Printer Friendly

Detection of spotted fever group Rickettsiae in birds and ticks in Tennessee.

Abstract--Rocky Mountain spotted fever is a tick-borne disease caused by the bacterial pathogen Rickettsia rickettsii (Brumpt). Other spotted fever group rickettsiae also have been linked to febrile rash illnesses. The American dog tick, Dermacentor variabilis (Say), is the primary vector responsible for transmission of R. rickettsii in Tennessee. This study evaluated D. variabilis collected from middle Tennessee for evidence of Rickettsia spp. DNA. Additionally, blood from migratory waterfowl and wild turkeys was tested for Rickettsia spp. because studies in Europe have suggested that birds contribute to the spread of Rickettsia spp. DNA was extracted from 73 pooled ticks (2 adult ticks/pool) and 315 bird blood samples. Ticks evaluated in this study were not associated with the birds. Following primary and nested amplification, positive samples were cloned and sequenced. Three samples from migratory birds (0.9% of all bird samples) were amplified using primers specific for the rickettsial ompA gene, although no distinct Rickettsia species could be identified. Ten tick pools (Minimum Infection Rate of 6.8%) were positive for Rickettsia montanensis (Bell, Kohls, Stoenner and Lackman), a spotted fever group rickettsial organism. These results demonstrate that Rickettsia spp. are present in D. variabilis in middle Tennessee and suggest that birds may have a role in the dissemination of some rickettsial species. Spotted fever group rickettsiae, including R. montanensis, may represent emerging pathogens that could contribute to the epidemiology of Rocky Mountain spotted fever.

Introduction

Rocky Mountain spotted fever (RMSF) is the most common tick-borne rickettsial disease in the United States. The disease is caused by the obligate intracellular bacterial pathogen Rickettsia rickettsii (Brumpt). There are four species groups in Rickettsia: the spotted fever group (SFG), the typhus group, the ancestral group, and the transitional group (Wood and Artsob, 2012). The SFG consists of approximately 20 different rickettsial species. Other SFG rickettsia spp. may be associated with pathogenic outcomes following human infection including R. parkeri (Paddock et al., 2004) and R. amblyommii (Fritzen et ah, 2011).

The incidence of RMSF has been increasing; from 2005-2007, over 2000 cases were reported. Five states were responsible for 64% of RMSF cases: North Carolina, Oklahoma, Arkansas, Tennessee, and Missouri (Openshaw et ah, 2010). Southwestern Tennessee was identified as a geographic region with one of the highest rates of fatalities and hospitalizations with complications (Adjemian et al., 2009).

Rocky Mountain spotted fever manifests with early, nonspecific flu-like symptoms. The characteristic spotted rash usually appears within 4-5 days of infection. The rash is the result of infected endothelial cells leaking and eventually bursting, releasing blood into extravascular spaces. An estimated 20% of untreated infections may be fatal; however, prompt administration of doxycycline decreases the mortality rate to approximately 5% (Adjemian et al., 2009). The primary vector responsible for transmitting R. rickettsii is the American dog tick, Dermacentor variabilis (Say). This tick species is widely distributed in Tennessee.

Passerine birds have been documented as contributing to the dispersal of tick-borne diseases in Europe (Elfvig et al., 2010; Palomar et al., 2012). Through migration, birds have the potential to transport infected ticks or transfer Rickettsia spp. in infected blood. A study in Slovakia reported Rickettsia spp. in both birds as well as in ticks attached to infected birds (Berthova et al., 2015).

This study was undertaken to evaluate D. variabilis ticks and blood from migratory birds and non-migratory wild turkeys from west and middle Tennessee for the presence of Rickettsia species. While the ticks were not directly associated with the birds, this survey of birds was conducted to determine if they may have been exposed to rickettsial agents in similar regions in Tennessee. A total of 315 avian blood samples and 73 pooled tick samples were tested by PCR for Rickettsia spp. DNA.

Materials and Methods

Sample collection--Avian blood and ticks were collected as part of an earlier study investigating the presence of Lyme disease or southern tick-associated rash illness attributed to Borrelia organisms (Jordan et al., 2009). With the increasing incidence of RMSF, it was decided to reinvestigate some of those samples for evidence of Rickettsia spp. Blood collections from wild turkeys and waterfowl were done over three hunting seasons, 2003-2006. Blood was obtained from 176 wild turkeys (Meleagris gallopavo silvestris) at Tennessee Wildlife Resources Agency check stations and live-captured birds in middle Tennessee. Counties of collection included DeKalb, Dickson, Jackson, Macon, Montgomery, Robertson, Rutherford, Smith, Stewart, White and Wilson. Blood from 139 migratory waterfowl was provided by hunters. The waterfowl included American black duck (Anas rubripes), Canada goose (Branta canadensis), mallard (Anas pkityhynchos), and wood duck (Aix sponsa). These birds were harvested from Bedford, Chester, Coffee, Dyer, Giles and Rutherford counties. DNA was extracted and purified using the IBI Genome DNA Frozen Blood kit (Peosta, Iowa). Extracts were stored at -20[degrees]C until amplification.

Ticks were collected during summer months from 2004-2005 by dragging or from C[O.sub.2] traps as described by Sonenshine (1993). Counties of collection included Montgomery, Robertson, Rutherford and Stewart. Only collected adults of Dermacentor variabilis were used in this study. A total of 146 ticks were pooled in groups of two, resulting in 73 pools. Ticks were only pooled if they were obtained from the same collection site. The Minimum Infection Rate (MIR) was determined by dividing the number of positive pools by the total number of individuals as described by Bacon et al., 2005. Ticks were stored in 70% ethanol. For extraction of DNA, ticks were cut in half to ensure access to gut contents, and the DNA was purified using the ZR Tissue and Insect DNA Mini Prep kit (Zymo Research Corp., Irvine, CA).

DNA amplification and electrophoresis--Both bird blood and tick extracts underwent two rounds of amplification by PCR. Primary PCR products were amplified using nested primers to provide greater specificity. The primer sequences, specific for part of the ompA gene, are shown in Table 1. Sterile deionized [H.sub.2]O controls were included in each amplification set. Nested PCR products were visualized under ultraviolet illumination on a 1% agarose gel stained with ethidium bromide.

Cloning and sequencing--Samples that produced a band at approximately 240 bp, the predicted fragment size using the nested primers, were ligated into pGEM-T vectors and transformed into E. coli. Plasmid sequencing was done on an Applied Biosystems sequencer using bidirectional sequencing primers T7 and Sp6. Sequence identity was evaluated by nucleotide BLAST in the GenBank database.

Results

None of the blood samples collected from wild turkeys were positive for Rickettsia spp. DNA. For the samples obtained from migrating waterfowl, 3 of 139 (2.2%) generated bands of what appeared to be approximately 240 bp on a gel. The positive samples were from a mallard from Rutherford county, a wood duck from Rutherford county, and a mallard from Chester county.

Sequence analysis determined that the actual fragment size was 207 bp, and all three fragments were identical. The sequences obtained from the waterfowl did not demonstrate identity with any sequence in the GenBank database. There was only 63% sequence identity between the waterfowl sequences and the sequences obtained from American dog ticks. It could be that the sequences from birds may not even be rickettsial.

Ten of the 73 pooled tick samples demonstrated a band that equated to 240 bp (Fig. 1). Of these, all samples were at least 99% homologous to R. montanensis (Bell, Kohls, Stoenner and Lackman) when compared with GenBank sequences. Of the 10 positive samples, one was completely homologous with R. montanensis (GenBank Accession number AY543681), eight differed at a single nucleotide, and one tick sequence had 2 mismatched bases. Counties of positive tick pools are listed in Table 2. The overall MIR was determined to be 6.8%.

Discussion

The relatively high number of RMSF cases reported in the southeastern US--including Tennessee--suggests that the causative bacterium R. rickettsii would be detected. However, there was no evidence of R. rickettsii in any of our samples. Other studies conducted in Tennessee, Kentucky, and North Carolina also have failed to detect any R. rickettsii among any ticks (Moncayo et al., 2010; Smith et al., 2010; Pagac et al., 2014). It should be pointed out that absence of detection does not equate to the absence of occurrence. A larger number of ticks would need to be sampled before drawing conclusions regarding the incidence of R. rickettsii.

The rickettsial organism detected in ticks in this study, R. montanensis, is part of the SFG rickettsiae. The sequence most closely related to the sequences found in ticks in this study was obtained from D. variabilis isolated in Maryland (Ammerman et al., 2004). In the current study, 10 of 73 pools were positive for R. montanensis, giving an MIR of 6.8%. Others have reported the presence of R. montanensis in individual D. variabilis ticks, ranging from 3.2% (Stromdahl et al., 2011) to 19.4% (Smith et al., 2010).

Rickettsia montanensis generally is considered to be nonpathogenic. However, one report described an afebrile rash illness in a child in Georgia. The tick, D. variabilis, was available for study following removal from the patient. PCR assay and DNA sequencing revealed 99% homology to R. montanensis (McQuiston et al., 2012).

The lack of detection of recognized Rickettsia spp. among both migratory and non-migratory birds in this study has also been reported in other studies. Cohen et al., 2015, noted that even though 29% of ticks recovered from birds were infected by Rickettsia spp., no avian blood samples were positive. Another study evaluating migratory birds for SFG rickettsiae reported while most SFG sequences were similar to Rickettsia sp. "Argentina", several samples represented novel sequences (Mukherjee et al., 2014). This same study noted that there was little correlation among ticks, rickettsial DNA, and whether or not the birds were competent reservoir hosts. Moraru et al. reported (2012) that no SFG rickettsiae DNA was found by amplifying blood samples from 47 passerine birds or 31 quail in Mississippi. It has also been reported (Lundgren and Thorpe, 1966) that not all species of birds are able to support R. rickettsii infection, and that may also extend to other SFG rickettsiae. Elfving et al. (2010) suggested that the role of birds may be more important as transporters of infected ticks rather than serving as reservoir hosts.

Several researchers have noted that there is extensive serologic cross-reactivity among the SFG species (Parola et al., 2005; Adjemian et al., 2012). The lack of detection of R. rickettsii in this current study, as well as in several other reports, suggests that other SFG rickettsiae may have a role in reported cases of RMSF (Cohen et al., 2009; Moncayo et al., 2010; McQuiston et al., 2012). In addition, several other possible explanations have been proposed to account for the seemingly low incidence of R. rickettsii detection. Stromdahl et al., 2011, hypothesized that R. rickettsii may be lethal for some of the ticks that become infected. Another report indicated that the presence of multiple rickettsial species may interfere with vertical transmission in ticks (Macaluso et al., 2002). In terms of mammalian hosts, Wood and Artsob (2012) suggest that cross reactivity among Rickettsia spp. may confer protective immunity.

The failure to detect R. rickettsii in this and other studies may warrant re-evaluation of RMSF epidemiology. Rickettsia montanensis and other SFG rickettsiae may represent emerging rickettsial pathogens that have a role in tick-borne illnesses.

Acknowledgments

We thank the Tennessee Wildlife Resources Agency for assistance with wild turkey blood collection at check stations, and M. Travis who coordinated sample collection among hunters. We acknowledge A. Cole for assistance with sequencing. This work was supported, in part, by National Science Foundation Grant 0216716.

Literature Cited

Adjemian, J. Z., J. Krebs, E. Mandel, and J. McQuiston. 2009. Spatial clustering by disease severity among reported Rocky Mountain spotted fever cases in the United States, 2001-2005. American Journal of Tropical Medicine and Hygiene 80:72-77.

Adjemian, J., I. B. Weber, J. McQuiston, K. S. Griffith, P. S. Mead, W. Nicholson, A. Roche, M. Schriefer, M. Fischer, O. Kosoy, J. J. Laven, R. A. Stoddard, A. R. Hoffmaster, T. Smith, D. Bui, P. P. Wilkins, J. L. Jones, P. N. Gupton, C. P. Quinn, N. Messonnier, C. Higgins, and D. Wong. 2012. Zoonotic infections among employees from Great Smoky Mountains and Rocky Mountain national parks, 2008-2009. Vector-Borne and Zoonotic Diseases 12:922-931.

Ammerman, N. C., K. I. Swanson, J. M. Anderson, T. R. Schwartz, E. C. Seaberg, G. E. Glass, and D. E. Norris. 2004. Spotted-fever group Rickettsia in Dermacentor variabilis, Maryland. Emerging Infectious Diseases 10:1478-1481.

Bacon, R. M., M. A. Pilgard, B. J. B. Johnson, J. Piesman, B. J. Biggerstaff, and M. Quintana. 2005. Rapid detection methods and prevalence estimation for Borrelia lonestari glpQ in Amblyomma americanum (Acari: Ixodidae) pools of unequal size. Vector-Borne and Zoonotic Diseases 5:146-156.

Berthova, L., V. Slobodnik, R. Slobdnik, M. Oleksak, Z. Sekeyova, Z. Svitalkova, M. Kazimirova, and E. Spitalska. 2015. The natural infection of birds and ticks feeding on birds with Rickettsia spp. and Coxiella burnetii in Slovakia. Experimental and Applied Acarology. Epub ahead of print. DOI 10.1007/s10493-015-9975-3

Cohen, E. B., L. D. Auckland, P. P. Marra, and S. A. Hamer. 2015. Avian migrants facilitate invasions of neotropical ticks and tick-borne pathogens into the United States. Applied and Environmental Microbiology 81:8366-8378.

Cohen, S. B., M. J. Yabsley, L. E. Garrison, J. D. Freye, B. G. Dunlap, J. R. Dunn, D. G. Mead, T. F. Jones, and A. C. Moncayo. 2009. Rickettsia parkeri in Amblyomma americanum ticks, Tennessee and Georgia, USA. Emerging Infectious Diseases 15:1471-1473.

Elfving, K., B. Olsen, S. Bergstrom, J. Waldenstrom, A. Lundkvist, A. Sjostedt, H. Mejlon, and K. Nilsson. 2010. Dissemination of spotted fever rickettsia agents in Europe by migrating birds. PLoS ONE 5:e8572.

Fritzen, C. M., J. Huang, K. Westby, J. D. Freye, B. Dunlap, M. J. Yabsley, M. Schardein, J. R. Dunn, T. F. Jones, and A. C. Moncayo. 2011. Infection prevalences of common tick-borne pathogens in adult lone star ticks (Amblyomma americanum) and American dog ticks (Dermacentor variabilis) in Kentucky. American Journal of Tropical Medicine and Hygiene 85:718-723.

Jordan, B. E., K. R Onks, S. W. Hamilton, S. E. Hayslette, and S. M. Wright. 2009. Detection of Borrelia burgdorferi and Borrelia lonestari in birds in Tennessee. Journal of Medical Entomology 46:131-138.

Lundgren, D. L., and B. D. Thorpe. 1966. Infectious diseases in wild animals in Utah.VII. Experimental infection of rodents with Rickettsia rickettsii. American Journal of Tropical Medicine and Hygiene 15:799-806.

Macaluso, K. R., D. E. Sonenshine, S. M. Ceraul, and A. F. Azad. 2002. Rickettsial infection in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of a second Rickettsia. Journal of Medical Entomology 39:809-813.

McQuiston, J. H., G. Zemtsova, J. Pemiciaro, M. Hutson, J. Singleton, W. L. Nicholson, and M. L. Levin. 2012. Afebrile spotted fever group Rickettsia infection after a bite from a Dermacentor variabilis tick infected with Rickettsia montanensis. Vector- Borne and Zoonotic Diseases 12:1059-1061.

Moncayo, A. C., S. B. Cohen, C. M. Fritzen, E. Huang, M. J. Yabsley, J. D. Freye, B. G. Dunlap, J. Huang, D. G. Mead, T. F. Jones, and J. R. Dunn. 2010. Absence of Rickettsia rickettsii and occurrence of other spotted fever group rickettsiae in ticks from Tennessee. American Journal of Tropical Medicine and Hygiene 83:653-657.

Moraru, G. M., J. Goddard, A. Murphy, D. Link, J. L. Belant, and A. Varela-Stokes. 2012. Evidence of antibodies to spotted fever group rickettsiae in small mammals and quail from Mississippi. Vector-Borne and Zoonotic Diseases 12:1-5.

Mukherjee, N., L. Beati, M. Sellers, L. Burton, S. Adamson, R. G. Robbins, F. Moore, and S. Karim. 2014. Importation of exotic ticks and tick-borne spotted fever group rickettsiae into the United States by migrating songbirds. Ticks and Tick Borne Diseases 5:127-134.

Openshaw, J. J., D. L. Swerdlow, J. W. Krebs, R. C. Holman, E. Mandel, A. Harvey, D. Haberling, R. F. Massung, and J. H. McQuiston. 2010. Rocky Mountain spotted fever in the United States, 2000-2007: Interpreting contemporary increases in incidence. American Journal of Tropical Medicine and Hygiene 83:174-182.

Paddock, C. D., J. W. Sumner, J. A. Comer, S. R. Zaki, C. S. Goldsmith, J. Goddard, S. L. McLellan, C. L. Tamminga, and C. A. Ohl. 2004. Rickettsia parkeri: a newly recognized cause of spotted fever rickettsiosis in the United States. Clinical Infectious Diseases 38:805-811.

Pagac, B. B., M. K. Miller, M. C. Mazzei, D. H. Nielsen, J. Jiang, and A. L. Richards. 2014. Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA. Emerging Infectious Diseases 20:1750-1752.

Palomar, A. M., P. Santibanez, D. Mazuelas, L. Roncero, S. Santibanez, A. Portillo, and J. A. Oteo. 2012. Role of birds in dispersal of etiologic agents of tick-borne zoonoses, Spain, 2009. Emerging Infectious Diseases 18:1188-1191.

Parola, P., C. D. Paddock, and D. Raoult. 2005. Tick-borne rickettsioses around the world: Emerging diseases challenging old concepts. Clinical Microbiology Reviews 18:719-756.

Regnery, R. L., C. L. Spruill, and B. D. Plikaytis. 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. Journal of Bacteriology 173:1576-1589.

Smith, M. P., L. Ponnusamy, J. Jiang, L. A. Ayyash, A. L. Richards, and C. S. Apperson. 2010. Bacterial pathogens in Ixodid ticks from a Piedmont County in North Carolina: Prevalence of rickettsial organisms Vector-Borne and Zoonotic Diseases 10:939-952.

Sonenshine, D. E. 1993. Biology of ticks, vol 2. Oxford University Press, New York.

Stromdahl, E. Y., J. Jiang, M. Vince, and A. L. Richards. 2011. Infrequency of Rickettsia rickettsii in Dermacentor variabilis removed from humans, with comments on the role of other human-biting ticks associated with spotted fever group rickettsiae in the United States. Vector-Borne and Zoonotic Diseases 11:969-977.

Wood, H., and H. Artsob. 2012. Spotted fever group rickettsiae: a brief review and a Canadian perspective. Zoonoses and Public Health 59:65-79.

Manuscript received 7 August 2015; Manuscript accepted 19 February 2016.

J.A. Hamilton, E.R. Scott, S.W. Hamilton, S.E. Hayslette, and S.M. Wright *

Biomedical Sciences, University of Alabama, Birmingham, AL 35294 (JAH)

Department of Biology, Middle Tennessee State University, Murfreesboro, TN 37132 (ERS, SMW)

Center of Excellence for Field Biology, Austin Peay State University, Clarksville, TN 37044 (SWH)

Department of Biology, Tennessee Technological University, Cookeville, TN 38505 (SEH)

* Corresponding Author

TABLE 1. Sequences of primers used for amplification of
rickettsial ompA.

                                         Fragment
Primer name       Primer sequence          size     Primer source

Rr190.70p     5' ATGGCGAATATTTCTCCAAAA     532      Regnery, 1991
Rr190.602n    5' AGTGCAGCATTCGCTCCCCCT              Regnery, 1991
NestFor       5' TAGCGGGGCACTCGGTGTTG      240      This study
NestRev       5' AGACCTACGGGACTAGTACC               This study

TABLE 2. Counties of collection of positive American
dog tick samples and Minimum Infection Rate.

              Ticks    Pools     Pools     Infection
County        tested   tested   positive     Rate

Montgomery      32       16         1         3.1
Robertson       38       19         2         5.3
Rutherford      26       13         2         7.7
Stewart         50       25         5        10.0
Totals         146       73        10         6.8


----------

Please note: Some tables or figures were omitted from this article.
COPYRIGHT 2016 Tennessee Academy of Science
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2016 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Hamilton, J.A.; Scott, E.R.; Hamilton, S.W.; Hayslette, S.E.; Wright, S.M.
Publication:Journal of the Tennessee Academy of Science
Article Type:Report
Geographic Code:1USA
Date:Jun 1, 2016
Words:3144
Previous Article:First reported occurrence of the invasive land snail Euglandia rosea in Tennessee: implications for global warming.
Next Article:Tennessee Academy of Science section chairpersons--2016.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters