Printer Friendly

Detection of loss of heterozygosity by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry-based analysis of single-nucleotide polymorphisms.

A variety of genetic alterations are associated with the initial steps of carcinogenesis in sporadic tumors. Inactivation of tumor suppressor genes frequently occurs in a sequential process of genomic deletion of one allele and missense or nonsense mutation of the other allele in somatic cells (1). Cytogenetically undetectable deletions can be identified at the molecular level as loss of heterozygosity (LOH). Comparative genotyping of polymorphic markers such as microsatellites or single-nucleotide polymorphisms (SNPs) in healthy and tumor tissue can detect the loss of one allele by demonstrating the conversion of a heterozygous marker to a hemizygous genotype. LOH analysis of solid tumors does not necessarily show 100% deletion of one allele, as blood and immune cells without LOH may contaminate the tumor. Therefore, LOH analysis often shows a reduction, rather than a complete disappearance, of one allele.

Genotyping of polymorphic markers has been performed predominantly by gel-based methods, using microsatellites or short tandem repeats. Because of the repetitive nature of these polymorphic structures, PCR amplification often leads to so-called "shadow bands" resulting from DNA polymerase slippage. Shadow bands may overlap with major polymorphic bands and are frequently sources of genotyping ambiguities, particularly in the case of apparent incomplete deletion of one allele (2).

Breast cancer is the most common malignancy of women, with up to 95% of cases sporadic (3). Cytogenetic investigations and microsatellite LOH analysis have revealed deletions in the terminal part of Xp in breast carcinoma (4, 5). On the basis of analysis of 13 SNPs within the genomic region of the potential tumor suppressor gene PPP2R3B, located in the terminal band Xp22.3 (6, 7), we established a matrix-assisted laser desorption/ ionization time-of-flight mass spectrometry (MALDI-TOFMS) approach to analyze LOH in nonmicrodissected tissue.

Comparative sequencing of PCR-amplified fragments in tumor and healthy tissue revealed reduced allelic signals in tumor tissue in 3 of 29 patients, whereas in healthy tissue, sequencing signals of both alleles were within 20% of each other (Fig. 1 in the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/vol51/issue3/). All three (patients 2, 5, and 20) showed loss of several heterozygous markers, indicating that true genomic deletion had occurred.

This study was approved by the Ethics Committee of the University Erlangen-Nurnberg for the Department of Gynaecology and Obstetrics, and informed consent was obtained from all participating patients. We used proteinase K digestion and standard protocols to extract DNA from frozen samples of histologically separated tumor and the surrounding healthy tissue of breast cancer patients treated at the Department of Gynecology. PCR reactions (50 [micro]L) contained 25 pmol of each primer (PPPIE2for, 5'-GACTCTTCAGGTTCAGACACGG-3'; PPPE2Irev, 5'CACGTACCTTGGCCACCAGG; PPPIE10/11for, 5'-CCGCAGGGAAGATCAG3'; PPPIE12rev, 5'-TCACCCGTCCTCCCAGG3'; PPPI12Cfor, 5'-ATTCGTGGAGCCGGCGTC3'; PPPI13Crev, 5'-CAGAGGGTGTCCGTGTGG-3'; all from MWG Biotech), 50 ng of DNA template, 1 U of Taq polymerase in the supplied PCR buffer (Promega) supplemented with 1.5 mM Mg[Cl.sub.2], and 2 nmol of each deoxynucleotide triphosphate. PCR conditions were 96[degrees]C for 2 min; 35 cycles of 96[degrees]C for 30 s, 30 s at 65[degrees]C (exon 2; 210 bp) or 60[degrees]C (exon 11-12; 300 bp), and 72[degrees]C for 30 s; followed by 5 min at 72[degrees]C. Exon 13 (370 bp) was amplified by touchdown PCR with an annealing temperature of 64[degrees]C for 10 cycles and 56[degrees]C for 30 cycles.

Purified PCR products (GenoPure ds; Bruker Daltonics) were used as templates for 10-[micro]L extension reactions containing 1-2 U of Thermosequenase, 1x reaction buffer (Amersham Biosciences), 2 nmol of assay-specific deoxynucleotide triphosphates and dideoxynucleotide triphosphates, and 12 pmol of extension primer. For example, primer PPPE11C40678Tfor (5'-TGAAGCGCTGCAAGCTGGC3') was used with a mixture of dTTP, ddCTP, and ddATP with extension at 58[degrees]C (see Table 1 in the online Data Supplement). Extension reactions were performed at 96[degrees]C for 2 min, followed by 40 cycles at 94[degrees]C for 30 s, 53-62[degrees]C for 30 s, and finally 72[degrees]C for 3 min. We analyzed 1-[micro]L aliquots of purified extension samples (GenoPure oligo; Bruker Daltonics) by MALDITOFMS (Bruker Daltonics) according to the method described by Bonk et al. (8).

[FIGURE 1 OMITTED]

To quantify the loss of a specific allele, we analyzed DNA samples from healthy and corresponding tumor tissue in parallel, using shared master mixtures. We compared the peak-height ratio obtained by MALDITOFMS of the healthy tissue with that of the tumor tissue, as described previously (8), and analyzed the results by use of an unpaired t-test.

All seven DNA fragments showing allelic reduction by sequencing were confirmed by MALDI-TOF-MS. Shown in Fig. 1A are the MALDI-TOF-MS spectra at nucleotide 40678 in exon 11 for samples from patients 2, 20, and 7. Whereas the peak heights in healthy tissue from patients 2 and 20 were very similar, the peak heights for the T allele in tumor tissue were lower. In contrast, samples from patient 7, who did not exhibit LOH, gave similar peak heights for both healthy and tumor tissue.

We analyzed DNA extracted from healthy and tumor breast tissue of five individuals by repeated primary PCR reactions and in up to seven parallel extension reactions to exclude random variation and to assess the reproducibility of LOH measurements. Two patients with LOH (2 and 20) and three patients (7, 10, and 22), characterized by sequencing as lacking LOH, were reanalyzed by MALDITOFMS for SNP C40678T. In the healthy tissue, the ratio of mean peak heights (T/C alleles) ranged between 0.76 and 0.92 but did not differ significantly in patients with (2 and 20) or without (7, 10, and 22) LOH (Table 1).

Analysis of tumor tissue in non-LOH patients (7, 10, and 22) also revealed mean peak ratios in the range of 0.78-0.94 with no significant difference between healthy and tumor tissue (P >0.05). In contrast, patients for whom LOH had been shown by sequencing had significantly different peak ratios in tumor and healthy tissues (Table 1). Repeated analysis of the exon 11 polymorphism in DNA from tumor and nontumor samples from patients 2, 7, 10, 20, and 22 clearly demonstrated that the tumor tissue of patients 2 and 20 had lost significant amounts of the T allele, giving mean peak ratios of 0.20-0.29. No such allelic reduction was observed in patients 7, 10, and 22, for whom signal ratios in tumor and healthy tissue were in the same range (Fig. 1B and Table 1).

In patient 2, signal ratios in tumor tissue for three additional heterozygous markers, located in intron 11 (A40768G and T40788G) and exon 12 (C40907T), were reduced for all SNPs analyzed, indicating that the whole region was deleted in the tumor (Fig. 1C). Similarly, one allele of exon 11, intron 11 (A+B), and exon 12 also was reduced in patient 20.

To characterize the ability of MALDI-TOF-MS to detect LOH, we mixed (in ratios of 1:10, 1:1, and 10:1) two synthetic alleles, oligonucleotides PPPE11tempG (5'-GACGTTGGCCAGCTTGCAGCGCTTCAGG3') and PPPE11tempA (5'-GACGTTAGCCAGCTTGCAGCGCTTCAGG-3'), representing the exon 11 polymorphism C40678T. The signal height ratio was linearly related to the ratio of template DNA variants used in the extension reactions. Whereas the same amount of PPPE11tempG and PPPE11tempA gave a signal ratio of 1.04, diverging ratios of template DNA led to significantly different peak-height ratios. Only marginal differences in signal ratios were detected for multiple samples set up in parallel (Fig. 2 in the online Data Supplement).

Comparative genomic hybridization was developed to identify large sections (10-20 Mbp) of increased or deleted genomic material in tumors. Array comparative genomic hybridization with spotted bacterial artificial chromosomes or with ligation-mediated PCR of bacterial artificial chromosomes can narrow the intervals for reliable copy number measurements to ~1.4 Mbp (9), whereas the method of multiplex ligation-dependent probe amplification (MLPA) (10) detects mid-size deletions. Use of MLPA in cancer genetics, e.g., for BRCA1, MLH1, and MSH2 analysis (11, 12), allows the detection of deletions or amplification of ~50%. To our knowledge, however, analysis by MLPA of gradual loss of genetic material has not been published.

The identification of known tumor suppressor genes in specific tumors and at specific stages of carcinogenesis has prognostic value (13). Clinical diagnostics require methods for investigation of LOH of a tumor suppressor gene with high reproducibility, accuracy, and potential for automation. MALDI-TOF-MS-based genotyping of genetic heterogeneities (e.g., SNPs, insertions/deletions, microsatellite instabilities, and methylation) offers these features combined with excellent sensitivity [for a review see Ref. (14); also see Refs. (8, 15-19)]. The high sensitivity of MALDI-TOF-MS allows analysis of several genetic alterations in parallel.

Quantification of MALDI-TOF-MS signals requires low background and clear peak separation; therefore, use of deoxynucleotide triphosphates and dideoxynucleotide triphosphates for addition of one or two bases, respectively, producing mass differences of ~300 Da, is a prerequisite for reproducible results. Only two enzymatic reactions are necessary in the described method, in contrast to chip-based technologies (20-23), which require several modifications and/or hybridizations that may potentially alter the quantitative results. SNP-mapping array analysis detects the loss or addition of genetic material in cell lines (21, 22) but was verified just once in tumor tissue, and then without a discussion of homogeneity of tumor samples and gradual loss of genetic material (23).

In this report we show that semiquantitative MALDITOFMS-based analysis of heterozygous SNPs is useful to confine (i.e., confirm alterations and investigate which of several genes in a region may be the disease-causing gene) genomic alterations at the gene level. This may lead directly to the identification of tumor suppressor genes or can be used as a prognostic and diagnostic tool to characterize known tumor suppressor genes.

We thank Dr. J. Brill for helpful discussions during manuscript preparation; S. Beck, B. Orlicz-Welcz, and P. Wenzeler for technical assistance; all of the patients who allowed the investigation; and the Department of Gynecology and Obstetrics, University Erlangen-Nurnberg (Prof. M. Beckmann) for providing the tissue samples. We are grateful to Dr. Markus Kostrzewa and Bruker Daltonik GmbH for helpful discussions and for providing the MALDI-TOF mass spectrometer. This work was supported by grants from Deutsche Forschungsgemeinschaft (DFG Schi 451/5-1), German-Israeli Foundation for Scientific Research & Development, and Marohn Stiftung, Erlangen.

References

(1.) Knudson AG Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 1971;68:820-3.

(2.) Bluteau O, Legoix P, Laurent-Puig P, Zucman-Rossi J. PCR-based genotyping can generate artifacts in LOH analyses. Biotechniques 1999;27:1100-2.

(3.) Mincey BA. Genetics and the management of women at high risk for breast cancer. Oncologist 2003;8:466-73.

(4.) Loupart ML, Adams S, Armour JA, Walker R, Brammar W, Varley J. Loss of heterozygosity on the X chromosome in human breast cancer. Genes Chromosomes Cancer 1995;13:229-38.

(5.) Roncuzzi L, Brognara I, Cocchi S, Zoli W, Gasperi-Campani A. Loss of heterozygosity at pseudoautosomal regions in human breast cancer and association with negative hormonal phenotype. Cancer Genet Cytogenet 2002;135:173-6.

(6.) Yan Z, Fedorov SA, Mumby MC, Williams RS. PR48, a novel regulatory subunit of protein phosphatase 2A, interacts with Cdc6 and modulates DNA replication in human cells. Mol Cell Biol 2000;20:1021-9.

(7.) Schiebel K, Meder J, Rump A, Rosenthal A, Winkelmann M, Fischer C, et al. Elevated DNA sequence diversity in the genomic region of the phosphatase PPP2R3L gene in the human pseudoautosomal region. Cytogenet Cell Genet 2000;91:224-30.

(8.) Bonk T, Humeny A, Gebert J, Sutter C, von Knebel Doeberitz M, Becker CM. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometrybased detection of microsatellite instabilities in coding DNA sequences: a novel approach to identify DNA-mismatch repair-deficient cancer cells. Clin Chem 2003;49:552-61.

(9.) Albertson DG. Profiling breast cancer by array CGH. Breast Cancer Res Treat 2003;78:289-98.

(10.) Sellner LN, Taylor GR. MLPA and MAPH: new techniques for detection of gene deletions. Hum Mutat 2004;23:413-9.

(11.) Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligationdependent probe amplification. Nucleic Acids Res 2002;30:e57.

(12.) Taylor CF, Charlton RS, Burn J, Sheridan E, Taylor GR. Genomic deletions in MSH2 or MLH1 are a frequent cause of hereditary non-polyposis colorectal cancer: identification of novel and recurrent deletions by MLPA. Hum Mutat 2003;22:428-33.

(13.) Hu TH, Huang CC, Lin PR, Chang HW, Ger LP, Lin YW, et al. Expression and prognostic role of tumor suppressor gene PTEN/MMAC1/TEP1 in hepatocellular carcinoma. Cancer 2003;97:1929-40.

(14.) Tost J, Gut IG. Genotyping single nucleotide polymorphisms by mass spectrometry. Mass Spectrom Rev 2002;21:388-418.

(15.) Humeny A, Bonk T, Berkholz A, Wildt L, Becker CM. Genotyping of thrombotic risk factors by MALDI-TOF mass spectrometry. Clin Biochem 2001;34:531-6.

(16.) Humeny A, Bonk T, Becker K, Jafari-Boroujerdi M, Stephani U, Reuter K, et al. A novel recessive hyperekplexia allele GLRA1 (S231R): genotyping by MALDI-TOF mass spectrometry and functional characterisation as a determinant of cellular glycine receptor trafficking. Eur J Hum Genet 2002;10:188-96.

(17.) Humeny A, Schiebel K, Seeber S, Becker CM. Identification of polymorphisms within the bovine prion protein gene (Prnp) by DNA sequencing and genotyping by MALDI-TOF-MS. Neurogenetics 2002;4:59-60.

(18.) Humeny A, Beck C, Becker CM, Jeltsch A. Detection and analysis of enzymatic DNA methylation of oligonucleotide substrates by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Anal Biochem 2003;313:160-6.

(19.) Bonk T, Humeny A, Sutter C, Gebert J, von Knebel Doeberitz M, Becker CM. Molecular diagnosis of familial adenomatous polyposis (FAP): genotyping of adenomatous polyposis coli (APC) alleles by MALDI-TOF mass spectrometry. Clin Biochem 2002;35:87-92.

(20.) Tang K, Fu DJ, Julien D, Braun A, Cantor CR, Koster H. Chip-based genotyping by mass spectrometry. Proc Natl Acad Sci U S A 1999;96: 10016-20.

(21.) Zhou X, Mok SC, Chen Z, Li Y, Wong DT. Concurrent analysis of loss of heterozygosity (LOH) and copy number abnormality (CNA) for oral premalignancy progression using the Affymetrix 10K SNP mapping array. Hum Genet 2004.

(22.) Janne PA, Li C, Zhao X, Girard L, Chen TH, Minna J, et al. High-resolution single-nucleotide polymorphism array and clustering analysis of loss of heterozygosity in human lung cancer cell lines. Oncogene 2004;23:2716-26.

(23.) Wong KK, Tsang YT, Shen J, Cheng RS, Chang YM, Man TK, et al. Allelic imbalance analysis by high-density single-nucleotide polymorphic allele (SNP) array with whole genome amplified DNA. Nucleic Acids Res 2004;32:e69.

Andre Reuland, [1] Andreas Humeny, [1] Achim Magener, [2] Cord-Michael Becker, [1] and Katrin Schiebel [1] * ([1] Institut fur Biochemie, Emil-Fischer-Zentrum, and [2] Pathologisch-Anatomisches Institut, Friedrich-Alexander Universitat Erlangen-Nurnberg, Erlangen, Germany; * address correspondence to this author at: Institut fu r Biochemie, EmilFischer-Zentrum, Universitat Erlangen-Nu rnberg, Fahrstrasse 17, D-91054 Erlangen, Germany; fax 49-9131-8522485, e-mail katrin.schiebel@biochem.uni-erlangen.de)
Table 1. Signal height ratios for MALDI-TOF-MS peaks in healthy and
tumor tissue from patients with or without LOH for SNP C40678T.

Patient Tissue Mean (SD)
 signal ratio (a)

 7 Healthy 0.76 (0.12)
 Tumor 0.87 (0.07)
10 Healthy 0.92 (0.10)
 Tumor 0.78 (0.13)
22 Healthy 0.77 (0.12)
 Tumor 0.94 (0.15)
 2 (LOH) Healthy 0.88 (0.14)
 Tumor 0.29 (0.07)
20 (LOH) Healthy 0.88 (0.16)
 Tumor 0.20 (0.04)

(a) Ratio of peak height for T allele to peak height for C allele.
COPYRIGHT 2005 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Reuland, Andre; Humeny, Andreas; Magener, Achim; Becker, Cord-Michael; Schiebel, Katrin
Publication:Clinical Chemistry
Date:Mar 1, 2005
Words:2570
Previous Article:Circulatory corticotropin-releasing hormone mRNA concentrations are increased in women with preterm delivery but not in those who respond to...
Next Article:Techniques for identifying heterophile antibody interference are assay specific: study of seven analytes on two automated immunoassay analyzers.
Topics:


Related Articles
Quantitative synthetic polymer mass spectrometry workshop. (Conference Report).
Broad Partnerships to Enable Maximisation of Opportunities in the Expression Proteomics Sector.
MALDI-TOF mass spectrometry compared with real-time PCR for detection of fetal cell-free DNA in maternal plasma.
Analysis of mass spectrometry profiles of the serum proteome.
Four common mutations of the cystathionine [beta]-synthase gene detected by multiplex PCR and matrix-assisted laser desorption/ionization...
High-level multiplex genotyping of polymorphisms involved in folate or homocysteine metabolism by matrix-assisted laser desorption/ionization mass...
Mass-spectrometric approaches for DNA-based genetic screening.
Detecting CFTR gene mutations by using primer oligo base extension and mass spectrometry.
Mass spectrometry of nucleic acids.
Matrix-assisted laser desorption/ionization mass spectrometric analysis of DNA on microarrays.

Terms of use | Copyright © 2017 Farlex, Inc. | Feedback | For webmasters