Printer Friendly

Deteccion de Borrelia burgdorferi sensu lato en perros y sus garrapatas en comunidades rurales de Yucatan, Mexico.

La enfermedad de Lyme (EL) es una enfermedad zoonotica producida por espiroquetas del complejo Borrelia burgdorferi sensu lato (s.l.) que afecta al humano y a los animales (Glenny, Mendoza, & Falconi, 2004). Es transmitida por garrapatas de la familia Ixodidae (Burgdorfer, Hayes, & Corwin, 1989), siendo Ixodes ricinus el vector mas comun en la transmision de la infeccion en Europa e I. scapularis e I. pacificus en Estados Unidos (E.U.) (Mannelli, Bertolotti, Gern, & Gray, 2012). Hasta el momento, el Centro de Control y Prevencion de Enfermedades de los E.U. (CDC, por sus siglas en ingles) solo reconoce a la EL en E.U. y Euroasia, pero no en Centro y Sudamerica (CDC, 2015). La importancia de la EL en Mexico queda por esclarecerse, a pesar de los distintos estudios que se han realizado sobre la distribucion de la garrapata Ixodes, no solo en los estados del noreste mexicano incluyendo la zona transfronteriza de Texas y Mexico (Feria et al., 2014), asi como a lo largo del centro y sureste del pais, incluyendo la peninsula de Yucatan (Solis-Hernandez, Rodriguez-Vivas, Barrera-Perez, Esteve- Gassent, & Apanaskevich, 2015; Rodriguez-Vivas et al., 2016). En Mexico, desde 1991 se reportaron los primeros casos sugestivos a EL en pacientes de Sinaloa y Monterrey (Arroyave & Tamez, 1994). Posteriormente, en 2007 se reportaron los primeros casos de EL autoctonos en humanos procedentes del Valle de Mexico y Quintana Roo (Gordillo-Perez et al., 2007).

Entre los hospederos domesticos de Borrelia burgdorferi s.l., el perro es el mas estudiado ya que actua como hospedero de Ixodes spp. y otras especies de garrapatas (Smith et al., 1993). El perro es considerado hospedero incidental que adquiere la infeccion durante la alimentacion de las formas maduras de las garrapatas infectadas, mientras que las formas inmaduras tienen una mayor preferencia alimentaria por pequenos mamiferos (especialmente roedores), aves o reptiles (Krupka & Straubinger, 2010). Algunos autores mencionan que aunque no hay evidencia de que la EL del perro suponga un riesgo para la salud publica, estos son considerados los reservorios mas importantes de garrapatas en el ambiente domestico y pueden ser fuente intermediaria para la infestacion de garrapatas en el humano (Levy & Magnarelli, 1992; Straubinger, 2000).

En Mexico, los estudios sobre la frecuencia y distribucion de B. burgdorferi s.l. en perros son escasos. En la zona norte y centro del pais (Monterrey, Nuevo Leon y Distrito Federal) se observo una seroprevalencia del 16 % (136 / 850), y en un estudio preliminar realizado en el 2003 en Mexicali, Baja California, se reporto una prevalencia de 7.4 % (7 / 94) en perros infestados por la garrapata Rhipicephalus sanguineus (Salinas-Melendez, Tamez-Gonzalez, Welsh-Lozano, & Barrera-Saldaana, 1995; Salinas-Melendez, AvalosRamirez, Riojas-Valdez, & Martinez-Munoz, 1999; Tinoco-Gracia et al., 2008).

En Mexico se ha reportado que el perro es hospedero de varias especies de garrapatas, que incluyen Rhipicephalus sanguineus sensu lato, Dermacentor nitens, Amblyomma mixtum, A. sabanerae, A. parvum, A. ovale, A. auricularium, A. maculatum e Ixodes affinis (Rodriguez-Vivas et al., 2016). Se cree que las garrapatas R. sanguineus s.l. (Tinoco-Gracia et al., 2008) e I. affinis son las responsables de la transmision de B. burgdorferi s.l. a los perros. Solis-Hernandez et al. (2015) mencionan que la garrapata I. affinis parasita con mayor frecuencia en perros de areas rurales que tienen acceso a las zonas forestales cuando son llevados de caceria, y por ende se asume que tienen mayor riesgo de infectarse con la espiroqueta que los animales de zonas urbanas.

El acceso de perros a la areas forestales, las modificaciones de los habitat silvestres y el cambio climatico han afectado la distribucion de los reservorios y sus garrapatas y han favorecido la expansion de B. burgdorferi s.l. (Ogden et al., 2006; Solis-Hernandez et al., 2015). La deteccion de Borrelia en perros podria ser un criterio importante para la evaluacion del riesgo de la EL en humanos, ya que el perro puede emplearse como indicador epidemiologico para la identificacion de nuevos focos de esta enfermedad (Bhide, Travnicek, Curlik, & Stefancikova, 2004; Little, Heise, Blagburn, Callister, & MeadLyme, 2010).

En Mexico, la distribucion y presencia de genoespecies patogenas de B. burgdorferi en perros y sus garrapatas no ha sido investigada, especialmente en areas rurales de Yucatan donde los perros tienen acceso a las areas selvaticas, por tal motivo, el objetivo del presente estudio fue detectar la presencia y estimar la prevalencia de B. burgdorferi s.l. en perros y sus garrapatas, en comunidades rurales de Yucatan, Mexico, mediante la deteccion de los genes flaB, p66 and ospC.

MATERIALES Y METODOS

Area de estudio: El estudio se realizo en las comunidades rurales de Opichen y Tixmehuac en el estado de Yucatan, Mexico. Tixmehuac ocupa una superficie de 251.6 [km.sup.2], con un clima calido sub-humedo con lluvias en verano. La temperatura media anual es de 26[grados]C y la precipitacion pluvial anual es de 1 050 mm; la vegetacion prevaleciente en la periferia de la comunidad es selva mediana sub-caducifolia. Las principales actividades economicas de 4 746 habitantes de la comunidad son la agricultura, la caza y la construccion en diferentes ciudades del estado de Yucatan (INEGI, 2014). Opichen ocupa un area de 268.2 [km.sup.2] con un clima calido sub-humedo con lluvias en verano. La temperatura media anual es de 28[grados]C con una precipitacion pluvial anual de 1 100 mm; la comunidad esta rodeada de parches de la selva baja caducifolia, areas de cultivo "milpas" y pastizales. La comunidad tiene una poblacion de 6 285 habitantes, y la principal fuente de ingresos de la familia es la agricultura y la caza, asi como la construccion en diferentes ciudades del estado de Yucatan, complementado con actividades como la cria de animales de traspatio (INEGI, 2014).

Seleccion de viviendas y perros: En cada comunidad se seleccionaron por conveniencia 50 viviendas que tuvieran al menos un perro. Las comunidades se dividieron en cuatro cuadrantes y se tomo como referencia las calles principales que cruzan los poblados de norte a sur y de este a oeste. Cada vivienda seleccionada fue georeferenciada y se solicito la anuencia de los duenos para participar en el estudio. Cuando un dueno no aceptaba la participacion, se seleccionaba otra vivienda. Los muestreos se realizaron de julio a diciembre de 2013, meses de mayor abundancia de garrapatas en perros de la region (Rodriguez-Vivas et al., 2016).

Manejo y toma de muestras en perros: De cada perro (144) se obtuvo una muestra de sangre. Para ello se realizo la antisepsia del area con alcohol isopropilico y se extrajeron 3 mL de sangre por puncion de la vena safena. Las muestras fueron tomadas bajo el minimo estres y se siguieron las recomendaciones establecidas en la normatividad vigente para el manejo y la toma de muestras de animales en Mexico (N0M-062-Z00-1999) y en presencia del dueno de cada animal. La sangre se coloco en tubos Vacutainer[R] con Citrato de Sodio. Las muestras se transportaron en neveras con refrigerantes (aproximadamente 4[grados]C) al Campus de Ciencias Biologicas y Agropecuarias de la Universidad Autonoma de Yucatan (CCBAUADY) en un periodo no mayor a 24 horas para su posterior congelacion a -80[grados]C.

Recolecta de garrapatas: Todos los perros de las viviendas seleccionadas fueron inspeccionados durante un periodo de 10 a 15 min con el proposito de recolectar todas las garrapatas encontradas en el animal (una recolecta). Las garrapatas fueron recolectadas bajo el minimo estres para los perros y en presencia del dueno de cada animal, y se siguieron las recomendaciones establecidas en la normatividad vigente para el manejo y toma de muestras de animales en Mexico (NOM062-ZOO-1999). La recolecta se realizo por el metodo de extraccion manual mediante el uso de pinzas de punta fina para sujetar y retirar las garrapatas cerca de la piel del perro, sin comprometer el aparato bucal de la garrapata (Gammon & Salam, 2002). Todas las garrapatas recolectadas de cada perro se colocaron en viales de 50 mL que contenian una solucion de etanol al 70 %. Se recolectaron en total 846 garrapatas que fueron transportadas al Laboratorio de Parasitologia en el Campus de Ciencias Biologicas y Agropecuarias de la Universidad Autonoma de Yucatan (CCBA-UADY) para su clasificacion taxonomica con la ayuda de las claves taxonomicas descritas por Keirans y Litwat (1989) y Guerrero (1996), y por comparacion morfologica con ilustraciones disponibles.

Extraccion de ADN: Se extrajo el ADN de todas las muestras de sangre de perro y garrapatas recolectadas mediante el uso del kit comercial DNeasy blood and tissue (Qiagen, Valencia, USA) de acuerdo a las instrucciones del fabricante. Posteriormente, las muestras fueron almacenadas a -80[grados]C hasta su procesamiento.

Diagnostico molecular: Para el diagnostico molecular de B. burgdorferi s.l. se utilizo la prueba de reaccion en cadena de la polimerasa (PCR por sus siglas en ingles) convencional y anidada. Para todas las reacciones de PCR se utilizo un termociclador (Minicycler, BIO RAD). Para detectar la presencia del genero Borrelia en las muestras de sangre y garrapatas, se utilizo como marcador genetico la flagelina cromosomica de 41-kDA (flaB) en un PCR convencional, de acuerdo a la metodologia descrita por Jaulhac et al. (2000), mediante el uso de los cebadores: F5'AACACACCAGCATCACTTTCAGG3', R5'GAGAATTAACTCCGCCTTGAGAA GG3'. Los productos positivos a flaB, fueron amplificados para identificar B. burgdorferi s.l. mediante el uso de los genes p66 (66kDA) y ospC (23-kDA) en PCRs anidados, de acuerdo a la metodologia descrita por Bunikis et al. (2004a, b).

Para la amplificacion del gen p66 se utilizaron los cebadores:

F5'GATTTTTCTATATTTGGACACAT3', R5'TGTAAATCTTATTAGTTTTT CAAG3', Fn5'CAAAAAAGAAACACCCTCAGATCC3', Rn5'CCTGTTTTTAAATAAATTTTTGTAGCATC3'

y para ospC: F5'ATGAAAAAGAATACATTAAGTGC3', R5'ATTAATCTTATAATATTGATTTTAATTAAGG3', Fn5'TATTAATGACTTTATTTTTATTTATATCT3', Rn5'TTGATTTTAATTAAGGTTTT TTTGG3'.

El tamano de los productos esperados para cada uno de los genes flaB, p66 y ospC son 234pb, 684pb y 585pb, respectivamente. Como controles positivos se uso el ADN genomico de B. burgdorferi sensu stricto B31 (cepas MSK5 y A3), B. afzelii (cepa ATCC51567), B. gar ini i (cepa ATCC51383) y B. turicatae (cepas TCBP2 y 91E135), proporcionados por la Universidad de Texas A&M en College Station, Texas (EUA), y para evitar posible contaminacion, en cada reaccion se incluyo un control negativo. Para cada producto de PCR se realizo electroforesis, a traves de un gel de agarosa al 2 %, el cual se tino con bromuro de etidio, y posteriormente, se examino mediante transiluminacion UV.

Se obtuvo la prevalencia de perros y garrapatas positivos a B. burgdorferi s.l. mediante el uso de los marcadores geneticos flaB, p66 y ospC. Para conocer la diferencia en la frecuencia de perros y garrapatas positivas a B. burgdorferi s.l. en ambas comunidades (Opichen y Tixmehuac) se uso la prueba de X2.

RESULTADOS

Se muestrearon un total de 144 perros, 88 en la comunidad de Opichen y 56 en la comunidad de Tixmehuac. De estos, se recolectaron un total de 846 garrapatas, 672 en la comunidad de Opichen y 174 en la comunidad de Tixmehuac. De los 144 perros estudiados, en 139 perros se recolectaron garrapatas de una o mas especies (1-12 garrapatas por animal). La cabeza, orejas y extremidades fueron las zonas de perros donde se recolectaron el mayor numero de garrapatas. Treinta y tres garrapatas I. affinis fueron recolectadas en 16 perros, 27 del genero Amblyomma de 22 perros (A. maculatum, A. ovale, A. auricularium y A. mixtum) y 786 garrapatas R. sanguineus s.l. de 91 perros (Cuadro 1).

Analisis molecular: Los resultados del analisis molecular en sangre de perro, muestran que el 25 / 144 (17.3 %) fueron positivos al gen flaB, de los cuales 13 / 88 (14.7 %) corresponden a la comunidad de Opichen y 12 / 56 (21.4 %) a la comunidad de Tixmehuac (Cuadro 2). No se encontro diferencia significativa (p > 0.05) entre las dos comunidades. Del total de muestras, 12.50 % (18 / 144) resultaron positivas al gen p66 y 1.38 % (2 / 144) al gen ospC.

De las 846 garrapatas recolectadas, 1.53 % (13 / 846) fueron positivas al gen flaB (Cuadro 2). En la comunidad de Tixmehuac la prevalencia fue mayor que en la comunidad de Opichen (p < 0.05). De las especies de garrapatas analizadas R. sanguineus s.l. tuvo una prevalencia de infeccion de 0.89 % (7 / 786), A. mixtum de 5.88 % (1 / 17) e I. affinis de 15.15 % (5 / 33) (Cuadro 3), siendo esta ultima especie la que presento mayor prevalencia (p < 0.05). Solamente una garrapata R. sanguineus s.l. fue positiva al gen p66 y ninguna especie de garrapata fue positiva al gen ospC.

DISCUSION

El perro puede actuar como un importante centinela del complejo B. burgdorferi s.l., debido al contacto directo que mantiene con el habitat de las garrapatas vectoras, haciendolo mas vulnerable a adquirir esta bacteria (Goossens, van den Bogaard, & Nohlmans, 2001). Asimismo, los perros desempenan un papel clave en la dispersion de garrapatas, transportandolas al ambiente intra o peridomiciliar (Appel, 1990; Straubinger 2000; De Lacerda, Cuhna, Antunes, Do, & Machado, 2005), lo cual ocasiona un riesgo para la poblacion humana, ya que incrementa su exposicion con el agente (Mather, Fish, & Coughlin, 1994). Los habitantes de ambas comunidades rurales que trabajan en el campo y tienen acceso a areas selvaticas o agricolas, podrian tener mayor riesgo de adquirir el agente, ya que pueden tener mayor exposicion a garrapatas infectadas con las espiroquetas (Stanek, Wormser, Gray, & Strle, 2012).

En Mexico, la mayoria de los estudios realizados sobre el diagnostico de B. burgdorferi s.l. en perros, se han basado principalmente en pruebas serologicas. Salinas-Melendez et al. (1999) reportaron una seroprevalencia del 16 % en perros de Monterrey, y Tinoco-Gracia et al. (2007; 2008) del 8.2 % y 6.8 % en Mexicali.

Actualmente, la borreliosis canina en Mexico es poco estudiada, debido a que los perros infectados con Borrelia spp. generalmente no desarrollan signos clinicos asociados con esta espiroqueta, los que hace mas dificil su deteccion, monitoreo y tratamiento (Little et al., 2010). Sin embargo, en algunas ocasiones los perros infectados con la bacteria pueden presentar artritis migratoria, claudicacion intermitente, anorexia y malestar general. Asimismo se ha reportado en perros bloqueo cardiaco, signos neurologicos, convulsiones y falla renal fatal (Bhide et al., 2004).

Los principales vectores de B. burgdorferi s.l. son las garrapatas del genero Ixodes. En EE.UU. es transmitida principalmente por I. scapularis, I. pacificus e I. neotomae, mientras que la mayor parte de Europa (centro, norte y oeste) es transmitido por I. ricinus, y en Europa del este y Asia por I. persulcatus (Stanek et al., 2012). Recientemente, en EE.UU. se ha reportado que I. affinis puede ser vector de B. burgdorferi s.l. (Harrison et al., 2010). En el presente estudio, se encontro que el 15.15 % de I. affinis estudiados fueron positivos al gen flaB (dos perros y sus garrapatas I. affinis fueron positivos) lo que pone de manifiesto el probable papel de esta especie de garrapata en el ciclo de transmision de esta bacteria a los perros. La prevalencia de infeccion de garrapata es variable dependiendo de la especie, las fases de desarrollo y las condiciones medioambientales. En un estudio realizado en Servia, Savie et al. (2010) encontraron que el 22.1 % de garrapatas I. ricinus recolectadas en perros, se encontraban infectadas con B. burgdorferi s.l. En otro estudio realizado en EE.UU. el porcentaje de infeccion de I. scapularis con Borrelia spp. alcanzo hasta 50 % en garrapatas adultas (Greene & Straubinger, 2006). Generalmente, el porcentaje de infeccion de las garrapatas ixodidas se incrementa con el ciclo de vida de los vectores (~10 % en ninfas, ~20 % en adultas) y puede alcanzar hasta 75 % en el centro de Europa (Rauter & Hartung, 2005).

Se sabe que las fases inmaduras de I. affinis parasitan principalmente a pequenos mamiferos y aves, mientras que la fase adulta parasita a mamiferos de talla mediana y grande (Guglielmone, Estrada-Pena, Keirans, & Robbins, 2004; Mannelli et al., 2012). I. affinis generalmente no infesta humanos (Rudenko et al., 2012); sin embargo, Allan (2001) observo que esta especie puede ocasionalmente alimentarse de humanos. En futuros estudios se recomienda investigar el papel de I. affinis como vector competente de B. burgdorferi s.l. en animales y humanos en comunidades rurales de Yucatan, Mexico.

Aunque con menor frecuencia, en el presente estudio se encontraron R. sanguineus s.l. y A. mixtum positivos al gen flaB de B. burgdorferi s.l., ambas especies de garrapatas no son reconocidas ampliamente como vectores competentes de EL; sin embargo, Schulze et al. (1984), mencionan que las garrapatas de genero Amblyomma pueden considerarse como vector potencial de Borrelia en America del Sur y Mexico. En futuros estudios, sera necesario confirmar el papel de estas especies de garrapatas como vectores competentes de la EL en Yucatan, Mexico, ya que R. sanguineus s.l. y A. mixtum son las garrapatas mas abundantes que parasitan a una amplia gama de mamiferos incluyendo al humano en Yucatan (Rodriguez-Vivas et al., 2016). Asimismo, estas dos especies de garrapatas pueden ser vectores de varios agentes zoonoticos tales como Coxiella burnetii, Ehrlichia canis, R. conorii, and Rickettsia rickettsii, y pueden representar un riesgo de transmison a la poblacion de las comunidades estudiadas (Dantas-Torres, 2008; RodriguezVivas et al., 2016).

La presencia de perros positivos a B. burgdorferi s.l. en perros y sus garrapatas en comunidades rurales de Yucatan, Mexico, ponen de manifiesto la importancia de este agente en el sureste de Mexico y el posible riesgo de transmision a los humanos. En el 2007 se reportaron los primeros casos de EL autoctonos en humanos de Mexico, que presentaron manifestaciones cutaneas y neurologicas procedentes del Valle de Mexico y Quintana Roo (Gordillo-Perez et al., 2007).

Este estudio confirma la existencia de B. burgdorferi s.l. en perros y sus garrapatas en comunidades rurales de Yucatan, Mexico. La potencial transmision de B. burgdorferi s.l. a los humanos es alta, debido a que en Yucatan existen las condiciones ambientales y ecologicas para la proliferacion de garrapatas y es reconocido que en area rurales existe una alta infestacion de humanos con garrapatas. Se necesitan realizar estudios futuros para conocer la presencia de la EL en la poblacion humana de comunidades rurales de Yucatan, Mexico.

AGRADECIMIENTOS

Los autores agradecen a los habitantes y autoridades de las comunidades de Opichen y Tixmehuac por permitirnos entrar en sus casas y por su ayuda durante el Proyecto. Nuestra gratitud a Alonso Panti May, Rodrigo Carrillo Peraza y Marco Torres Castro, por su apoyo tecnico.

REFERENCIAS

Allan, S. (2001). Ticks (Class Arachnida: Order Acarina). In W. S. Samuel, M. J., Pybus, & A. A. Kocan (Eds.), Parasitic Diseases of Wild Animals. 2nd edition (pp. 72-106), Iowa: Iowa State University Press.

Appel, J. G. (1990). Lyme disease in dogs and cats. Compendium, 12, 617.

Arroyave, C. M., & Tamez, G. R. (1994). Enfermedad de Lyme. Informe de dos casos. Boletin Medico del Hospital Infantil de Mexico, 51, 117-120.

Bhide, M., Travnicek. M., Curlik. J., & Stefancikova, A. (2004). The importance of dogs in eco-epidemiology of Lyme borreliosis: a review. Veterinary Medicine, 4, 135-142.

Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., & Barbour, A. G. (2004a). Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology, 150, 1741-1755.

Bunikis, J., Tsao J., Luke C. J., Luna, M. G., Fish, D., & Barbour, A. G. (2004b). Borrelia burgdorferi infection in a natural population of Peromyscus leucopus mice: a longitudinal study in an area where Lyme Borreliosis is highly endemic. Journal of Infectious Diseases, 189, 1515-1523.

Burgdorfer, W., Hayes, S. F., & Corwin, D. (1989). Pathophysiology of the Lyme disease spirochete, Borrelia burgdorferi, in ixodid ticks. Clinical Infectious Diseases, 6, S1442-S1450.

Centers for Disease Control and Prevention (CDC). (2015). Lyme Disease. Retrieved from ww.cdc.gov/lyme

Dantas-Torres, F. (2008). The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Veterinary Parasitology, 152, 173-185.

De Lacerda, A. A., Cuhna, M. R., Antunes, D. R., Do, N. C. F., & Machado, B. R. (2005). Frequency of Ixodes ricinus ticks in Europe: a metaanalysis. Applied and Environmental Microbiology, 71, 7203-7216.

Feria, T. P., Castro, I., Gordillo, G., Cavazos, A. L., Vargas, M., Grover, A., ... Esteve-Gassent, M. D. (2014). Implications of climate change on the distribution of the tick vector Ixodes scapularis and risk for Lyme disease in the Texas-Mexico transboundary region. Parasites & Vectors, 7, 199.

Gammon, M., & Salam, G. (2002). Tick removal. American Family Physician, 66, 643-645.

Glenny, M., Mendoza, L., & Falconi, E. (2004). Deteccion de anticuerpos contra Borrelia burgdorferi e identificacion de garrapatas ixodidas en Piura y Amazonas, Peru. Revista Peruana de Medicina Experimental y Salud Publica, 20, 23-27.

Goossens, H. A. T., van den Bogaard, A. E., & Nohlmans, M. K. E. (2001). Dogs as sentinel for human Lyme borreliosis in The Netherlands. Journal of Clinical Microbiology, 39, 844-848.

Gordillo-Perez, G., Torres, J., Solorzano-Santos, F., De Martino, S., Lipsker, D., Velazquez, E., Ramon, G., Munoz, O., & Jaulhac, B. (2007). Borrelia burgdorferi infection and cutaneous Lyme disease, Mexico. Emerging Infectious Diseases, 13, 1556-1558.

Greene, C. E., & Straubinger, R. K. (2006). Borreliosis. In C. E. Greene (Ed.), Infectious Diseases of the Dog and Cat. 3rd edition (pp. 417-435). Philadelphia: WB Saunders Elsevier.

Guerrero, R. (1996). Las garrapatas de Venezuela (Acarina: Ixodidae). Listado de especies y claves para su Identificacion. 1996. Boletin de Malariologia y Salud Ambiental, 36, 1-24.

Guglielmone, A., Estrada-Pena A., Keirans, J., & Robbins, R. (2004). Las garrapatas (Acari: Ixodida) de la region zoogeografica neotropical. Argentina: Instituto Nacional de Tecnologia Agropecuaria.

Harrison, B. A., Rayburn, W. H. Jr, Toliver, M., Powell, E. E., Engber, B. R., Durden, L. A., ... Whitt, P. B. (2010). Recent discovery of widespread Ixodes affinis (Acari: Ixodidae) distribution in North Carolina with implications for Lyme disease studies. Journal of Vector Ecology, 35, 174-179.

Instituto Nacional de Estadistica y Geografia (INEGI). (2014). Censo General de Poblacion y Vivienda 2010. Recuperado de www.inegi.org.mx

Jaulhac, B., Heller, R., Limbach, F. X., Hansmann, Y., Lipsker, D., Monteil, H., ... Piemont, Y. (2000). Direct molecular typing of Borrelia burgdorferi sensu lato species in synovial samples from patients with Lyme arthritis. Journal of Clinical Microbiology, 38, 1895.

Keirans, J. E., & Litwak, T. R. (1989). Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodidea), east of the Mississippi river. Journal Medical of Entomology, 26, 435-448.

Krupka, I., & Straubinger, R. K. (2010). Lyme borreliosis in dogs and cats: background, diagnosis, treatment and prevention of infections with Borrelia burgdorferi sensu stricto. Veterinary Clinics of North America: Small Animal Practice, 40, 1103-1119.

Levy, S. A., & Magnarelli, L. A. (1992). Relationship between development of antibodies to Borrelia burgdorferi in dogs and the subsequent development of limb/ joint borreliosis. Journal of the American Veterinary Medical Association, 200, 344-347.

Little, S. E., Heise, S. R., Blagburn, B. L., Callister, S. M., & MeadLyme, P. S. (2010). Borreliosis in dogs and humans in the USA. Trends in Parasitology, 26, 213-218.

Mannelli, A., Bertolotti, L., Gern, L., & Gray, J. (2012). Ecology of Borrelia burgdorferi sensu lato in Europe: transmission dynamics in multi-host systems, influence of molecular processes and effects of climate change. Microbiological Reviews, 36, 837-61.

Mather, T. N., Fish, D., & Coughlin, R. T. (1994). Competence of dogs as reservoir for Lyme disease spirochetes (Borrelia burgdorferi). Journal of the American Veterinary Medical Association, 205, 186-188.

Ogden, N. H., Maarouf, A., Barker, I. K., Bigras-Poulin, M., Lindsay, L. R., Morshed, M. G., O'callaghan, C. J., ... Charron, D. F. (2006). Climate change and the potential for range expansion of the Lyme disease vector Ixodes scapularis in Canada. International Journal for Parasitology, 36, 63-70.

Rauter, C., & Hartung, T. (2005). Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus Ticks in Europe: a Metaanalysis. Applied and Environmental Microbiology, 71, 203-7216.

Rodriguez-Vivas, R. I., Apanaskevich, D. A., Ojeda-Chi, M. M., Trinidad-Martinez, I., Reyes-Novelo, E., Esteve-Gassent, M. D., & Perez de Leon, A. A. (2016). Ticks collected from humans, domestic animals, and wildlife in Yucatan, Mexico. Veterinary Parasitology, 215, 103-107.

Rudenko, N., Golovchenko, M., Honig, V., Mallatova, N., Krbkova, L., Mikulasek, P., ... Oliver, J. H. Jr. (2012). Detection of Borrelia burgdorferi sensu stricto OspC alleles associated with human Lyme Borreliosis worldwide in non-human-biting tick Ixodes affinis and rodent hosts in Southeastern United States. Applied and Environmental Microbiology, 79, 1444-1453.

Salinas-Melendez, J. A., Avalos-Ramirez, R., Riojas Valdez, V. M., & Martinez-Munoz, A. (1999). Serological survey of canine borreliosis. Revista Latinoamericana de Microbiologia, 41, 1-3.

Salinas-Melendez, J. A., Tamez-Gonzalez, R., Welsh-Lozano, O., & Barrera-Saldaana, H. A. (1995). Detection of Borrelia burgdorferi DNA in human skin biopsies and dog sinovial fluid by the polymerase chain reaction. Revista Latinoamericana de Microbiologia, 37, 7-10.

Savie, S., Vidic, B., Lazic, S., Lako, B., Potkonjak, A., & Lepsanovic, Z. (2010). Borrelia burgdorferi in ticks and dogs in the province of Vojvodina, Serbia. Parasite, 17, 357-361.

Schulze, T. L., Bowen, G. S., Bosler, E. M., Lakat, M. F., Parkin, W. E., Altman, R., ... Shisler, J. K. (1984). Amblyomma americanum: a potential vector of Lyme disease in New Jersey. Science, 224, 601-603.

Smith, R. P. Jr, Rand, P. W., Lacombe, E. H., Telford, S. R, Rich, S. M., Piesman, J., & Spielman, A. (1993). Norway rats as reservoir hosts for Lyme disease spirochetes on Monhegan Island, Maine. Journal Infected Disease, 168, 687-691.

Solis-Hernandez, A., Rodriguez-Vivas, R. I., Barrera-Perez, M. A., Esteve-Gassent, M. D., & Apanaskevich, D. A. (2015). Ixodes affinis (Acari: Ixodidae) in dogs from rural localities of Yucatan, Mexico: Prevalence, abundance and associated factors. Veterinaria Mexico, 2, 1-9.

Stanek, G., Wormser, G. P., Gray, J., & Strle, F. (2012). Lyme borreliosis. The Lancet, 379, 461-473.

Straubinger, R. K. (2000). PCR-based quantification of Borrelia burgdorferi organisms in canine tissues over a 500-day postinfection period. Journal of Clinical Microbiology, 38, 2191-2199.

Tinoco-Gracia, L., Quiroz-Romero, H., Quintero, M. T., Renteria-Evangelista, T. B., Barreras-Serrano, A., Hori-Oshima, S., ... Vinasco, J. (2007). Seroprevalence of Borrelia burgdorferi in dogs from a Mexico-U.S. border desert region: pilot study. Journal of Animal and Veterinary Advances, 6, 787-789.

Tinoco-Gracia, L., Quiroz-Romero, H., Quintero, M. T., Renteria-Evangelista, T. B., Barreras-Serrano, A., Hori-Oshima, S., ... Moro, M. H. (2008). Prevalence and risk factors for Borrelia burgdorferi infection in Mexicali, Baja California, a Mexico-US border city. International Journal of Applied Research in Veterinary Medicine, 6, 161-165.

Analilia Solis-Hernandez (1), Roger Ivan Rodriguez-Vivas (1) *, Maria Dolores Esteve-Gasent (2) & Sandra Luz Villegas-Perez (1)

(1.) Laboratorio de Parasitologia, Campus de Ciencias Biologicas y Agropecuarias. Facultad de Medicina Veterinaria y Zootecnia. Universidad Autonoma de Yucatan. Km 15.5 carretera Merida-Xmatkuil. CP. 97000. Merida, Yucatan, Mexico; analilia.solis@gmail.com, rvivas@correo.uady.mx, sandra.villegas@correo.uady.mx

(2.) Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX-77843, USA; MEsteve-Gassent@cvm.tamu.edu

* Correspondencia.

Recibido 02-VI-2017. Corregido 18-VIII-2017. Aceptado 20-IX-2017.
CUADRO 1

Abundancia de garrapatas recolectadas por especie, en perros de dos
comunidades rurales de Yucatan, Mexico

TABLE 1

Abundance of tick species collected in dogs of two rural
communities in Yucatan, Mexico

Genero          Especie           Tixmehuac   Opichen   Total

Rhipicephalus   sanguineus s.l.      146        640      786
Amblyomma       maculatum             1          5        6
Amblyomma       ovale                 1          1        2
Amblyomma       auricularium          1          1        2
Amblyomma       mixtum                6         11       17
Ixodes          affinis              19         14       33
Total                                174        672      846

CUADRO 2

Resultados correspondientes al PCR del gen flaB, en muestras de
sangre de perros y garrapatas de las localidades rurales de Opichen
y Tixmehuac en Yucatan, Mexico

TABLE 2

PCR results for the flaB gene in blood samples and ticks of dogs
from the rural communities of Opichen and Tixmehuac in Yucatan,
Mexico

Poblado       Perros           Perros               Prev.
            muestreados   positivos a flaB   B. burgdorferi s.l.

Opichen         88               13                14.7 %
Tixmehuac       56               12                21.4 %
Total           144              25                17.3 %

Poblado      Garrapatas      Garrapatas            Prev.
            recolectadas   positivas flaB   B. burgdorferi s.l.

Opichen         672              5                  1 %
Tixmehuac       174              8                 4.6 %
Total           846              13               1.53 %

Prev: Prevalencia, s.l.: sensu lato.

Prev: Prevalence, s.l.: sensu lato.

CUADRO 3

Perros y sus garrapatas positivas al gen flaB obtenidas dos
localidades rurales de Yucatan, Mexico

TABLE 3

Dogs and their positive ticks to flaB gene obtained from two
communities in Yucatan, Mexico

                 Perro         Garrapatas
Identificacion   flaB    p66   Especie                         flaB

1                  +      +    Ixodes affinis                   -
2                  +      +    Rhipicephalus sanguineus s.l.    -
3                  +      +    Ixodes affinis                   +
4                  +      +    *                                *
5                  +      +    *                                *
6                  +      +    *                                *
7                  +      +    Rhipicephalus sanguineus s.l.    -
8                  +      +    *                                *
9                  +      +    Rhipicephalus sanguineus s.l.    -
10                 +      -    Rhipicephalus sanguineus s.l.    -
11                 +      -    Rhipicephalus sanguineus s.l.    -
12                 +      +    Rhipicephalus sanguineus s.l.    -
13                 +      +    Rhipicephalus sanguineus s.l.    -
14                 +      +    *                                *
15                 +      +    Amblyomma mixtum                 -
16                 +      -    *                                *
17                 +      +    Ixodes affinis                   +
18                 +      +    Rhipicephalus sanguineus s.l.    -
19                 +      -    Rhipicephalus sanguineus s.l.    -
20                 +      +    Rhipicephalus sanguineus s.l.    -
21                 +      -    Rhipicephalus sanguineus s.l.    -
22                 +      +    *                                *
23                 +      -    Amblyomma mixtum                 -
24                 +      +    Rhipicephalus sanguineus s.l.    -
25                 +      -    Ixodes affinis                   -

* No se encontraron garrapatas en los perros. Las garrapatas A.
mixtum y R. sanguineus s.l. positivas al gen flaB fueron
recolectadas de perros negativos. Tres I. affinis positivos a flaB
fueron recolectados de perros negativos.

* No ticks were found in dogs. The ticks A. mixtum and R.
sanguineus s.l. positive to the flaB gene were collected from
negative dogs. Three I. affinis positive to flaB were collected
from negative dogs.
COPYRIGHT 2018 Universidad de Costa Rica
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2018 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Solis-Hernandez, Analilia; Rodriguez-Vivas, Roger Ivan; Esteve-Gasent, Maria Dolores; Villegas-Perez
Publication:Revista de Biologia Tropical
Date:Mar 1, 2018
Words:5078
Previous Article:Comparative reservoir limnology in Juramento (Salta) and Sali-Dulce (Tucuman) Basins in Argentina.
Next Article:Diversidad y distribucion de peces y su relacion con variables ambientales, en el sur del Golfo de Mexico.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |