FIG. 1).

[FIGURA 1 OMITIR]

Los protocolos aplicados fueron los siguientes:

Protocolo 1. Contenido cecal: Se tomaron 10 g de la muestra y se agrego 90 mL de caldo selectivo para L. monocytogenes, Universidad de Vermont Modificado (UVM) (CM 863 Oxoid), mas suplemento selectivo UVM I (UVM I, SR 142 Oxoid). Se incubaron a 37[grados]C por 48 horas. Se tomo una alicuota de 100 [micron]L de la muestra en caldo UVM I, y se inoculo en 9,9 mL de caldo UVM mas suplemento selectivo UVM II (UVM II, SR 143, Oxoid). Se incubo a 37[grados]C por 48 horas.

Posteriormente, se tomo una alicuota de 100 [micron]L de la muestra en caldo UVM II, y se sembro en agar Palcam (CM 0877, Oxoid) mas suplemento selectivo (SR 0150 Oxoid), e incubo a 37[grados]C por 48 horas. Luego, se seleccionaron 5 colonias putativas de L. monocytogenes (FIG. 2), las cuales fueron confirmadas por medio de la prueba de la hidrolisis de la esculina [32], utilizando para ello el mismo agar Palcam con su suplemento selectivo, y determinando positivas a Listeria spp. aquellas colonias que presentaban un halo oscuro alrededor de las mismas (FIG. 2). Por ultimo, se verificaron y diferenciaron las colonias antes confirmadas, en cuanto al genero y especie (Listeria spp., L. monocytogenes), por medio de la tecnica de PCR multiple.

Protocolo 2. Hisopado con esponja (canales de las cerdas y ambiente): Se prehidrato la esponja esteril (Nasco, Whirl-Pak, Speci-Sponge, B01324WA) (5 x 10 x 1 cm) con 10 mL de agua peptonada 0,1%. Se realizo barrido con ambas caras de la esponja por el area definida (superficie de la canal del animal o del ambiente de trabajo) para la toma de la muestra y se regreso al empaque original para su transporte al laboratorio. Se coloco la esponja en 30 mL de caldo UVM I, y se incubo a 37[grados]C por 48 horas. Toma de la muestra para PCR multiple. Se continuo de forma similar al protocolo 1.

Protocolo 3. Cortes de carne: Se colocaron 25 g de la carne en una bolsa esteril de plastico resistente. Con un martillo de goma, se trituro la carne y se le agrego 250 mL de caldo UVM I. Se mezclo con el stomacher durante 1 min y se incubo a 37[grados]C por 48 horas.

Se inocularon 100 [micron]L de la muestra en caldo UVM I en 9,9 mL de caldo UVM II y se incubo a 37[grados]C por 48 horas. Toma de la muestra para PCR multiple. Se continuo de forma similar al protocolo 1.

Protocolo 4. Ganglios. Se colocaron 3 g del ganglio en una bolsa esteril de plastico resistente. Con un martillo de goma, se trituro el contenido (ganglio) y se le agrego 30 mL de caldo UVM I. Se mezclo con el stomacher durante 1 min y se incubo a 37[grados]C por 48 horas. Se inocularon 100 [micron]L de la muestra en caldo UVM I en 9,9 mL de caldo UVM II y se incubo a 37[grados]C por 48 horas. Toma de la muestra para PCR multiple. Se continuo de forma similar al protocolo 1.

Procedimiento molecular

Se aplico la tecnica de PCR multiple para la determinacion de Listeria spp. y L. monocytogenes. Los iniciadores o primers seleccionados han sido reportados previamente [4, 7, 32, 33]. Estos amplifican especificamente la region del gen 16S rRNA altamente conservada en la Listeria spp. [5, 12, 14] y la region del gen que codifica para el listeriolisina O (hly A) unica para L. monocytogenes [8]. Estos primers amplifican regiones de 938 y 174 pares de bases respectivamente [17, 34] (TABLA 1).

Extraccion del ADN

En este estudio se evaluo tres procedimientos para la extraccion del ADN de una muestra proveniente de caldo UVM II, sospechosa de Listeria spp. o L. monocytogenes.

Procedimientos:

I. Se transfirio una alicuota de 1,5 mL del cultivo de L. monocytogenes en caldo UVM II a un tubo eppendorf de 1,6 [micron]L; se centrifugo a 8000 r.p.m. por 2 min y se descarto el sobrenadante. Se resuspendio el pellet en 500 [micron]L de agua destilada, se mezclo en vortex durante 30 seg y se centrifugo a 5000 r.p.m. durante 1 min. Se repitio el paso 2 y se resuspendio el pellet en 250 [micron]L de agua destilada. Se utilizaron 5 [micron]L como muestra de ADN para el PCR.

II. Igual al procedimiento I. Se resuspendio el pellet en 500 [micron]L de agua destilada, se mezclo en vortex durante 30 seg y se centrifugo a 8000 r.p.m. por 2 min. Se descarto el sobrenadante. Se resuspendio el pellet en 500 [micron]L de agua destilada, se calento a temperatura de ebullicion durante 15 min. Luego se coloco la muestra en hielo durante 2 min y se centrifugo a 8000 r.p.m. durante 3 min. Se utilizo 5 [micron]L del sobrenadante como muestra de ADN para el PCR.

III. Se repitio el paso 1 del Procedimiento I. Se resuspendio el pellet en 250 [micron]L de agua destilada. Se anadieron 10 [micron]L de lisozima (50 mg/mL in 10 mM Tris-HCl. pH 8.0). Se incubaron a 37[grados]C durante 1 h. Se agregaron 40 [micron]L (20mg/mL) proteinasa K. Se incubo a 72[grados]C por 30 min y luego a 95[grados]C durante 10 min. Se agregaron 300 [micron]L de isopropanol helado, se mezclo durante 3 min y se incubo a -70[grados]C por 15 min. Se centrifugo a 8000 r.p.m. por 2 min y se descarto el sobrenadante. Se resuspendio el pellet en 300 [micron]L de etanol al 70%, y se centrifugaron a 8000 r.p.m. durante 1 min. Se seco el pellet conteniendo el DNA. Se reconstituyo en 200 [micron]L de agua destilada. Se utilizo 5 [micron]L como muestra de ADN para el PCR.

Reaccion de PCR multiple

El protocolo para esta reaccion de PCR multiple se realizo de la siguiente forma: 0,5 ng del ADN de la muestra, 50 pmol de cada uno de los iniciadores (U1, LI1, Lis-1 y Lis-2), 1,25 U de Taq-polimerasa (Roche), 200 [micron]M de cada nucleotido (dATP, dCTP, dTTP y dGTP), 10 mM Tris-HCl, 50 mM KCl y 6,5 mM de Mg[Cl.sub.2] [31], en un volumen de reaccion de 50 [micron]L.

En el termociclador (9700 Applied Biosystems, EUA), el ciclo de temperaturas fue el siguiente: Un primer periodo de desnaturalizacion de 94[grados]C x 5 min, luego 25 ciclos de 94[grados]C x 30 seg, 60[grados]C x 30 seg y 72[grados]C x 30 seg. Al final, 72[grados]C durante 7 min para la extension final y luego 4[grados]C la temperatura final de mantenimiento del producto del PCR [34, 35].

Los productos de PCR se separaron por electroforesis en geles de agarosa al 2% (95 V x 1 h) con Tris-borato-EDTA (TBE), previamente tenidos con bromuro de etidio, se registraron con el sistema Gel Doc 1000 (Bio-Rad, Richmond, California, EUA).

RESULTADOS Y DISCUSION

La especificidad de los primers para la deteccion de Listeria spp. y L. monocytogenes se confirmo con los resultados obtenidos y reflejados en la FIG. 3, donde se evidencian los productos de amplificacion de los genes 16S rRNA y hyl A, los cuales codifican para genero y especie respectivamente.

[FIGURA 3 OMITIR]

Metodos de extraccion del ADN

En la FIG. 4, pozos 9 y 10, los resultados muestran las bandas que indican la amplificacion de las secuencias esperadas, en las muestras evaluadas, utilizando el ADN aislado mediante el procedimiento III. En comparacion con el ADN obtenido en el procedimiento I, se observan las bandas amplificadas tanto de especie como del genero de forma muy delgada y con poca intensidad en los pozos 3 y 4.

[FIGURA 4 OMITIR]

Con respecto al procedimiento II, en donde se utilizo como ADN blanco tanto el pellet corrido en los pozos 5 y 6, como el sobrenadante (producto del mismo proceso de extraccion), corridos en los pozos 7 y 8, en ambos resultaron amplificaciones debiles para el gen hyl A, asi como negativas, para el gen 16S rRNA.

En consecuencia, se selecciono el procedimiento III, para la extraccion del ADN de las muestras a ser evaluadas en este estudio por medio de la tecnica de PCR multiple.

Estudio microbiologico para Listeria spp.

El procedimiento microbiologico anteriormente descrito en materiales y metodos (FIG. 1), aplicado a la totalidad de las muestras revelo un total de 42 positivas a Listeria spp., solamente las muestras provenientes de ganglio subiliaco resultaron negativas. La mayor proporcion de muestras positivas (20%, rango 0,6 a 20%), se observaron en aquellas provenientes de contenido cecal (TABLA II).

Comparacion entre los resultados obtenidos por la tecnica PCR multiple a dos etapas del procesamiento Microbiologico

Cuando se aplico la tecnica del PCR multiple directamente a todas las muestras, luego del enriquecimiento en caldo UVM II, los resultados fueron los siguientes: Para las Canales, 3/160 de las muestras resultaron positivas a Listeria spp. y ninguna a L. monocytogenes; en Contenido cecal, 15/160 fueron Listeria spp. y 4/160 L. monocytogenes. Los ganglios

ileocecales resultaron todos negativos. De los ganglios subiliacos, 10/160 resultaron Listeria spp. y 2/160 dieron positivos a L. monocytogenes. Las 20 muestras de carne resultaron negativas. De las muestras colectadas del ambiente, 2/48 resultaron positivas a Listeria spp. (TABLA III).

Las muestras identificadas positivas a Listeria spp., fueron evaluadas por medio de la tecnica PCR multiple al final del procedimiento microbiologico, tomando el ADN de las colonias seleccionadas como Listeria spp. Las 3 muestras positivas aisladas de las canales, resultaron igualmente positivas a Listeria spp. por medio de la tecnica del PCR multiple. Todas las 31 muestras positivas a Listeria spp., aisladas del contenido cecal, se confirmaron por PCR multiple como positivas a Listeria spp. Del total de las muestras positivas de los ganglios ileocecal y subiliaco evaluados, una sola muestra presuntiva a Listeria spp., resulto negativa con el ensayo de PCR multiple (FIG. 5). Con respecto a los cortes de carne, la unica muestra positiva a Listeria spp., fue confirmada de la especie L. monocytogenes, con el uso de la tecnica de PCR multiple (TABLA III).

[FIGURA 5 OMITIR]

Las hipotesis planteadas refieren una comparacion entre proporciones, relacionadas con los valores obtenidos de la aplicacion a dos tiempos diferentes de la tecnica PCR multiple, de las muestras provenientes de las cerdas beneficiadas:

[H.sub.0]: [P.sub.1] = [P.sub.2]; [H.sub.1]: [P.sub.1] [desigual a] [P.sub.2]

En estos resultados, no se obtuvieron diferencias significativas (P [mayor que o igual a] 0,05) entre el resultado del PCR multiple, a los 4 dias del procesamiento microbiologico (segundo periodo de enriquecimiento Medio UVM II) y la PCR multiple aplicada a las colonias positivas Listeria spp. al final del proceso, al aplicarlos en las muestras de ganglios ileocecales e hisopados de las superficies de las canales de las cerdas. Por otro lado, si se observo diferencia significativa de P = 0,0168 < 0,05 y P = 0,0038, < 0,05, para las muestras de contenido cecal y ganglio sub-iliaco, respectivamente.

Incidencia de Listeria spp. y L. monocytogenes

La incidencia reportada en este estudio resulto del compendio de los valores positivos a Listeria spp. y L. monocytogenes, obtenidos de las diferentes muestras procesadas, tomando en cuenta todos los hallazgos logrados por las tecnicas PCR multiple, durante todo el proceso del analisis microbiologico de las muestras. En el contenido cecal, el 19,4% de las muestras resultaron positivas a Listeria spp. y el 2,5% a L. monocytogenes. Al evaluar los ganglios subiliacos, el 6,3% mostraron Listeria spp. y el 1,3% L monocytogenes, no observandose ningun resultado positivo para muestras provenientes de los ganglios iliocecales. Por otro lado, en cuanto a los hisopados de las canales de las cerdas, solo se logro el aislamiento de Listeria spp. en el 1,9% de las muestras. Igualmente, para las muestras tomadas del medio ambiente, solo se aislo Listeria spp. en el 4,2% de las mismas. Por ultimo, el 5% de las muestras de carne resultaron positivas a L. monocytogenes.

En concordancia con los resultados reportados por Wesly y col. [17,34], al utilizar la tecnica de PCR multiple y los primers por ellos reportados, se logro detectar en este estudio Listeria spp. y L. monocytogenes en diferentes tipos de muestras tomadas en el matadero. Sin embargo Wesley y col. [17], en muestras similares de cerdos de engorde, obtuvieron menores porcentajes de positividad para L. monoyitogenes (1%) con la tecnica del PCR multiple que con la metodologia microbiologica convencional (2,4%), la cual resulto ser la misma empleada en el presente estudio.

Al igual que lo reportado por Manzano y col. [19], no se evidencio diferencia con la tecnica microbiologica convencional y la tecnica del PCR multiple. Estos autores adicionalmente reportan haber logrado estos resultados en un periodo de 8 horas, coincidiendo con el presente estudio, donde el tiempo utilizado para el procesamiento de las muestras por la tecnica de PCR multiple fue similar. Cabe destacar que el metodo microbiologico aplicado, consumio 8 dias.

Los hisopados de las superficies de canales de las cerdas evaluados en este estudio resultaron negativos mediante ambas tecnicas, a diferencia del 1,5% que reporto Wesley y col. [17] en muestras de hisopado de superficie de canales de cerdos de engorde.

En las muestras de contenido cecal, usando el metodo microbiologico, se logro aislar colonias de Listeria spp. en un numero mayor que con la aplicacion de la tecnica molecular. Sin embargo, la PCR multiple permitio identificar, de manera exclusiva, un numero importante de muestras positivas para L. monocytogenes, en un periodo considerablemente menor que con la metodologia tradicional. En este tipo de muestras Wesley y col. [17] no obtuvieron resultados positivos con ninguna de las metodologias utilizadas.

En las muestras de ganglio sub-iliaco, con el procedimiento de microbiologia convencional no se aislo ninguna colonia putativa de Listeria spp. y por tanto de L. monocytogenes. En este caso, la PCR multiple permitio identificar muestras positivas tanto para Listeria spp. como para L monocytogenes. A diferencia de lo reportado por Wesley y col. [17], quienes lograron identificar la presencia de este patogeno por ambas metodologias en las muestras de ganglios sub-iliacos de los cerdos. Este mismo grupo de investigadores, tomo muestras de carne molida de diferentes plantas procesadoras de cerdos de engorde y encontraron resultados positivos para el patogeno en estudio. Utilizando las mismas metodologias que se realizaron en este estudio, sus resultados positivos variaron entre el 21% y el 92% de las muestras. Esto contrasta con lo detectado en la planta evaluada en la presente investigacion, donde se encontro en los cortes de carnes, un 5% de las muestras positivas a L. monocytogenes. Estas diferencias de la condicion microbiologica de carnes obtenidas en ambas plantas pudieran estar relacionadas con alta densidad de matanza por hora (1.100 cerdos/hora) con respecto a una planta como la estudiada en este trabajo, donde no se sacrifican mas de 500 animales por dia.

El determinar la presencia de L. monocytogenes en centros de procesamiento de materias primas de origen animal, se ha convertido en los Estados Unidos en un procedimiento de rutina dentro de las medidas y estrategias que deben ser adoptadas por la industria de alimentos. Esto con el fin de cumplir con la normativa, establecida por las autoridades sanitarias del pais, para obtener y mantenerse bajo la legislacion de "Cero tolerancia" [32].

La planta bajo estudio es una industria de procesamiento y produccion de alimentos, especificamente de alimentos de alto riesgo, porque sus productos son elaborados con carnes frescas obtenidas mediante el sacrificio de cerdas como parte del proceso en la misma planta y luego, porque son comercializados en su mayoria, de forma de productos frescos bajo refrigeracion.

Entre estos productos estan los chorizos, los cuales tienen a favor, que su consumo debe llevarse a cabo, luego de su total cocimiento, por lo cual, las altas temperaturas van a lograr la eliminacion de cualquier tipo de bacteria presente en los mismos. Gande y Muriana [11] concluyeron que la pasteurizacion es una herramienta efectiva para el control de L. monocytogenes en la superficie de productos carnicos.

En este sentido, Southwick y Purisch [29], han evaluado el riesgo que representa cuando grandes volumenes de materias primas son procesados dentro de las industrias de alimentos, ya que de igual forma, mayores seran los riesgos de contaminacion con Listeria spp., al que se estan sometiendo los sistema de produccion y mas dificil sera prevenir su entrada al proceso.

Belceil y col. [4] y Skovgaard y Norrung [27], coinciden en que los cerdos portadores de L. monocytogenes en sus intestinos, se constituyen en la principal fuente de contaminacion de sus canales. Adicionalmente, el peligro se incrementa, al colonizar y establecerse en los diferentes ambientes a los cuales se expone, ya que su capacidad para adaptarse a los mismos es muy amplia, logrando constituir los llamados biofilms.

La evidencia lograda en este estudio de aislar celulas viables de L. monocytogenes de ganglios, confirma lo planteado por Southwick y Purisch [29]; al describir el riesgo que representan los organos linfoides de animales como fuentes de esta bacteria, y dependiendo del grado de infeccion del animal, su presencia en una gran variedad de celulas del mismo [31].

Esto evidencia las posibilidades de entrada de este patogeno a las areas de produccion de la planta, sobrepasando la mayoria de las barreras de control sanitario instaladas para tal fin. Ganglios linfaticos infectados, y practicas de eliminacion inadecuadas durante el procesamiento, pudieran producir la contaminacion de estas carnes.

Duffy y col., revisado por Wesley y col. [17], en un estudio realizado en 6 areas metropolitanas de EUA, no detectaron L. monocytogenes en carne molida de cerdo colectada a nivel de las plantas procesadoras, pero posteriormente 27% del producto vendido fue diagnosticado positivo a este patogeno. En este tipo de hallazgo pudiera estar combinado la contaminacion post-proceso y tambien, la caracteristica que tiene Listeria de invadir diferentes tipos de organos linfoides y celulas en general.

Aunque las carnes de estas cerdas en particular no representan un riesgo realmente grande como fuente de contaminacion en la elaboracion de las salchichas en ese establecimiento, no se puede descuidar la vigilancia para con L. monocytogenes, sobre todo conociendo su patogenicidad sobre las celulas del hospedador [21].

CONCLUSIONES

No se encontro evidencia de Listeria monocytogenes sobre la superficie de las canales de las cerdas evaluadas en el matadero seleccionado.

Las cerdas pueden ser portadoras de L. monocytogenes, tanto en sus heces como en sus ganglios, convirtiendose en fuente de contaminacion de este patogeno en el sistema de produccion de alimentos.

El sistema de control higienico sanitario establecido en esta planta de produccion, si bien mantiene un grado de contaminacion bajo sobre el ambiente, no impidio el paso del patogeno hacia las carnes a ser procesadas.

Los procedimientos microbiologicos convencionales nunca seran desplazados totalmente, dentro de los esquemas para el control microbiologico, ya que sus principios hoy en dia son necesarios para complementar la aplicacion de la tecnica del PCR en todas sus variantes, en muestras de alimentos.

La tecnica de PCR multiple puede ser ofrecida, como metodologia alternativa para la verificacion del estatus microbiologico en la industrias de alimentos, al permitir la identificacion de Listeria spp. y L. monocytogenes de forma confiable y mucho mas rapida.

AGRADECIMIENTO

Los autores extienden su mas cordial agradecimiento al National Animal Diseases Center (NADC), USDA, en Ames, Iowa. EUA., asi como tambien a la Iowa State University.

REFERENCIAS BIBLIOGRAFICAS

[1] ACHESON, D. Bringing foodborne disease into focus. Food Quality. Noviembre/Diciembre. 34-37 pp. 2000

[2] BARTLETT, J.; STIRLING, D. Methods in Molecular Biology. PCR Protocols. Vol 226. 2nd Ed. Humana Press. New Jersey. 545.pp. 2003.

[3] BASSLER, H.A.; FLOOD, S.J.; LIVAK, K.J.; MARMARO, J.; KNORR, R.; BATT, C. Use of a fluorogenic probe in a PCR-Based assay for the detection of Listeria monocytogenes. Appl. Environ. Microbiol. 61(10):3724-3728. 1995.

[4] BELCEIL, P.A.; FRAVALO, P.; CHAUVIN, C.; FABLET, C.; SALVAT, G.; MADEC, F. Epidemiology and quality assurance in pig production unit. J. Vet. Med. B. Infect Dis. Vet. Public Health. 50(4): 155-60. 2003

[5] BORDER, P.M.; HOWARD, J.J.; PLASTOW, G.S.; SIGGENS, K.W. Detection of Listeria monocytogenes using polymerase chain reaction. Lett. Appl. Microbiol. 11:158-162. 1990.

[6] CHASSEIGNAUX, E.; GERAULT, P.; TOQUIN, M.; SALVAT, G.; COLIN, P.; ERMEL, G. Ecology of Listeria monocytogenes in the environment of raw poultry meat and raw pork meat processing plants. Microbiol Lett. 210: 271-275. 2002

[7] CHASSEIGNAUX, E.; TOQUIN, M.; RAGIMBEAU, C.; SALVAT, G.; COLIN, P.; ERMEL, G. Molecular epidemiology of Listeria monocytogenes isolates collected from the environment raw meat and raw products in two poultry-and pork processing plants. J.of Appl. Microbiol. 91: 888-899. 2001

[8] DENEER, H.; BOYCHUK, I. Species-Specific detection of Listeria monocytogenes by DNA amplification. Appl. and Environ. Microbiol. 57(2):606-609. 1991.

[9] Facultad Veterinaria Medicine School of Zaragoza-Spain; University of Edinburgh; Wageningen University. Netherlands. Computer programs in veterinary epidemiology. http://www.clive.ed.ac.uk/winepiscope/2001.

[10] FORSYTHE, S. The Microbiology of Safe Food. 1st. Ed. Oxford, Londres. Blackwell Science Editorial. 412 pp. 2000.

[11] GANDE, N.; MURIANA, P. Prepacking surface pasteurization of ready-to-eat meats with a radiant heat oven for reduction of Listeria monocytogenes. J. of Food Prot. 66(9): 1623-30. 2003.

[12] GLASER, P.; FRANGEUL, L.; BUCHRIESER, C.; RUSNIOK, C.; AMEND, A.; BAQUERO, F.; BERCHE, P.; BLOECKER, H.; BRAND, P.; CHAKRABORTY, T.; CHARBIT, A.; CHETOUANI, F.; COUVE, E.; DE DARUVAR, A.; DEHOUX, P.; DOMANN, E.; DOMINGUEZ-BERNAL, G.; CUCHAUD, E.; DURANT, L.; DUSSURGET, O.; ETIAN, K.; FSIHI, H.; GARCIA DEL P, F.; GARRIDO, P.; GAUTIER, L.; GOEBER, W.; GOMEZ-LOPEZ, N.; HAIN, T.; HAUF, J.; JACKSON, D.; JONES, L.; KAERST, U.; KREFT, J.; KUHN, M.; KUNST, F.; KURAPKAT, G.; MADUENO, E.; MAITOURNAM, A.; VICENTE, J.; NG, E.; NEDJARI, H.; NORDSIEK, G.; NOVELLA, S.; DE PABLOS, B.; PEREZ, J.; PURCELL, R.; REMMEL, B.; ROSE, M.; SCHLUETER, T.; SIMOES, N.; TIERREZ, A.; VAZQUEZ, J.; VOSS, H.; WEHLAND, J.; COSSART, P. Comparative Genomics of Listeria species. Science. 294: 849-852. 2001.

[13] HENEGARIU, O.; HEEREMA, N.; DLOUHY, S.; VANCE, G.; VOGT, P. Multiplex PCR: critical parameters and step-by-step protocol. Biotech. 23(3): 504-511. 1997.

[14] INNIS, M.; GELFAND, D.; SNINSKY, J. London Academic Press. 566 pp. 1999.

[15] JINNEMAN, K.; HUNT, J.; EKLUND, CH.; WERNBERG, J.; SADO, P.; JOHNSON, J.; RICHTER, R.; TORRES, S.; AYOTTE, E.; ELIASBERG, S.; ISTAFANOS, PH.; BASS, D.; KEXEL-CALABRESA, N.; LIN, W.; BARTON, C. Evaluation and interlaboratory validation of a selective agar for phosphatidylinositol-specific phospholipase C activity using a chromogenic subtrate to detect Listeria monocytogenes from foods. J. of Food Prot. 66(3): 441-445. 2003.

[16] JOHANSSON, T.; AHOLA-LUTTILA, H.; PIRHONEN, T.; TAIMISTO, A.; HAARIO, H.; LAINE, M.; SALKINOJASALONEN, M. Improved detection of Listeria monocytogenes in soft mould ripened cheese. J. of Appl. Microbiol. 88:870-876. 2000.

[17] KANUGANTI, S.; WESLEY, I.V.; REDDY, P.G.; MCKEAN, J.D.; HURD, H.S. Detection of Listeria monocytogenes in pigs and pork. J. of Food Prot. 65: 1470-1474. 2002.

[18] MANZANO, M.; COCOLIN, L.; CANTONI, C.; COMI, G. Temperature gradient gel electrophoresis of the amplified product of a small 16S rRNA gene fragment for the identification of Listeria species isolated from food. J. of Food Prot. 63(5): 659-661. 2000.

[19] MAMZANO, M.; COCOLIN, L.; CANTONI, C.; COMI, G. A rapid method for the identification and partial serotyping of Listeria monocytogenes in food by PCR and restriction enzyme analysis. Inter. J. of Food Microbiol. 42: 207-212. 1998.

[20] MARTINEZ, R.; VILLALOBOS DE B., L. Aislamiento de Listeria monocytogenes en atun fresco expedido en la ciudad de Cumana, Venezuela. Rev. Cientif., FCV/LUZ. XIV(4): 354-357. 2004.

[21] McLAUCHLIN, J.; MITCHELL, R.; SMERDON, W.; JEWELL, K. Listeria monocytogenes and listeriosis: a review of hazard characterization for use in microbiological risk assessment of foods. J. of Food Microbiol. 92(1): 15-13. 2004.

[22] NOGVA, H.; RUDI, K.; NATERSTAD, K.; HOLCK, A.; LILLEHAUG, D. Application of 5'nuclease PCR for quantitative detection of Listeria monocytogenes in pure cultures, water, skim milk and unpasteurized whole milk. Appl. and Enviro. Microbiol. 66(10): 4266-4271. 2000.

[23] NORTON, D.M. Polimerase chain reaction -based methods for detection of Listeria monocitogenes: toward realtime screening for food and environmental samples. J. of AOAC Internat. 85(2): 505-515. 2002.

[24] NORTON, D.M.; BATT, C.A. Detection of Viable Listeria monocytogenes with a 5' nuclease PCR assay. Appl. Environ. Microbiol. 65(5): 2122-2127. 1999.

[25] O'CONNOR, L.; JOY, J.; KANE, M.; SMITH, T.; MAHER, M. Rapid polymerase chain reaction/DNA probe membrane-based assay for the detection of Listeria and Listeria monocytogenes in food. J. of Food Prot. 63(3):337-342. 2000.

[26] SILK, T., ROTH, T.; DONNELLY, C. Comparation of growth kinetics for healthy and heat-injured Listeria monocytogenes in eight enrichment broths. J. of Food Prot. 65(8): 1333-1337. 2002.

[27] SKOVGAARD, N.; NORRUNG, B. The incidence of Listeria sp. in feces of Danish pigs and in minced pork meat. Int. J. Food Microbiol. 8: 59-63. 1989.

[28] SOMER, L; KASHI, Y. A PCR method based on 16S rRNA sequence for simultaneous detection of the genus Listeria and species Listeria monocytogenes in food products. J. of Food Prot. 66(9): 1658-1665. 2003.

[29] SOUTHWICK, F.; PURICH, D. Intracellular pathogenesis of listeriosis. Review articles. The New England J. of Med. 334(12): 770-776. 1996.

[30] TORRES, D.; BARRIER, M.; BIHL, F.; QUESTNIAUX, V.J.F.; MAILLET, I.; AKIRA, SH.; RIFLE, B.; ERARD, F. Toll-Like receptor 2 is required for optimal control of Listeria monocytogenes infection. Infect and Immun. 72(4): 2131-2139. 2004.

[31] US. DEPARTMENT OF AGRICULTURE/ Food safety and inspection service, office of public health and service. Isolation and identification of Listeria monocytogenes from red meat, poultry, eggs and environmental samples. MLG 8,03. Revision 03. 20 pp. 2002.

[32] US. DEPARTMENT OF AGRICULTURE/ Food safety and inspection service; department of health and human service / food and drug administration. Preventing Food-born Listeriosis. http://vm.cfsan.fda.gov/~mow/FSISLIST. html. 9 pp. 2002.

[33] WESLEY, I.; HARMON, K.; DICKSON, J.; SCHWARTZ, A. Application of a multiplex polymerase chain reaction assay for the simultaneous confirmation of Listeria monocytogenes and other Listeria species in turkey sample surveillance. J. of Food Prot. 65[5]:780-785. 2002.

[34] WESLEY, I.V.; HARMON, K.M.; RAMOS, A.; DICKSON, J.; Application of a multiplex PCR assay for the simultaneous confirmation of Listeria especies and Listeria monocytogenes. J. of Food Prot. 65: 780-785. 2001.

Fernando H. Rivera P. (1), Irene Wesley (2), Scott Hurd (2), David Simoes (1), Alix Sosa (3) y Sergio Rivera (1)

(1) Facultad de Ciencias Veterinarias, Universidad del Zulia. Maracaibo, Venezuela. (2) National Animal Disease Center, USDA-ARS, USA. (3) Laboratorio de Referencia Las Naciones (LARNACA). Maracaibo, Venezuela. E-mail: privera@luz.edu.ve

Recibido: 27/06/2005. Aceptado: 15/03/2006.
TABLA I
PRIMERS DESCRITOS POR WESLEY Y COL. PARA LA APLICACION DE LA TECNICA
DE PCR MULTIPLE EN LA CONFIRMACION SIMULTANEA DE Listeria spp. y L.
monocytogenes / PRIMERS REPORTED BY WESLEY et al., TO AMPLIFY
SEQUENCE OF Listeria spp. AND L. monocytogenes

      Gen          Primers        Secuencia 5'-'3        Pb.

   16S-rRNA           U1        CAGCMGCCGCGGTAATWC       938
                               M = A o C y W = A o T
                     LI1        CTCCATAAAGGTGACCCT
     hly A           Lis1      GCATCTGCATTCAATAAAGA      174
listeriolysin O      Lis2        TGTCACTGCATCTCCG

TABLA II
RESULTADOS MICROBIOLOGICOS EN LA DETERMINACION DE Listeria spp. /
Listeria spp. POSITIVE SAMPLES BY MICROBIOLOGICAL CONVENTIONAL METHOD

Muestras                  n          (+)          %

Canal                    160          5          3,1
Contenido cecal          160         32         20,0
Ganglio ileocecal        160          1          0,6
Ganglio subiliaco        160          0           --
Carne                     20          1          5,0
Ambiente                  48          3          6,3

TABLA III
APLICACION DE LA TECNICA DE LA PCR MULTIPLE, EN LA DETERMINACION
DE LA INCIDENCIA DE Listeria spp. Y L. monocytogenes, EN MUESTRAS
PROVENIENTES DE CERDAS DE REEMPLAZO A NIVEL DE PLANTA
BENEFICIADORA EN EUA / APPLICATION OF PCR MULTIPLEX TO
DETERMINE Listeria spp. AND L. monocytogenes INCIDENCE
IN USA CULL SOWS

Muestra                 n       PCR multiple *

                                Listeria spp.         L. monocytogenes
                                  (+)         %       (+)        %

Canal                  160         3         1,9       0         0
Contenido cecal        160        15a        9,4       4        2,5
Ganglio ileocecal      160         0          -        0         -
Ganglio subiliaco      160        10a        6,3       2        1,3
Carne                   20         0          -        0         -
Ambiente                48         2         4,2       0         -

Muestra                         PCR multiple **

                      Listeria spp.         L. monocytogenes
                       (+)         %         (+)       %

Canal                   3         1,9         0        -
Contenido cecal        31b       19,4         0        -
Ganglio ileocecal       0          -          0        -
Ganglio subiliaco       0b         -          0        -
Carne                   0          -          1        5
Ambiente                2         4,2         0        -

* Muestras en UVM II. ** Confirmacion de resultados microbiologicos.
Letras diferentes (a, b), muestran diferencias estadisticamente
significativas (P [less than or equal to] 0,05).
COPYRIGHT 2006 Universidad del Zulia, Facultad de Ciencias Veterinarias
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2006 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Rivera P., Fernando H.; Wesley, Irene; Hurd, Scott; Simoes, David; Sosa, Alix; Rivera, Sergio
Publication:Revista Cientifica de la Facultad de Ciencias Veterinarias
Date:May 1, 2006
Words:7729
Previous Article:Crecimiento pre-destete en hembras bovinas doble proposito.
Next Article:Estandarizacion de la deteccion del glicomacropeptido por PAGE-SDS como indice de adulteracion de leche.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters