Printer Friendly

Detection of H. pylori by PCR method using ureA and ureC gene in gastric biopsy sample.

Nearly hundred years ago a well known anatomist, Bizzozero, reported that the spirochetes inhibit the gastric glands and the canaliculated of the parietal cells. The work of Bizzozero's was further extended by other scientists Salomon and Doengen who discovered the presence of these organisms in the stomach of mouse and other mammals such as rat, cat, dog, monkey, and human. The organisms were referred as gastric spirals due to their morphological characteristics (1). In 1940, Freedberg and Baron found spirochetes like organism in 40% of gastric specimens. In 1950, Fitzgerald and Murphy observed the production of urease in patient with gastric ulceration. Then in the same year the work of Doenges and Freedberg were challenged by Palmer, who investigated 1,000 gastric biopsies taken with a blind suction biopsy instrument but claimed that no bacteria could be seen. In 1967 Susumu Ito of Harvard medical school while observing gastric mucosa under electron microscope observed spirals like organism within a parietal cell gland and publish photograph of one of these organisms (2).

They cultured the positive biopsy samples under a variety of conditions but mainly micro aerobic incubation similar to that used for Campylobacter. However after 48h of incubation, the biopsies were discarded due to the overgrowth of normal flora gastrointestinal tract. The organism was grown because of lucky accident in which the culture were left the incubator for several days over the long Easter holiday and after four to five days transparent colony were observed. The longer than usual incubation resulted in the isolation of an organism and was termed as Campylobacter-like organism. The organism resembled to Campylobacter in several aspects including curved or spiral morphology, growth on enriched media under microaerophilic condition, similar G+C content. It was initially name as Campylobacter pyloridis and then it was corrected to Campylobacter in 1987 (3). Later it was found that the organism does not belong to the genus Campylobacter and thus a new genus was suggested in 1989 (4).

Helicobacter pylori is a non-sporeforming, Gram negative, spiral-shaped, curved rod shaped, or fusiform bacterium with 1 to 3 turns. The spiral wavelength may be varying with age and growth condition. Size ranges from 0.2-1.2 micrometer diameter and 1.5-10 micrometer in length (5).

Electron dense granule bodies have been observed in H. pylori and it these granule are mainly poly phosphate granules, localized to three different regions in the cytoplasm: the cytoplasm, the flagella pole and the associated with the cell membrane and it may serve as source of energy (6). External to the cell wall present a 40nm thick 9 to 11 periplasmic fibers or electron dense glycocalyx or capsule like layer. Helicobacter pylori were motile with a rapid corkscrew like or slower wave like motion due to the presence of bipolar tuft of 10 to 14 sheathed flagella (7). H. pylori is microaerophilic in nature. It requires 5-10% oxygen, and 5 to 10% carbon dioxide for optimum growth in culture medium. H. pylori grow well at a temperature of 30-37[degrees]C all these requirement is fulfill in the gastrointestinal tract of mammals (8).

Glucose is not necessary for growth but its presence enhances cell viability. Certain amino acids like arginine, histidine, isoleucine, leucine, methionine, phenylalanine and valine is necessary for its growth. It is a fastidious organism therefore it does not grow on ordinary laboratory media and nutrient broth, unless growth medium is supplemented with either bovine serum or fetal calf serum, however (2, 6-dimethyl)-Beta-cyclodextrin (CD) also support the growth of H. pylori. Bovine serum, fetal calf serum and CD bind to the toxic metabolite produced by the bacteria which inhibit the growth of bacteria. Although the blood and serum may also contain other growth-stimulating factor required by the bacteria (9,10). H. pylori is considered as the causative agent of gastro duodenal diseases such as chronic gastritis, peptic ulcer, duodenal ulcer, and gastric cancer. Although the gastric mucosal environment do not favor the growth of microorganisms, H. pylori is able to grow in this harsh condition with great adaptability and capacity to colonize the gastric epithelium. In most of the cases this colonization lead to asymptomatic carrier state that persist for longer period of time however in a subset of population (~10%) this colonization lead to pathological conditions (14-15). The urea breath test is a non-invasive and fast mean for the detection of active H. pylori infection. This test is non-quantitative and it determines current infection. The test is based on the principal that the orally administered urea is hydrolyzed by the urease enzyme produced by the H. pylori in large quantity. Urea is hydrolyzed to ammonia and carbon dioxide, which then is absorbed from the stomach and eliminated in the breath. False negative result can arise if there are too few bacteria in the stomach of infected host to produce detectable urease especially during or after a treatment regiment, also in the case of infection with different bacteria that also produce urease. Generally, either [sub.13]C or [sub.14]C is used. The labeled urea is hydrolyzed by the urease enzyme in the stomach of an infected host, and the resulting C[O.sub.2] is absorbed across the gastric mucosa into the blood circulatory system, and then excreted through the lungs as expired air (40). The serological tests are based on the principal that infection with H. pylori induces both local and systemic antibody responses. The systemic response comprises a transient rise in IgM, it is followed by a specific rise in IgA and IgG. The serological test detect specific anti-H. pylori immune response mostly IgG antibodies in serum, whole blood, urine and saliva (42). The circulating antibodies to H. pylori can be detected by enzyme linked immunosorbent assay (ELISA) or western blotting and latex agglutination tests. The serological test has many advantages, it is inexpensive, essentially non-invasive, quick and easy to perform, and little specialized equipment is required. It sensitivity is 91-100% and have specificity 50-90% (43,44). However serum antibody persists even after H. pylori infection is eradicated therefore serological test has limited application in H. pylori eradication (42). This test is based on the principal that the urease enzyme produce by H. pylori hydrolyses urea to ammonia and carbon dioxide, which consequently raise the pH of the medium detected by phenol red indicator (38). The test is performed with gastric biopsy samples. The CLO test and rapid urease test are of similar sensitivity and specificity i.e. 90% and 100% respectively (39). As postulated in Koch's postulates that for every disease some agent is responsible which can be isolated from the patient and reintroduce in susceptible body but unfortunately disease cases with strong clinical evidence of a bacterial etiology are not supported by laboratory isolation and identification of responsible pathogen. So the isolation centered approach has been in question. Thanks to the blessings of new molecular techniques used in microbiology the association of bacteria in disease can be accomplished with out culturing in lab. One of them is PCR.PCR is a rapid, sensitive and accurate method for the specific detection of H. pylori in a variety of clinical specimens. It can detect low number of organism in the sample. The sample used in PCR assay for the detection of H. pylori includes gastric biopsies, saliva, dental plaque and stool. However gastric biopsies are more commonly used due to higher chances of bacterial presence in gastric mucosa.

MATERIALS AND METHODS

The study was based on the PCR evaluated of gastric biopsy samples collected from February 2010 to November 2011. The patients who reported to Medical Unit 1, Civil Hospital Karachi for upper gastro duodenal endoscopy and with the gastroscopic evidence of ulceration or gastritis were included in this study. The most commonly observed symptoms were epigastric pain, nausea, vomiting, heart burn and anemia. (table-6) Antral gastric biopsy samples were obtained from 50 patients with different age groups. Written consents were obtained from each patients and study protocol was approved by local ethical review board.

Collection and transport of the biopsy samples

Samples were collected using Olympus GIF XQ 10 gastroscope in endoscopy unit of Civil Hospital Karachi, Patients who were recommended for endoscopy were asked to stop eating for at least six hours earlier and at the time of endoscopy they were asked to gargle with 4% Xylocain.. The biopsy forceps were sterilized with 70% Alcohol. From each biopsy sites specimens were collected in pairs and immediately one specimen were immersed in liquid thioglycollate and other specimen was stabbed in unease vial. Since H. pylori cannot survive in aerobic condition so thioglycollate broth was used which provide anaerobic condition till processing. After the collection, the specimens were transported to the Immunology and Infectious Disease Research Laboratory in the Department of Microbiology, University of Karachi within two hours.

DNA was extracted from these samples for PCR.It was freezeat zero degrees centigrade.PCR was performed by following procedure.

PCR for detection of H. pylori

DNA extraction from biopsy

Following method was used to extract DNA from Gastric biopsies. The biopsies samples were crushedand were added to test tube containing 240 [micro]l D/W. Followed by the addition of 20-30 [micro]l 20%SDS, then 80 [micro]l PK buffer and than 40 [micro]l protinase K were added to each test tube. All the contents were mixed well. After mixing all the test tubes were incubated at 55[degrees]C overnight if it was biopsy and for 1 hour if it was a culture. After incubation all the test tubes were placed at room temprature. Than to each test tube 100 [micro]l 6M NaCl were added and mixed well. After mixing all the test tubes were centrifuged for 1 minute at 14,000 g. After centrifugation the supernatent was separeted in a separate tube. To the supernatent 1ml 100% chilled ethanol were added and centrifuged as mentioned above. The supernatent was discarded. Than 1ml 70% ethanol was added and centrifuged as mentioned above. Supernatent was discarded and the mixture was suspended in 100 [micro]l TE buffer.

Preparation of PCR Mix

PCR mixture was prepared as follows. To each test tube 14.7 [micro]l Nuclease free water was added. Followed by the addition of 2.5 [micro]l PCR Buffer, 1.0 [micro]l Mg[Cl.sub.2] and 0.5 [micro]l dNTPs. Than to each test tube 0.5 [micro]l forward primer and 0.5 [micro]l reversed primer were added. Finally 0.3 [micro]l Taq pol and 3.5 [micro]l of DNA sample were added to each test tube.

Amplification conditions

Beta-Globulin gene

The primer sequence of Beta-Globulin forward is 5'ACACAACTGTGTTCACTA GC 3' and reversed is 5' CAACTTCA TCCACG TTCACC 3'. Product were amplified under the following condition: intial denaturation at 95[degrees]C for 5min followed by 35 cycles of denaturation at 95[degrees]C for 30 sec, annealing at 58[degrees]C for 30 sec and polymerization at 72[degrees]C for 30 sec with final round of polymerization at 72[degrees]C for 10min, in Bio-metraThermocycler. ureA gene

The primer sequence of UreA gene forward 5'GCCAATGGTAAATTAGTT-3' and reverse 5'CTCCTTAATTGTTTTTAC-3'. Product were amplified under the following condition: initial denaturation at 95[degrees]C for 5 min followed by 36 cycle of denaturation at 95[degrees]C for 30 sec, annealing at 58[degrees]C for 30 sec and polymerization at 72[degrees]C for 30 sec with final round of polymerization at 72[degrees]C for 10 min, in Bio-metraThermocycler. UreC (glmM) GENE

The primer sequence for UreC gene Forward 5'AAGCTTTTAGGGGTGTTAGGGGTTT 3' and Reversed 5'AAGCTTAC TTTCTAA CACTAACGC-3'. Product were amplified under the following condition: initial denaturation at 95[degrees]C for 5 min followed by 36 cycles of denaturation at 95[degrees]C for 30 sec, annealing at 55[degrees]C for 30 sec and polymerization at 72[degrees]C for 30 sec with final round of polymerization at 72[degrees]C for 10 min, in Bio-metraThermocycler.

GEL electrophoresis

PCR product were analyzed by gel electrophoresis using 1.7% (W/V) agrose, stained in 0.2 [micro]l of ethidium bromide, and examined by ultraviolet transilluminator.Using 100bp marker

RESULTS

A total of 50 biopsy samples from different age groups were investigated for H. pylori infection by PCR. All the sample were initally investigated for Beta-Globulin gene, All sample show positive result for Beta-Globulin gene which confirmed that DNA was extracted from biopsy specimen. ureA gene based PCR was found to be positive in 25/50 (%). The positive predictive value is found to be 50% and negative predictive value is also found to be 50 %(table 3).

The second PCR used the glmM (ureC) as the target. Out of the 50, 10 samples showed positive results for ureC gene. The positive predictive value was determined to be 20% and negative predictive value was found to be 80% (table 3). Out of 35 positive sample amplify by two different PCR method 35 sample were positive for both ureA and ureC gene in PCR.

A total of 50 patient with endoscopically proved deudenal ulcer were included in this study. Out of 50 patients, 36 showed evidence of H. pylori infection so prevalence of H. pylori recorded was 72 %. (table-2)

Regarding H. pylori positivity 19 out of 28 (67.8%) males were H. pylori +ve and 9 out of 28 (32.14) were H. pylori -ve. Incase of females 17 out of 22 (77.2%) were H. pylori +ve so positivity was 77.2:67.8% i.e. 1.14:1 (table-5) Maximum incidence of H. pylori was 100% recorded in age group I (10-20 years) and then 85% recorded in age group III (31-40 years) while the minimum incidence was zero percent recorded in age group V I (60-70 years) Age of the patient range from 14-65 years (meanage). Maximum number of patients were in age III (31-40 years) next were in age group II (21-30years) then age group I V (41-50 years) and then age group V (51-60 years) and then age group 1(10-20 years) and then age group V I (61-70 years).(table 4) Data about prevalence showed that its prevalence is high among the age group 1 (10-20 years) which is 100% and then second most susceptible group is age group 3 (30-40 years) which is 85%.

DISCUSSION

The diagnosis of H. pylori infection is necessary to understand gastroduodenal pathologies and to decide the exact regime required for the treatment and control.

Although culture isolation has been the standard method for detection of organism, but it may not be the most appropriate method for detection of H. pylori like organism due to cost, the special conditions required for specimen transport and growth, and the long interval between specimen harvest and test results, which delay treatment decision. Among the other method, serological test which detect specific antibody against H. pylori has disadvantage that it cannot distinguish between active infection and previous exposure to H. pylori (3). The rapid urease test and histology may not prove to be specific tests since the presence of other urease producing bacteria with H. pylori like morphology in stomach cannot be denied. Detection of H. pylori DNA from the gastric tissue by the polymerase chain reaction (PCR) is quite satisfactory, can yield high level of sensitivity (93%) and specificity (100%) can detect as few as 10 H. pylori colony forming units. The potential advantage of PCR includes high specificity, quick results, and the ability to type bacteria without the requirement for special transport condition.

This study used ureA gene and ureC (glmM) genes as the PCR target. Both genes are highly conserved for H. pylori, and a number of researchers have used them previously (68).

All the sample were initially investigated for Beta-Globulin gene PCR, in order to confirm the extraction of DNA. All the sample were found to be positive with Beta-Globulin gene PCR. Than after confirmation of DNA extraction from biopsy all the sample were investigated for ureA and ureC gene. 25 out of 50 samples were found to be positive with ureA gene based PCR with positive predictive value 50%. While the ureC (glmM) gene amplified only 10 samples with positive predictive value 20%. Our results are contradictory with the previously published report by Lu et al since the same primers are used in this study. compared five different PCR methods targeting different segment of the H. pylori genome. Of 5 different PCR methods, they found ureC (glmM) gene PCR as the most sensitive and specific for the detection of H. pylori in gastric biopsy specimens (69). There could be several reasons behind the contradictory results; first there may be a chance of polymorphism in ureC gene in Pakistani population. However further study is required to confirm the ureC gene polymorphism in Pakistani strains of H. pylori.

According to the present study the prevalence of H. pylori in gastritic patient belonging to Karachi is 72% (36 out of 50 patients are PCR positive for either UreA gene or UreCgene). This result is comparable with various previous studies which have recorded a consistently high prevalence.

The reason for variation in prevalence could be due to low sensitivity of diagnostic tests, age group of patients, ethenic difference and socioeconomic status of the patients. High prevalence rate of H. pylori in this study may be due to the age factor (as mojority of the patients were in 3rd to 4th decades of life at which age H. pylori infection is generally high), crowded enviroment, low sanitation, poor hygiene which predispose to the spread of H. pylori infection, and selection of high sensitivity diagnostic tests i.e. PCR

Regarding to the sex, this study showed predominance of male patients over female patients of gastritis (M/F ratio--28/22 i.e. 1.2:1) which is comparable to other studies showing predominance of male gender. Lam S. K, and.Org G.B. documented a M/F ration of 4:1 [72]. A study conducted by W. Ahmed et al in 1990 revealed a ratio of 5.7:1. In the litrature it is reported that gastritis was lower in young women until the onset of menopause and this led to the idea that somehow female hormones protec against the development of gastritis.

Contrary to the result of this study M/F ratio is different in developed countries like United States where it is reported to be 1:1 (73), and United Kingdom where it is reported to be 2:1 (74). This wide geographical differences in the sex ratio support environmental factor theory and the changing habits of females in the developing vs. developed countries.

Distribution of the patient according to the age has revealed that majority of patients in the present study were in their 3rd-4th decaded of life. This figure is consistant with that reported in the litrature. High prevalence of H. pylori is reported in 1995 in age group 31-50 years (75). In addition the prevalence of H. pylori showed an increase with the increasing age. Difference in the age suggest two possibilities. Either risk factors for infection in adults differ from those acting during childhood or most infections may be acquired before childhood and the observed increase in seroprevalence with age could be predominatly a cohort effect (73).

There are numerous reason that why sometime the diagnostic test failed to detect H. pylori from sample. Firstly the use of different drugs prior to the endoscopy which are the known suppressors of H. pylori, reduce the number of organism and as they are few in number they can't survive in the environment or in other words in vitro. Secondly the biopsy specimens in some cases have not taken from the correct area or the area colonized by H. pylori may have been missed. Third may be due to delay in processing of the biopsy specimens. Goodwin et al recommended that the biopsy specimens should be kept at 4[degrees]C if more than 2 hours are required before processing. Since Civil hospital Karachi is quite far from university, it took some time to transport the biopsy specimens and due to insufficient facilities, specimen could not be kept at low temperature during transport. It also indicates that ureA gene has sufficient sensitivity for clinical application than ureC gene.

ACKNOWLEDGMENTS

The authors are thankful to the Deanship of Scientific Research, King Saud University, Riyadh, Saudi Arabia, for funding the work through the research Group project No. RGP-210

REFERENCES

(1.) Doenges J.L. Spirochetes in the gastric glands of macacus rhesus and of man without related diseases. J. Arch. Pathol. 1939; 27:469-470.

(2.) Freedberg A.S., L.E. Baron. The presence of spirochetes in human gastric mucosa. Am. J. Dig. Dis. 1940; 7:443-445.

(3.) Steer H. W., Colin Jones D.G., Mucosal changes in gastric ulceration and their response to carbenoxolone sodium. Gut. 1975; 16:590-597.

(4.) Solnick. J.V. and P. Vandamme. Taxanomy of Helicobacter Genus. 2001; 39-52. In Helicobacter pylori physiology and genetics. Mobley H.L.T., G.L. Mendz, S.L. Hazell ed). Washington (DC): ASM Press.

(5.) Bode G., F. Mauch, H. Ditschuneit, P. Malfertheiner. Identification of structures containing polyphosphate in Helicobacter pylori. J. Gen. Microbiol. 1993; 139(12): 3029-33.

(6.) Lee A., M.W. Phillips, J.L.O' Rourke, B.J. Paster, F.E. Dewhirst, G.J. Fraser, J.G. Fox, L.I. Sly, P.J. Romaniuk, T. J. Trust. Helicobacter muridarum sp. Nov., a microaerophilic helical bacterium with a novel ultra structure isolated from the intestinal mucosa of rodents. Int.J.Sys.Bacteriol. 1992; 42(l):27-36

(7.) Van Duynhoven Y.T., R. deJonge. Transmission of Helicobacter pylori: a role for food?. Bull World Health Organ. 2001; 79(5): 455-460.

(8.) Alberston N., I. Wenngren, J-E. Sjostrom. Growth and survival of Helicobacter pylori in defined medium and susceptibility to Brij 1998; 78: 36(5):1232-1235.

(9.) Davood E,. M.M. Ashraf, Salmanian, A.H.Z. Hosseini. Optimization of Helicobacter pylori culture in order to prepare favorable antigens. J. Bacteriol. 2009; 1(9):101-104.

(10.) Marais A., G.L. Mendz, S.L. Hazell, F. Megraud. Metabolism and genetics of Helicobacter pylori: the genomic Era. Microbiol. Rev. 59(3): 451480.

(11.) Jiang X., M.P. Doyle. Effect of environmental and substrate factors on survival and growth of Helicobacter pylori. J. Food Prot. 1998; 61(8): 929-33.

(12.) Graham D Y., M.S. Osato. H. pylori in the pathogenesis of duodenal ulcer: interaction between duodenal acid load, bile, and H. pylori. Am. J. Gastroenterol. 2000; 95(1):87-91.

(13.) Suerbaum S., I. Michetti. Helicobacter pylori infection. Engl. J. Med. 2002; 347. Falk P.G., L.V. Hooper. T. Midtvedt, G.I. Gordon. Creating and maintaining the gastrointestinal ecosystem: What we know and known to know from Gnotobiology. Microbiol. Mol. Biol. Rev. 1998; 62(4):1157-1170.

(14.) Hardin F. J., R. A. Wright, Helicobacter pylori: Review and Update. Clin. Rev: 2003; 23-31

(16.) Kusters J.G., A.H.M. vanVliet, E.J. Kuipers. Pathogenesis of Helicobacter pylori infection. Clin. Microbiol Rev: 2006; 19(3). 449-490.

(17.) Thomas J.E., J.E.G. Bunn, H. Kleanthous, T.P. Monath, M. Harding, W.A. Coward, L.T. Weaver. Specific immunoglobulin A antibodies in maternal milk and delayed Helicobacter pylori colonization in Gambian infants. J of Medicin. 39:1155-1160.

(18.) Suerbaum S., I. Michetti. Helicobacter pylori infection. Engl. J. Med. 2002; 347.

(19.) Suarez G., V E. Reyes, E.J. Beswick. Immune response to Helicobacter pylori. World J Gastroenterol. 2006; 12(35): 5593-5598.

(20.) Mitchell H.M., Epidemiology of H. pyloir. p. 39-52. In Helicobacter pylori physiology and genetics. Mobley H.L.T., G.L. Mendz, S.L. Hazell (ed). washington (DC): ASM Press, 2001.

(21.) Megraud F., M.P.B. Rabbe, F. Denis, A. Belbousi, D.Q. Hoa. Seroepidemiology of Compylobacter pylori infection in various population. J. Clin Microbiol. 1999; 1870-1873.

(22.) Epidemiological features of Helicobacter pylori infection in developing countries. Bardhan P.K. Hunt R.H., S.D. Xiao, F. Megraud, R. Leon-Barua. WGO Global Guideline Helicobacter pylori in developing countries. J. Digestivie Diseases. 2010; 12:319-326.

(23.) Lamber J.R., S.K. Lin, W. Sievert, L. Nicholson, M. Schembri, C. Guest. High prevalence of Helicobacter pylori antibodies in an institutionalized population: evidence for person-to-person transmission. Am J Gastroenterol. 1995; 90(12): 2167-71.

(24.) Shepherd A.J., C.L. Williams, C.P. Doherty, M. Hossack, T. Preston, K.E.L. McColl, L.T. Weaver. Comaprison of an enzyme immunoassay for the detection of Helicobacter pylori antigens in the faeces with the urea breath test Arch Dis Child. 2000; 83:268-270.

(25.) Ndip R.N., A.E. Malange, J.F.T. Akoachere, W.G. Mackay, V.P.K. Titanji, L.T. Weaver. Helicobacter pylori antigens in the faeces of asymptomatic children in the buea and limbe health districts of Cameroon: a pilot study. 2004; 9:1036-1040.

(26.) Ndip R.N., W.G. Mackay, M.J.G. Farthing, L.T. Weaver. Culturin Helicobacter pylori from clinical specimens: Review of microbiological methods. J pediatric Gastroenterol and Nutrition. 2003; 36:616-622.

(27.) Velapatino B., J. Balqui, R.H. Gilman, A. Bussalleu, W. Quino, S.A. Finger. Validation of string test for diagnosis of Helicobacter pylori infections. J. Clin. Microbiol. 2006; 44(3): 976-980.

(28.) Cy Wong B., Update on management of Helicobacter pylori infection. Medical Bulletin. 2010; 15(12): 8-10.

(29.) Asaka M., M. Kato, S. Takahashi, Y. Fukuda, T. Sugiyama, H. Ota, N. Uemura, K. Murakami, K. Satoh, K. Sugano. Guideline for the management of Helicobacter pylori infection in Japan: 2009 revised edition. Helicobacter. 2010; 15(1): 1-20.

(30.) Parsonnet J., H. Shmuely. T. Haqqerty. Fecal and oral shedding of Helicobacter pylori from healthy infected adults. JAMA. 1999; 282(23): 2240-5.

(31.) Dore M.P., M.S. Osato, M.H. Malaty, D.Y. Graham. Characterization of culture method to recover Helicobacter pylori from the feces of infected patients. Helicobacter.; 5(3): 165-8.

(32.) Owen RJ. Bacteriology of Helicobacter pylori. Bailliere's Clin Gastroenterol 1995; 9:415-40.

(33.) Dent JC., C.A.M. McNulty., Evaluation of a new selective medium for Campylobacter pylori. Eur J Clin Microbiol Infect Dis 1988; 7: 555-63.

(34.) Morgan D.R., J.J. Matheuson, R. Fredman, et al. Evaluation of a selective enrichment technique for the isolation of Campylobacter pylori. FEMS Microbiol Letts. 1990; 66: 303-06.

(35.) Berry V., V. Sagar. Rapid urease test to diagnose Helicobacter pyloriinfection. JK Science. 2006; 8(2): 86-88.

(36.) Nunthapisud P., K. lertpocasomabat, O. Hanivivatvoong, K. Tativakayee, D. Thong-Ngam et al.. Evaluation foinhouserapiod urease test for detection of Helicobacter pylori from gastric biopsy speciens. J Med Assoc Thai. 2002; 1: 355-359.

(37.) Savanino Vi, S. Vigneri. G. Celle. The C urea breath test in the diagnosis of Helicobacter pylori infection. Gut. 1999; 45: 118-12.

(38.) Baqai R., M.Arian. Diagnosis of Helicobacter pylori infection--the search goes on. JPMA. Asaka M., M. Kato, S. Takahashi, Y. Fukuda, T. Sugiyama, H. Ota, N. Uemura, K. Murakami, K. Satoh, K. Sugano 2010. Guideline for the management of Helicobacter pylori infection in Japan: 2009 revised edition. Helicobacter. 2001; 15(1): 1-20.

(39.) Wilcox M.H., T.H.S. Dent, J. Hunter, J.J. Gray, D.F.J. Brown, D.G.D. Wight, Accuracy of serology for the diagnosis of Helicobacter pylori infection a Comparison of eight kits. J Clin Pathol. 1996; 49: 373-376.

(40.) Laheij R.J.F., H. Straatman, J.B.M. Jansen, A.L.M.Verbeek. Evaluation of commercially Available Helicobacter pylori serology kits. J. Clin Microbiol (Rev). 1998; 38(10):2803-2809.

(41.) Vaira D., N. Vakil, M. Menegatti et al. The stool antigen test for detection of Helicobacter pylori after eradication therapy Anal of internal Medi. 2002; 136(4): 280-287.

(42.) Li Y.H., H. Guo, Peng-B. Clinecal value of Helicobacter pylori stool antigen test, Immunocard STAT HpSA, for detecting H. pylori infection. World J Gastroenterol. 2004; 10(6): 913-914

(43.) Frenck R.W., H.M. Fathy, M. Sherif et al. Sensitivity and specificity of various test for the diagnosis of Helicobacter pylori in Egyptian children. J. Pediatrics. 2006; 118(8): 1195-1202.

(44.) Mobley H.L., M.D. Island, R.P. Hausinger. Molecular biology of microbial ureases. J. Microbiol. Mol. Biol.(Rev). 1995; 59(3):451-480.

(45.) Clyne M., B. Drumm. The urease enzyme of Helicobacter pylori does not function as an adhesin. J. Infection and immunity. 1996; 64(7): 2817-2820.

(46.) Benoit S.L., R.J. Maier. Mua (HP0868) is a nickel-binding protein that modulates urease activity in Helicobacter pylori. J. Mbio. 2011; 19(2): 114-11.

(47.) Hong W., K. Sano, S. Morimatsu et al., Medium pH-dependent redistribution of the urease of Helicobacter pylori J. Med. Microbiol. 2003; 53: 211-216.

(48.) Hu L.T., P.A. Foxall, R. Russell, H.L.T. Mobley. Purification of recombinant Helicobacter pylori urease apoenzyme encoded by ureA and ureB. J. Infection and Immunity. 1992; 60(7): 2657-2666.

(49.) Reuse H., A. Slabigne, D.M. Lecreu. The Helicobacter pylori ureC gene code for a phosphoglucosaminemutase. J. Bacteriol. 1997; 179(11): 3488-3493.

(50.) Stone G.G., Shortridge D., Flamm R.K., Beyer J., Ghoneim A.T and Tanaka S.K., PCR-RFLP typing of ureC from Helicobacter pylori isolated from gastric biopsies during a European multi-country clinical trial. Journal of Antimicrobial Chemotherapy, 1997; 40:251-256.

(51.) Hazell S. L. Burns B. P., Characterization of the glucose transport in Helicobacter pylori. ActaGastroenterol. Belg. 1993; 56:44.

(52.) Chalk P A., Roberts A. D., Blows W. M., Metabolism of pyruvate and glucose by intact cells of Helicobacter pylori studied by C-13 NMR spectroscopy. Microbiology 1994; 140: 2085-2092.

(53.) Wenner, J., T. Gunnarsson, H. Graffner and G. Lindell. Influence of Smoking and Helicobacter pylori on Gastric Phospholipids. 2008l 45(8): 1648-1652.

(54.) Lin SK, Lambert JR, Nicholson L, et al. Prevalence of Helicobacter pylori in a representative Anglo-Celtic population of urban Melbourne. J Gastroenterol Hepatol 1998; 13: 505-510

(55.) Robertson MS, Cade JF, Savoia HF, et al. Helicobacter pylori infection in the Australian community: current prevalence and lack of association with ABO blood groups. Intern Med J 2003; 33: 163-167

(56.) Malaty HM., "Epidemiology of Helicobacter pylori infection". Best Pract Res Clin Gastroenterol 2007; 21(2): 205-14.

(57.) Goh KL, Parasakthi N., The racial cohort phenomenon: seroepidemiology of Helicobacter pylori infection in a multiracial South-East Asian country E ur J Gastroenterol Hepatol. 2000; 13: 177-83.

(58.) Chung A.Y., P.K. Chow, W.K. Yu, J.M. Ho, H.S. Chan, W.K. Wong, K.C. Soo. Prevalence of Helicobacter pylori in gastric cancer in a South-East Asian population by 14C-urea breath test. 2001; 71(10): 574-576.

(59.) Ahmed W., H. Qureshi, S.J. Zuberi. Pattern of duodenal ulcer in Karachi. JPMA 1989; 40(9):67-71.

(60.) Qureshi H, Hafiz S, Medhi I. H pylori IgG antibodies in children. J. Pak Med Assoc 1999; 49: 143-144

(61.) Yousfi M.M., H.M.EI-Zimaity, R.A. Cole, R.M. Genta, D.Y. Graham. Detection of Helicobacter pylori by rapid urease tests: is biopsy size a critical variable. Gastrointest Endosc. 1996; 43(3): 222-224.

(62.) Laine L, Chun D, Stein C, El-Beblawi I, Sharma V, Chandrasoma P. The influence of size or number of biopsies on rapid urease test results: a prospective evaluation. Gastrointest Endosc 1996; 43: 49-53

(63.) W G Weisburg, S M Barns, D A Pelletier and D J Lane. 16S ribosomal DNA amplification for phylogenetic study J Bacteriol. 1991; 173(2): 697-703

(64.) Bamford KB, Lutton DA, O'Loughlin B, Coulter WA, Collins JS., Nested primers improve sensitivity in the detection of Helicobacter pylori by the polymerase chain reaction. J Infect 1998; 36: 105-110.

(65.) Lu JJ, Perng CL, Shyu RY, Chen CH, Lou Q, Chong SK, Lee CH., Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol 1999; 37: 772-774

(66.) Stern S., T. Powers, L.M. Changchien and H.F. Noller. RNA-protein interactions in 30S ribosomal subunits: folding and function of 16S rRNA. 1989; 244(4906): 783-790.

(67.) Mukhopadhyay A K., D. Kersulyte, J. Jeong, S. Datta. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J. Bacteiol. 2000; 182(11): 3219-3227.

(68.) John H K., Nogawa., Meta-analysis of risk factors for peptic ulcer. non steroidalanti infammatory drugs, Helicobacter pylori, and smoking. J. Clin Gastroenterology 1997; 24(1):217.

(69.) Hansen G., C.Muller, P.Sinha. Gastric ulcer is accompanied by decrease of epidermal growth factor in gastric juice and saliva. J. Clin Chem Clin Biochem. 1989; 27(9):539-545.

(70.) Holcombe C. Helicobacter pylori: The African enigma. Gut. 1992; 33: 429-31.

(71.) Fox JG, Beck P, Dangler CA, et al.. Concurrent enteric helminth infection modulates inflammation and gastric immune responses and reduces helicobacter-induced gastric atrophy. Nat Med. 2006; 6: 536-42.

(72.) Perez-Perez, G. I., D. Rothenbacher, and H. Brenner. Epidemiology of Helicobacter pylori infection. Helicobacter 2004; 9(Suppl. 1): 1-6.

(73.) Pounder, R. E., and D. Ng., The prevalence of Helicobacter pylori infection in different countries. Aliment. Pharmacol. Ther. 1995; 9:33-39.

(74.) Malaty, H. M., and D. Y Graham., Importance of childhood socioeconomic status on the current prevalence of Helicobacter pylori infection. Gut 1994; 35:742-745.

(75.) Perez-Perez, G. I., A. Z. Olivares, F. Y. Foo, S. Foo, A. J. Neusy, C. Ng, R. S. Holzman, M. Marmor, and M. J. Blaser. Seroprevalence of Helicobacter pylori in New York City populations originating in East Asia. J. Urban Health 2005; 82:510-516.

(76.) Tsai, C. J., S. Perry, L. Sanchez, and J. Parsonnet. Helicobacter pylori infection in different generations of Hispanics in the San Francisco Bay Area. Am. J. Epidemiol. 2005; 162: 351-357.

(78.) Genta, R. M., Review article: after gastritis--an imaginary journey into a Helicobacter-free world. Aliment. Pharmacol. Ther. 2002; 16(Suppl. 4): 89-94.

Hazrat Wahab [1], Tilawat Khan [2], Iftikhar Ahmad [3], Arif Jan [3], Muhammad Younas [3], Hussain Shah [3], Naser M. AbdEl-Salam [4], Sultan Ayaz [5], Riaz Ullah [6] and Mohammad A. Wasim [7]

[1] Department of Microbiology, Karachi University Karachi Sindh, Pakistan

[2] Department of Microbiology, Swat Post Graduate College of Science and Technology Saidu Sharif Swat KPK Pakistan.

[3] Department of Zoology, Shaheed Benazir Bhutto University Sheringal Dir Upper KPK Pakistan.

[4] Riyadh Community College, King Saud University, Riyadh 11437, Saudi Arabia.

[5] College of Veterinary Sciences and Animal Husbandry, Abdul Wali Khan University Garden Campus Mardan, Pakistan.

[6] Department of Chemistry Government College Ara Khel FR Kohat, Kohat, KPK, Pakistan

[7] Department of Chemistry, Sarhad University of Science and Information Technology, Peshawar, KPK, Pakistan.

(Received: 18 June 2015; accepted: 28 August 2015)

* To whom all correspondence should be addressed. Mob.: +92-3348684196; E-mail: sultanayaz@yahoo.com

Table 1. Oligonucleotide sequence of primers and PCRproduct sizes

Amplified gene   Primer           Sequence (5'-3')

UreaseA gene     HPU1             59-GC CAAT GGTAAATTAGTT- 3 9
                 HPU2             59-CTCCTTAATTGTTTTTAC-39
glmMgene         Forward primer   59-AAGCTTTTAGGGGTGTTAGGGGTTT-39
                 Reverse primer   59-AAGCTTACTTTCTAACACTAACGC-39
Beta-Globulin    Forward primer   5' ACACAACTGTGTTCACTAGC 3
  gene           Reverse primer   5' CAACTTCATCCACGTTCACC 3'

Amplified gene   PCR product
                 size

UreaseA gene     411 bp
glmMgene         294 bp
Beta-Globulin    168bp
  gene

Table 2. Prevelance and positivity of H.pylori

Total     H.pylori +ve   Prevelance
patient                  of H.pylori

50             36            72%

Table 2. Prevelance and positivity of H.pylori

Total     H.pylori +ve   Prevelance
patient                  of H.pylori

50             36            72%

Table 3. Results of PCR in terms of predicted value

   Value                    ureAgene    ureCgene

Positive predicted value   50 (25/50)   20 (10/50)
Negative predicted value   50 (25/50)   80 (40/50)

Table 4. Incidence of H.pylori infection with respect to age

Group   Age range     No of       H.P.+ve.     H.P.-ve.
        years         patient      n-%age      n-%age

I.      10-20 years   3         3     100    1     0
II.     21-30 years   14        8    57.14   7   4285
III.    31-40 years   20        17   85.0    7   15.0
IV      41-50 years   6         2    33.33   4   66.66
Vi      51-60 years   5         2    40.0    3   60.0
VI.     61-70 years   2         0      0     2    100

Table 5. Prevalence of H.pylori in different sex

Sex      No of patient   H.pylori +ve   H.pylori -ve

Male          28          19 (67.8%)     9 (32.14%)
Female        22          17 (77.2%)     5 (22.72%)

Table 6. Symptoms of H.pylori patients

Symptoms           H. pylori       H. pylori
                 positiveN (%)   negativeN (%)

Gastric pain          80%             80%
Burning               74%             20%
Fever                 15%             25%
Nausea                10%             90%
Vomiting              12%             28%
Lower GI tract        90%             50%
  symptoms
Others                30%             40%
COPYRIGHT 2015 Oriental Scientific Publishing Company
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2015 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Wahab, Hazrat; Khan, Tilawat; Ahmad, Iftikhar; Jan, Arif; Younas, Muhammad; Shah, Hussain; AbdEl-Sal
Publication:Journal of Pure and Applied Microbiology
Article Type:Report
Date:Sep 1, 2015
Words:6043
Previous Article:Microbiological pools of soil carbon, nitrogen and phosphorus under exotic tree plantations in the degraded grasslands of Iran.
Next Article:In-vitro antibacterial activity screening of herb extracts against foodborne pathogenic bacteria from Thailand.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters