Printer Friendly

Determinacion del sexo en aves de la familia furnariidae a traves de tecnicas moleculares.

SEX DETERMINATION IN BIRDS OF FURNARIIDAE FAMILY BY MOLECULAR TECHNIQUES

INTRODUCCION

La familia Furnariidae constituye un grupo de aves exclusivo del nuevo mundo. Se distribuye desde el norte de Mexico hasta la Patagonia (HEIMERDINGER, 1995; MEZQUIDA, 2001), y dentro de la avifauna mundial, representa una de las familias con mayor riqueza de especies (REMSEN, 2003). Se la encuentra en bosques tropicales, matorrales densos, marismas, pantanos, llanuras abiertas de escasa vegetacion y sistemas rocosos con presencia de herbaceas (SKUTCH, 1969; WILLIS, 1991). En general, los furnaridos son organismos de tamano mediano (9-30 cm de longitud), con plumaje pardo (-grisaceo, -rojizo), bastante similar en machos y hembras (FJELDSA & KRABBE, 1990; RIDGELY & TUDOR, 1994), y con escaso o nulo dimorfismo sexual (ligeras diferencias en el tamano y coloracion del plumaje entre sexos de algunas especies) (REMSEN, 2003). En Colombia, algunos autores han descrito esta familia como vulnerable ante la perturbacion de su habitat y como un grupo en el que se han registrado extinciones locales a traves de los Andes (KATTAN et al., 1994; RENJIFO, 1999; CASTANO, 2004; CASTANO & PATINO, 2007, 2008). Asi mismo, algunas de sus especies se encuentran incluidas dentro de las categorias de amenaza nacional e internacional (RENJIFO et al., 2002).

En la familia Furnariidae, como en muchas especies de aves, la determinacion del sexo se dificulta debido a su monomorfismo sexual, y los metodos tradicionales de sexaje, como la endoscopia, determinacion de niveles hormonales, cariotipo y la observacion del comportamiento, presentan ciertas desventajas por ser traumaticas y estresantes, sumado a que generalmente son protocolos extensos e ineficientes para establecer el sexo de juveniles (LIZA et al., 2008; MATTA et al., 2008; CARDONI et al., 2009). El descubrimiento en aves del gen CHD-W, exclusivo para hembras y CHD-Z, presente en ambos sexos (hembras, ZW; machos, ZZ), ha permitido desarrollar un metodo universal de su sexaje, que consiste en localizar los dos genes conservados CHD (chromo-helicase-DNA-binding), ubicados en los cromosomas sexuales, exceptuando Ratitae, donde se plantea que estos no sufrieron ningun tipo de mutacion previa a la divergencia aviar, y por ello son indistinguibles y morfologicamente similares a los cromosomas autosomicos (GRIFFITHS et al., 1998; FRIDOLFSSON & ELLEGREN, 1999).

GRIFFITHS et al. (1998), a traves de la amplificacion de los genes CHD-Z y CHD-W, diferenciaron el sexo en aves de una pareja de cada una de las 28 especies que analizaron distribuidas en 23 familias, metodo que ha sido ampliamente documentado en varios grupos, entre los que se destacan Pipridae (RYDER & DURAES, 2005; ANCIAES & NASSIF, 2002), Accipitridae (DONOHUE & DUFTY, 2006), Cinclidae (CAMPOS et al., 2005), Psittacidae (CAPARROZ et al., 2001) y Strigidae (DOUBLE & OLSEN, 1997). La utilidad de la tecnica es evidente en especies de escaso o nulo dimorfismo sexual, aunque tambien puede ser necesaria en especies en las que a pesar de existir un claro dimorfismo sexual en adultos, en los estadios juveniles, son controversiales (GRIFFITHS & KORN, 1997). En esta investigacion se utilizo ADN extraido del calamo de plumas de aves de la familia Furnariidae y la amplificacion por PCR de los genes CHD-W y CHD-Z, como herramientas para determinar el sexo, y a su vez, resaltar un metodo no invasivo que reduce el impacto sobre el bienestar de las aves, particularmente aquellas con algun grado de amenaza.

MATERIALES Y METODOS

El trabajo de campo se realizo en cuatro localidades del departamento de Caldas, en la vertiente occidental de la Cordillera Central: i. Reserva forestal protectora bosques CHEC S.A. E.S.P., ubicada entre los municipios de Manizales y Villamaria (51'27,2" N - 75[grados]24'48,3" W), comprende altitudes desde 2000 hasta 3500 m, y un area de 3890 ha (SALAZAR-RAMIREZ, 2010); ii. Jardin Botanico Universidad de Caldas, ubicado al sureste de la ciudad de Manizales (5[grados]4'12" N - 75[grados]31'14" W), a 2150 m, y un area de 15 ha (GALLEGO, 2000); iii. Ecoparque Alcazares-Arenillo, ubicado dentro del casco urbano de Manizales (5[grados]4' N - 75[grados]32' W), entre 1730 y 1960 m de altitud, y un area de 70 ha (ARANGO-B. et al., 2007); iv. Vereda San Juan, corregimiento Berlin, municipio de Samana, a 700 msnm.

En las cuatro localidades se realizo la captura de aves empleando 10 redes de neblina (12 x 2,5 m x 36 mm), con un esfuerzo total de muestreo de 2432 horas/ red. Los furnaridos capturados se marcaron con anillos plasticos tipo celuloide de colores, y se clasificaron de acuerdo a REMSEN et al. (2011). De cada uno de los individuos se recolectaron remiges primarias y rectrices, que se almacenaron en tubos Eppendorf de 1,5 ml con 0,5 ml de etanol al 70%, para la posterior obtencion del ADN (DONOHUE & DUFTY, 2006; CONSTANTINI et al., 2008).

El ADN fue extraido del calamo de plumas, por el metodo fenol-cloroformoalcohol isoamilico, de acuerdo a la metodologia propuesta por BELLO et al. (2001). La cantidad y calidad del ADN se midio con un espectrofotometro (NanoVue 80-2140-00, [R]General Electric). La amplificacion de los genes CHD-Z y CHD-W, se realizo mediante un PCR utilizando los iniciadores P2 (5TCTGCATCGCTAAATCCTTT3), P8 (5CTCCCAAGGATGAGRAAYTG3) descritos por GRIFFITHS etal. (1998), y 2550F (5GTTACTGATTCGTCTACGAGA3), 2718R (5 ATTGAAATGATCCAGTGCTTG3 ) desarrollados por FRIDOLFSSON & ELLEGREN (1999). Las condiciones de amplificacion, tanto para la mezcla de reaccion como para el perfil termico, se realizaron segun CARDONI et al. (2009) con modificaciones. Los productos de amplificacion se visualizaron en geles de poliacrilamida al 4 y 6%, coloreados con nitrato de plata (SANGUINETTI et al., 1994). Los controles positivos correspondieron a muestras de Gallus gallus, y como controles negativos y de reaccion, se utilizo agua destilada-desionizada.

RESULTADOS

Las herramientas moleculares empleadas, permitieron la separacion entre machos y hembras de 7 especies de Furnariidae (3 especies de la subfamilia Furnariinae y 4 de Dendrocolaptinae): Synallaxis azarae, S. brachyura, Xenops minutus, Dendrocincla tyrannina, Lepidocolaptes lacrymiger, Campylorhampus trochilirostris, C. pusillus. La eficiencia de la reaccion de PCR, para amplificar los genes CHD-Z y CHD-W, fue del 80,65% (25 de 31 individuos con amplificaciones positivas) (Tabla 1). En estas 7 especies los iniciadores P2-P8 y 2550F-2718R, mostraron pesos moleculares exclusivos y claramente diferenciables para machos y hembras, particularmente donde la eficiencia de los iniciadores es especie-especifico (Tabla 1, Figuras 1 y 2). Sin embargo, las especies Cranioleuca erythrops, Premnoplex brunnescens, Thripadectes holostictus, Dendrocincla fuliginosa y Glyphorynchus spirurus, no presentaron amplificacion positiva, y algunas, aunque mostraron amplificacion, no permitieron la diferenciacion del sexo (Anabacerthia striaticollis, Xiphocolaptes promeropyrhinchus y Dendrocolaptes picummus). En terminos globales, la eficiencia de la reaccion de PCR, para amplificar los genes CHD-Z y CHD-W para el total de individuos capturados, fue del 66% (29 de 44 individuos con amplificaciones positivas). La utilizacion de plumas de individuos adultos de Gallus gallus, como fuente de ADN, tanto para la estandarizacion de las pruebas moleculares, como fuente de control positivo, resulto exitosa ya que favorecio la obtencion de ADN de buena cantidad y calidad (Figura 1).

[FIGURA 1 OMITIR]

DISCUSION

El estudio revelo la diferenciacion molecular entre machos y hembras en 7 de las 15 especies de furnaridos evaluados, usando como fuente de ADN el calamo de las plumas. En las otras 8 especies no se logro una clara diferenciacion sexual, lo que puede explicarse por la evaluacion molecular de un solo individuo por especie (Anabacerthia striaticollis, Cranioleuca erythrops, Dendrocincla fuliginosa, Thripadectes holostictus), analisis molecular de individuos de un solo sexo (Dendrocolaptes picummus), o por la falta de eficiencia de los iniciadores para lograr la amplificacion de los genes CHD-Z y CHD-W en el caso de las especies Glyphorynchus spirurus, Premnoplex brunnescens, Xiphocolaptes promeropyrhinchus.

En Colombia, estos son los primeros resultados que comprueban que machos y hembras de especies de la familia Furnariidae, son claramente distinguibles a traves de la amplificacion de los genes CHD-Z y CHD-W, y se demuestra el polimorfismo de tamano (peso molecular), entre estos genes, como ha sido reportado en otras especies y grupos de aves (DOUBLE & OLSEN, 1997; GRIFFITHS et al., 1998; CAPARROZ et al., 2001; ANCIAES & NASSIF, 2002; CAMPOS et al., 2005; RYDER & DURAES, 2005; DONOHUE & DUFTY, 2006), permitiendo una clara diferenciacion genica (y sexual, en este caso), contrario a lo reportado en Ratitae, donde los genes CHD-Z y CHDW, son indistinguibles (GRIFFITHS et al., 1998; FRIDOLFSSON & ELLEGREN, 1999). La utilizacion de los iniciadores P2-P8, permitio visualizar un amplicon correspondiente al gen CHD-W mas pesado (400 pb para furnaridos y 410 pb para Gallus gallus) que el CHD-Z (380 pb). Con los iniciadores 2550F-2718R, se comprobo el amplio polimorfismo presente en los cromosomas sexuales de aves. El tamano de los amplicones con los dos iniciadores, presentaron diferencias entre machos y hembras, con variaciones dependiendo de la especie, lo que es concomitante con lo encontrado por GRIFFITHS et al. (1998). De igual forma, FRIDOLFSSON & ELLEGREN (1999) y JENSEN et al. (2003), reportaron que con la utilizacion de los iniciadores 2550F-2718R, se obtienen diferencias en un rango de 150 a 250 pb; mientras que para los iniciadores P2-P8 oscilan entre 10 y 80 pb, aspectos similares a nuestros resultados; es decir, las diferencias evidentes en los amplicones se presentaron con los iniciadores 2550F-2718R.

[FIGURA 2 OMITIR]

El ADN extraido del calamo de plumas de algunas especies de aves, constituye una fuente de buena cantidad y calidad, resultados similares a los obtenidos por HARVEY et al. (2006) y SILVEIRA (2009). Las plumas constituyen un material biologico clave para el sexaje en aves pequenas como los furnaridos (otras investigaciones obtienen muestras de sangre de la vena braquio-femoral, ver MORENO et al., 2007), debido a que se reduce notablemente el tiempo de manipulacion de las aves y por lo tanto el estres asociado con este procedimiento. Aunque varios autores manifiestan que las plumas proporcionan un ADN de menor cantidad y calidad que el obtenido a partir de sangre o tejidos (BELLO et al., 2001; PALMA et al., 2001; DE VOLO et al., 2008; GEBHARDT & WAITS, 2008), el metodo posee ventajas para estudios de especies vulnerables o con algun grado de amenaza, al ser una tecnica no invasiva, no requiere entrenamiento especial, se reduce el tiempo de manipulacion del ave, no genera residuos peligrosos, permite un almacenaje sencillo y facilita la tarea de muestreo, tal como lo registran DONOHUE & DUFTY (2006) y HARVEY et al. (2006). Asi mismo, el uso de Gallus gallus como control positivo, hace el procedimiento facilmente replicable, sumado a que es una especie comun, de facil acceso y con un claro dimorfismo sexual en estado adulto.

Las parejas de iniciadores no siempre fueron eficientes para el sexaje de las aves, ya que en varias ocasiones algunos individuos solo presentaron productos de amplificacion con solo un iniciador. Esto puede explicarse por las cantidades limitadas y la degradacion natural e inestabilidad del ADN, debido a la congelacion y descongelacion de las muestras, que puede ser un motivo para la no amplificacion (PALMA et al., 2001). De igual manera, el uso de un protocolo de extraccion universal como el fenol-cloroformo-alcohol isoamilico, puede influir en la obtencion de un ADN de mayor calidad. WATSON et al. (2004), encontraron que de 80 individuos analizados usando plumas como fuente de ADN, el 6,25% no mostraron amplificacion. Por su parte, GEBHARDT & WAITS (2008) encontraron que en faisanes de cuello dorado con los iniciadores P2-P8 el 38,5% de las muestran no amplificaron, y sugieren, al igual que GRANT (2001), que la baja amplificacion puede correlacionarse con una menor cantidad y calidad del ADN presente en las muestras, o a una PCR con condiciones suboptimas. Se debe tener en cuenta que el grado de error puede variar segun las especies y que existen iniciadores que resultan mas exitosos para algunas de ellas; tambien puede ocurrir por el polimorfismo de algunos individuos (diferencias mutacionales en los sitios del cebador), tal como lo reportan GEBHARDT & WAITS (2008), lo que puede contrarrestarse en parte, con la busqueda y uso de iniciadores mas conservados y universales.

Finalmente, aunque la familia Furnariidae es una de las de mayor riqueza de especies en el Neotropico (REMSEN, 2003), son pocos los estudios que han tratado de resolver la identidad sexual de sus especies, y los que se han realizado se han enfocado en comparaciones morfometricas y del plumaje de machos y hembras (WILLIS, 1972; WINKER et al., 1994; REMSEN, 2003; ROPER & HUTSON, 2003; FARIA et al., 2007; MORENO et al., 2007; CARDONI et al., 2009), y muy pocos han abordado la tipificacion molecular (FARIA et al., 2007; MORENO et al., 2007; CARDONI et al., 2009). Estos factores, han limitado la investigacion en este grupo, especialmente en temas relacionados con dinamica poblacional, seleccion sexual, conflicto de sexos y comportamiento reproductivo (i.e. cuidado parental), todos ellos claves para apreciar la evolucion y conservacion de esta gran familia. El sexaje molecular de 7 especies de furnaridos en las cuales se logro una clara diferenciacion entre machos y hembras (Tabla 1), se convierte en una herramienta basica para su estudio, especialmente en Colombia, que alberga la mayor riqueza de especies de esta familia.

AGRADECIMIENTOS

A la Vicerrectoria de Investigaciones y Postgrados de la Universidad de Caldas, por la financiacion de este proyecto. A Carlos Arturo Franco, lider Gestion Ambiental de la Central Hidroelectrica de Caldas S.A. E.S.P. A Jose Humberto Gallego, Director del Jardin Botanico Universidad de Caldas, y a Yohany Lopez, coordinador Ecoparque Alcazares-Arenillo. A Carmen Dussan Lubert, Juan Alejandro Morales y Jhon Albert Guevara, por su asesoria en el desarrollo del proyecto.

BIBLIOGRAFIA

ANCIAES, M. & NASSIF, S., 2002.- Sex identification of pin-tailed manakins (Ilicura militaris: Pipridae) using the polymerase chain reaction and its application to behavioral studies. Ornitologia Neotropical, 13: 159-165.

ARANGO-B., L., MONTES-R., J.M., LOPEZ-P., D.A. & LOPEZ-P., J.O., 2007.- Mariposas (Lepidoptera: Papilionoidea, Hesperoidea), escarabajos coprofagos (Coleoptera: Scarabaeinae) y hormigas (Hymenoptera: Formicidae) del Ecoparque Alcazares-Arenillo (Manizales, Caldas -- Colombia). Bol. Cient. Mus. Hist. Nat. U. de Caldas, 11(1): 390-409.

BELLO, N., FRANCINO, O. & SANCHEZ, A., 2001.- Isolation of genomic DNA from feathers. Journal of Veterinary diagnostic investigation, 13: 162-164.

CAMPOS, F., GUTIERREZ, F., LOPEZ, J. & HERNANDEZ, M., 2005.- Un nuevo criterio para sexar Mirlos Acuaticos Cinclus cinclus en la Peninsula Iberica. Revista Catalana de Ornitologia, 21: 43-46.

CAPARROZ, R., ROBADO, N., BIANCHI, C. & WAYNTAL, A., 2001.- Analysis of the genetic variability and breeding behaviour of wild populations of two macaw species (Psittaciformes, Aves) by DNA fingerprinting. Ararajuba, 9 (1): 43-49.

CARDONI, D.J., MALDONADO, J. & ISACCJ, R.G., 2009.- Subtle sexual dimorphism in the bay-capped wren spinetail (Spartonoica maluroides; Furnariidae) uncovered through molecular sex determination. Ornitologia Neotropical, 20: 347-355.

CASTANO, G.J., 2004.- Evaluacion del riesgo de extincion de aves en habitats fragmentados a largo plazo mediante el analisis de sus caracteristicas ecologicas: Tesis Maestria, Universidad Nacional de Colombia, Sede Medellin.

CASTANO, G.J. & PATINO, J.C., 2007.- Composicion de la comunidad de aves en bosques fragmentados en la region de Santa Elena. Bol. Cient. Mus. Hist. Nat. U. de Caldas, 11: 47-60.

--., 2008.- Extinciones locales de aves en fragmentos de bosque en la region de Santa Elena, Andes Centrales, Colombia. El Hornero, 23 (1): 23-34.

CONSTANTINI, V., GUARICCI, A.C., LARICCHIUTA, P., RAUSA, F. & LACALANDRA, G.M., 2008.- DNA sexing in Humboldt Penguins (Spheniscus humboldti) from feather samples. Animal Reproduction Science, 106: 162-167.

DE VOLO, S.B., REYNOLDS, R., DOUGLAS, M.R. & ANTOLIN, M.F., 2008.- An improved extraction method to increase DNA yield from molted feathers. The Condor, 110 (4): 762-767.

DONOHUE, K. & DUFTY, A., 2006.- Sex determination of Red-tailed Hawks (Buteo jamaicensis calurus) using DNA analysis and morphometrics. Journal of Field Ornithology, 77 (1): 74-79.

DOUBLE, M. & OLSEN, P., 1997.- Simplified polymerase chain reaction (PCR)-based sexing assists conservation of an endangered owl, the Norfolk Island Boobook Ninox novaeseelandiae undulate. Bird Conservation International, 7: 283-286.

FARIA, L., CARRARA, L. & RODRIGUEZ, M., 2007.- Dimorfismo sexual de tamano no fura-barreira Hylocryptus rectirostris (Wied) (Aves, Furnariidae). Revista Brasileira de Zoologia, 24 (1): 207-212.

FJELDSA, J. & KRABBE, N., 1990.- Birds of the high Andes. Apollo Books y Zoological Museum, Svendborg y Copenhagen.

FRIDOLFSSON, A.K. & ELLEGREN, H., 1999.- A simple and universal method for molecular sexing of non ratite birds. Journal of Avian Biology, 30: 116-121.

GALLEGO, J., 2000.- Guia de especies cultivadas en el Jardin Botanico Universidad de Caldas.

GEBHARDT, K.J. & WAITS, L.P., 2008.- High error rates for avian molecular sex identification primer sets applied to molted feathers. Journal of Field Ornithology, 79 (3): 286-292.

GRANT, A., 2001.- DNA sexing of brown kiwi (Apteryx mantelli) from feather samples. DOC Science Internal Series, 13: 5-16.

GRIFFITHS, R., DOUBLE, M., ORR, K. & DAWSON, R., 1998.- A DNA test to sex most birds. Molecular Ecology, 7: 1071-1075.

GRIFFITHS, R. & KORN, R., 1997.- A CHD1 gene Z chromosome linked in the chicken (Gallus domesticus). Gene, 197: 225-229.

HARVEY, M.G., BOTER, D.N., STENZLER, L.M. & LOVETTE, I.J., 2006.- A comparison of plucked feathers versus blood samples as DNA sources for molecular sexing. Journal of Field Ornithology, 77 (2): 136-140.

HEIMERDINGER, M., 1995.- Body pterylosis of woodcreepers and ovenbirds (Dendrocolaptidae and Furnariidae). The Auk, 112 (3): 800-804.

JENSEN, T.F., PERNASETTI, F. & DURRANT, B., 2003.- Conditions for rapid sex determination in 47 avian species by PCR of genomic DNA from blood, shell-membrane blood vessels, and feathers. Zoo Biology, 22: 561-571.

KATTAN, G., ALVAREZ-LOPEZ, H. & GIRALDO, M., 1994.- Forest fragmentation and bird extinctions: San Antonio eighty years later. Conservation Biology, 8: 138-146.

LIZA, J., MATURRANO, L. & ROSADIO, R., 2008.- Determinacion del sexo por ADN en cinco especies de guacamayos. Revista de Investigaciones veterinarias de Peru, 19 (1): 31-36.

MATTA, N., RAMIREZ, N., ZUNIGA, B. & VERA, V., 2008.- Determinacion de sexo en aves mediante herramientas moleculares. Acta Biologica Colombiana, 13 (3): 27-40.

MEZQUIDA, E., 2001.- La reproduccion de algunas especies de Dendrocolaptidae y Furnariidae en el desierto del monte central, Argentina. Hornero, 16 (1): 23-30.

MORENO, J., MERINO, S., LOBATO, E., RODRIGUEZ, M. & VASQUEZ, R., 2007.- Sexual dimorphism and parental roles in the thorn-tailed rayadito (Furnariidae). The Condor, 109: 313-120.

PALMA, L., MIRA, S., CARDIA, P., BEJA, P., GUILLEMAUD, T., FERRAND, N., CANCELA, M.L. & CANCELA DA

FONSECA, L., 2001.- Sexing Bonelli's Eagle nestlings: morphometrics versus molecular techniques. Journal of Raptor Research, 35 (3): 187-193.

REMSEN, J.V., 2003.- Family Furnariidae (Ovenbirds): 162-357 (en) DEL HOYO, J., ELLIOT, A., CHRISTIE, D.A. (eds.) Handbook of the Birds of the World. Vol. 8. Broadbills to Tapaculos. Lynx Ediciones, Barcelona.

REMSEN, J.V.JR., CADENA, C.D., JARAMILLO, A., NORES, M., PACHECO, J.F., PEREZ-EMAN, J., ROBBINS, M.B., STILES, F.G., STOTZ, D.F. & ZIMMER, K.J., 2011.- A classification of the bird species of South America. American Ornithologists' Union. Disponible en: http://www.museum.lsu.edu/~Remsen/ SACCBaseline.html

RENJIFO, L.M., 1999.- Composition changes in a subandean avifauna after long-term forest fragmentation. Conservation Biology, 13: 1124-1139.

RENJIFO, L.M., FRANCO-MAYA, A.M., AMAYA-ESPINEL, J.D., KATTAN, G.H. & LOPEZ-LANUS, B. (eds.)., 2002.- Libro rojo de aves de Colombia. Serie Libros Rojos de Especies Amenazadas de Colombia. Instituto de Investigacion de Recursos Biologicos Alexander von Humboldt y Ministerio del Medio Ambiente. Bogota, Colombia. 554p.

RIDGELY, R.S. & TUDOR, G., 1994.- The birds of South America. Vol. 2. University of Texas Press, Austin.

ROPER, J.J. & HUTSON, A., 2003.- Ovenbirds: 438-441 (en) PERRIS, C.M. (ed.) The new encyclopedia of birds. Oxford University Press, Oxford.

RYDER, T. & DUARAES, R., 2005.- It's not easy being green: using molt and morphological criteria to age and sex greenplumage Manakins (Aves: Pipridae). Ornitologia Neotropical, 16: 481-491.

SALAZAR-RAMIREZ, L., 2010.- Estratificacion vertical de aves frugivoras y nectarivoras en plantaciones de aliso y bosque secundario: Trabajo de grado, Universidad de Caldas, Manizales, Caldas, Colombia. 34p.

SANGUINETTI, C.J., DIAS NETO, E. & SIMPSON, A.J., 1994.- Rapid silver straining and recovery of PCR products separated on polyacrylamide gels. Biotechniques, 17: 915-919.

SILVEIRA, P., BASTOS, E., MANNAN, R.W. & GUEDES-PINTO, H., 2009.- Polymerase chain reaction-single trand conformation polymorphism applied to sex identification of Accipiter cooperii. Molecular and Cellular Probes, 23: 115-118.

SKUTCH, A., 1969.- Families Cotingidae, Pipridae, Formicaridae, Furnariidae, Dendrocolaptidae and Picidae. Life histories of Central American Birds III. Berkeley, California. 580p.

WATSON, H.K., MOGG, R.J. & BOND, J.M., 2004.- Sexing Eurasian Oystercatchers Haematopus ostralegus from breast feathers collected when ringing. Wader Study Group Bulletin, 105: 87-89.

WILLIS, E.O., 1972.- The behavior of plain-brown woodcreepers, Dendrocincla fuliginosa. The Wilson Bulletin, 84 (4): 377-420.

--., 1991.- The Ovenbirds: 162-163 (en) FORSHAW, Joseph (ed.) Encyclopedia of Animals: Birds. Merehurst Press, London.

WINKER, K., VOELKER, G.A. & KLICKA, J.T., 1994.- A morphometric examination of sexual dimorphism in the Hylophilus, Xenops, and an Automolus from southern Veracruz, Mexico. Journal of Field Ornithology, 65 (3): 307-323.

Daniel Moreno Lopez (1), Beatriz Eugenia Henao Bustamante (1), German Ariel Lopez Gartner (1), Gabriel Jaime Castano-Villa (2) y Fredy Arvey Rivera Paez (1)

* FR: 10-III-2011. FA: 24-VIII-2011.

(1) Grupo de Investigacion Genetica, Biodiversidad y Fitomejoramiento, GEBIOME. Departamento de Ciencias Biologicas, Facultad de Ciencias exactas y Naturales, universidad de Caldas. e-mail: dmoreno86@hotmail.com; beatrizhenao17@gmail.com; german.lopez@ucaldas.edu.co; fredy.rivera@ucaldas.edu.co

(2) Grupo de Investigacion ecosistemas Tropicales, universidad de Caldas. e-mail: gabriel.castano_v@ucaldas.edu.co
Tabla 1. Furnaridos sexados molecularmente con amplificacion positiva
por PCR de los genes CHD-Z y CHD-W, usando dos iniciadores y Gallus
gallus como control positivo. Tamano del fragmento amplificado en pb.

Taxon                  #        Amplificaciones
                   Individuos   positivas (PCR)

Furnariinae

Synallaxis             14              9
azarae

Synallaxis             5               4
brachyura

Xenops minutus         2               2

Dendrocolaptinae

Dendrocincla           2               2
tyrannina

Lepidocolaptes         3               3
lacrymiger

Campylorhampus         3               3
trochilirostris

Campylorhampus         2               2
pusillus

Gallus gallus          --             --

Taxon                  Sexo               Iniciadores

                                     P2-P8     2550F-2718R

Furnariinae

Synallaxis         [masculinidad]      380          750
azarae              [feminidad]      380-410      750-800

Synallaxis         [masculinidad]       --          700
brachyura           [feminidad]         --        680-700

Xenops minutus     [masculinidad]      380          --
                    [feminidad]      380-410        --
Dendrocolaptinae

Dendrocincla       [masculinidad]       --          700
tyrannina           [feminidad]      380-410        --

Lepidocolaptes     [masculinidad]      380          750
lacrymiger          [feminidad]      380-410      700-750

Campylorhampus     [masculinidad]      380          --
trochilirostris     [feminidad]      380-410        --

Campylorhampus     [masculinidad]      380          --
pusillus            [feminidad]      380-410      700-750

Gallus gallus      [masculinidad]      380          700
                    [feminidad]      380-400      550-700
COPYRIGHT 2011 Universidad de Caldas
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Moreno Lopez, Daniel; Henao Bustamante, Beatriz Eugenia; Lopez Gartner, German Ariel; Castano-Villa,
Publication:Boletin Cientifico Centro De Museos De Historia Natural
Article Type:Report
Date:Jul 1, 2011
Words:3839
Previous Article:Presentacion.
Next Article:Historia de las especies de mamiferos exoticos en Colombia.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters