Printer Friendly

Detached Leaf Assay Coupled with Microscopic Conidial Quantification: An Efficient Screening Method for Powdery Mildew Resistance in Pea.

Byline: Muhammad Abubakkar Azmat, Asif Ali Khan, Hafiza Masooma Naseer Cheema, Muhammad Ashraf and Shahid Niaz

Abstract

The genetic resistance in high yielding pea cultivars against powdery mildew provides a cost effective and reliable strategy to reduce the yield losses and save quality of the harvest. The dependable selection of powdery mildew resistant source(s) is the most crucial step in breeding for disease resistance. The efficiency of a simple, reliable and reproducible screening method on detached leaves of pea under controlled environmental condition was evaluated in comparison with field screening under natural conditions. The detached leaf assay coupled with microscopic quantification of susceptibility percentage (%S) appeared ten times more precise and reproducible than field screening based on visual observation of percentage of leaf area affected with disease. A new 0-5 microscopic disease scale proposed here is more robust and stringent for making selections for powdery mildew resistant parents and effectively challenging the segregating populations against different isolates of Erysiphe pisi simultaneously.

The disease scale is based on susceptibility percentage (%S) as a function of percentage of germinated conidia with mycelial growth. For making more precise calculations non germinated conidia without germ tube were not taken in to account. The use of detached leaf assay and microscopic quantification of conidia has provided a simple and reliable screening method to clearly distinguish between escape and resistance mechanisms and the results are not prone to fluctuations in environmental conditions. The assay results were highly correlated (0.993) with the disease severity of whole plants under field conditions; moreover, dCAPS markers have also validated the assay results. Two pea genotypes (It-96 and No. 267) have been selected as highly resistant to powdery mildew, which could be used as a source for breeding disease resistant pea cultivars. (c) 2013 Friends Science Publishers

Keywords: Biotrophs; Erysiphe pisi; In vitro; Legumes; Pisum sativum; Susceptibility; Yield losses

Introduction

Powdery mildew (Erysiphe pisi Syd.) is the most troublesome foliar disease of pea (Pisum sativum) affecting all aerial portions of plants. The incidence of disease induces severe decline (25% to 50%) in green pod yield and produce objectionable odour (Gritton and Ebert, 1975; Dixon, 1978; Reiling, 1984; Agrios, 1988; Azmat et al.,2010).

The use of synthetic fungicides to reduce yield losses is the major practice by pea growers, which has serious implications for human health and a growing threat to environment. The development of genetically resistant cultivars is a cost effective and desirable option to reduce yield losses caused by powdery mildew. The precise selection of powdery mildew resistant source(s) is a pre- requisite for the development of stable powdery mildew resistant and high yielding pea cultivars. Field screening based on natural epidemic of disease is usually employed for making selection of powdery mildew resistant plants in pea. Natural epidemics of powdery mildew usually don't occur every year evenly due to environmental variation leading to erroneous selection of disease resistant source(s).

Moreover, E. pisi is an obligate biotroph (Huckelhoven, 2005), which grow and propagate through haustoria by redirecting the host's metabolism without causing the death of host (Perfect and Green, 2001; Belanger et al., 2002; Mendge and Hahn, 2002). Powdery mildew, downy mildew and rust fungi are phylogenetically unrelated biotrophs that are difficult to culture extensively in vitro. A significant range of variability for pathogenicity, virulence, disease severity and morphological parameters exist among different geographical isolates of the causal organism (Azmat et al.,2012a).

Owing to the dietary importance of pea, as an alternative of animal protein, the yield losses incurred by powdery mildew; the shortcomings of field screening method; the presence of pathogenic variation and most importantly, the obligate biotrophic nature of E. pisi, there is a need of a reliable and reproducible method of screening for powdery mildew.

The current research was undertaken on pea genotypes to check the efficiency and reliability of powdery mildew screening method using detach leaf assay under controlled conditions. A new precise microscopic scale is presented to quantify the disease severity of pea genotypes with more authenticity and reproducibility.

Materials and Methods

Preparation of Powdery Mildew Inoculum

Two highly virulent isolates of powdery mildew MUZ-1 and MUZ-2 (Azmat et al., 2012a) were separately maintained on highly susceptible pea cultivar "Meteor- Faisalabad". When 80-90% leaves were covered with white powdery mass of both the isolates, the leaves were excised and homogenized in 0.1% water-agar and 0.0025% Tween-20 solution (Reeser et al., 1983). The fresh inoculum used for inoculations had 4 x 104 conidia.mL[?]1 (Azmat et al.,2012b).

Field Screening

Seed of 30 pea cultivars belonging to the same maturity group (Azmat et al., 2011) was surface sterilized using 2% Sodium hypochlorite. The seed were sown in the field in a randomized complete block design with two replications. The soil was a well drained silt loam, pH 7.6. The field was well prepared. Synthetic NPK fertilizer was applied by band incorporation at 40N-40P-25K kg ha-1 at bed formation.

The N and P were from urea and diammonium phosphate; K was from muriate of potash. Each genotype was planted on 75 cm wide raised beds with 8 cm space between plants and 35 cm between rows. The cultural practices suggested by Azmat et al. (2011) were carried out for good crop. All the genotypes were inoculated with powdery mildew (E. pisi) inoculum at 8th node stage in water-agar and tween-20 solution (Reeser et al., 1983). An inoculator calibrated to 3.5 x 104*m[?]2 was used for uniform and effective inoculation (Azmat et al., 2012b). Control without powdery mildew inoculation was also maintained.

The data on disease severity were recorded 15 days after inoculation (DAI) on five plants of each genotype from all replications. The disease severity of genotypes was recorded on a 0-9 scale, "0" as highly resistant and "9" as highly susceptible (Warkentin et al., 1996). The disease severity scale is based on percentage of leaf area affected (% I):

0 = no infection, 1 = Less than 1%, 2 = 1%-5%, 3 = 6%-10%, 4 = 11%-20%, 5 = 21%-40%, 6 = 41%-60%, 7 = 61%-80%,8 = 81%-90%, 9 = Greater than 90%.

Detached Leaf Assay

For detach leaf assay 30 pea genotypes were grown separately in sterilized vermiculite containing approximately 200 mL of nutrient solution. The nutrient solution contained 1 mMCaCl2.2H20, 100 mM KCl, 800 mM MgSO4.7H2O, 10 M Fe EDTA, 35 mM H3BO3, 9 mM MnCl2.4H2O, 0.8 mM ZnCl2, 0.5 mM Na2MoO4.2H2O, 0.3 mM CuSO4.5H2O, 800 M KH2PO4, 700 mM Na2HPO4 and 1 mM NH4NO3. The pots were placed in a growth chamber under controlled conditions. A 14 h light period at 22oC and a 10 h dark period at 15oC were maintained in the growth chamber. The relative humidity was maintained at 60% and the light intensity was 400 umol m-2 s-1. There were two replications for each genotype.

At six to eight node stage six leaves from three healthy plants of individual genotypes from each replication were excised. The excised leaves were placed in Petri plates containing 1% agar, 6 mL 5% sucrose solution and 150 mg L[?]1 benzimidazole as a senescence inhibitor. To ensure even distribution of conidia, Petri plates were individually inoculated using a hand-held inoculator maintaining a conidial density of 20-50 spores/mm2. The inoculated leaves were placed adaxial surface up in sealed Petri plates. Control Petri plates for each genotype without powdery mildew inoculation was maintained to check cross infectivity. The Petri plates were placed in growth chamber at 22degC with a 14:10 h light: dark photoperiod with light intensity of 400 umoL m-2 s-1.

Microscopic Quantification of Disease Severity

Forty eight HAI (Hours after Inoculation) the inoculated leaves were placed in de-staining solution (1 lactic acid: 2 glycerol: 1 d2H2O) for 48 h and then stained with Coomassie blue. The stained samples were observed under dissecting microscope using 40X x 10X magnifying lenses. The slides were prepared by placing the adaxial surface of stained leaves upward in mounting medium (50% glycerin) on microscopic slides. The cover slip was placed over the leaves after adding few drops of mounting medium.

For the quantification of disease severity a scale was devised on the basis of susceptibility percentage (%S). The susceptibility percentage was calculated on the basis of successful germination and growth (mycelia development) of E. pisi conidia on pea leaves. Non germinated conidia (Fig. 1a) were not included in data recording. The conidia that were just germinated having germ tube (Fig. 1b) on leaves 48 HAI were considered as "resistant" while germinated conidia having mycelia growth (Fig. 1c) showed "susceptible" disease reaction. The minimum number of conidia (standard) was taken as 190 for each observation. The susceptibility percentage (% S) was calculated using following formula: A 0-5 scale based on susceptibility percentage (% S) is elaborated as under: 0 (Immune) = zero susceptibility, 1 (Highly resistant) = Less than 1-5%, 2 (resistant) = 6-10%, 3 (Moderately susceptible) = 11-40%, 4(Susceptible) = 41-70%, 5(Highly susceptible) = 71-100%.

Statistical Analysis

The experiments were repeated twice and the data recorded for each experiment were pooled due to significant homogeneity. All the values given here are the arithmetic means of two replications. Statistical analyses were carried out using Microsoft Excel (QI Macros) and MVSP 3.1 (Kovach Computing Services, Anglesey, Wales).

dCAPS (derived Cleaved Amplified Polymorphic

Sequences) Validation

The DNA from three highly resistant (It-96, No.267 and No. 20171) genotypes and one powdery mildew susceptible pea genotype (Meteor-Fsd) was extracted from the leaves using modified CTAB method (Azmat et al., 2012c). The genomic DNA was subjected to dCAPS validation of the assay results. The primers used for the validation included, dCAPS-HphI (AGGCACTTGAGCATGTGGGCTCGGT), dCAPS-Ple1 (AGGCACTTGAGCATGTGGGCTGAGT) and dCAPS-Tth111I (AGGCACTTGAGCATGTGGACTCAGT). The primer dCAPS- HphI and the corresponding restriction enzyme (HphI) cut the powdery mildew resistant genotypes only, while dCAPS-Ple1 and dCAPS-Tth111I were designed to cut corresponding DNA amplification of powdery mildew susceptible genotypes only.

Results

Field Screening

Significant variability for disease severity was observed among the genotypes. In response to field screening based on percentage of leaf area affected with powdery mildew, all the genotypes were broadly classified into six groups (Fig. 2). Of the 30 genotypes 16 were resistant of which only two (It-96 and No. 267) showed "immune" disease reaction and one was "highly resistant" (Acc. 20171). Among 14 susceptible genotypes, one was "highly susceptible" (Meteor-VRI) while 10 were ranked as "susceptible" (Table 1).

The SD (standard deviation) and SE (standard error) estimates for % I (Percent Infection on leaves) for individual experiment were recorded as 36.63 and 8.19; 35.48 and 7.94, respectively for field experiment 1 and 2. The difference in the infection percentage (D% I) among two independent experiments ranged from 0-14% with an average of 4.97%. The SD and SE estimates for D% I among two experiments were 3.34 and 0.61, respectively (Table 1).

Detached Leaf Assay

The disease score data based on susceptibility percentage (%S) have classified 30 pea genotypes into six main groups with susceptibility score ranging from 0-5. Only two genotypes (It-96 and No.267) were highly

Fig. 1: Stages of Erysiphe pisi conidia stained with coomassie blue 48 HAI under dissecting microscope using 40x10 magnifying lenses; (a) Non-germinated conidia (b) Germinated conidia with germ tube without mycelial growth (c) Germinated conidia with mycelial growth resistant as minimum number of germinated conidia without mycelia (1% and 0.83%) were quantified microscopically on their leaves, respectively. The maximum conidia with mycelia growth were observed on the leaves of cv. Climax (97.6%), Meteor-VRI (96.6%), KQP-6185 (95.1%) and PF-400 (95%). The "highly susceptible" genotypes with 71-100 %S made the 2nd largest group of genotypes followed by "moderately susceptible" genotypes with 11-40 %S (Fig. 3).

Following %S 13 genotypes (9057, 9370, 9375, 10609, 10612, 18412, 19598, 19611, 19727, 19782, 20152, 19616 and No. 380) that were ranked as resistant on the basis of field screening have emerged as susceptible to powdery mildew (Table 1 and 2). Among all the genotype "% S" ranged from 0.83-97.58 with an average of 46.94. A negligible difference in "%S" (0.02-1.15) was observed among independent observations of each experiment with an average difference of 0.47. The estimates for SD and SE for each experiment were the same to the average values of both experiments i.e., the values of SD and SE were 36.7 and 6.71; 36.65 and 6.7, respectively for lab experiment 1 and 2. The values of SD and SE For "D% S" among the observation of two experiments were 0.35 and 0.06, respectively (Table 2).

The SE estimates between the values of two field experiments conducted under natural conditions were higher (2.54) than those conducted under controlled conditions (0.24) in growth chamber (Table 1 and 2). Moreover, the results of detached leaf assay coupled with microscopic disease quantification were highly correlated (0.993) with the disease response of whole plants in the field screening under natural conditions. The dCAPS markers have also validated the results of detached leaf assay. As expected dCAPS- HphI and the corresponding restriction enzyme digested the amplification products of powdery mildew resistant genotypes only (Fig. 4). The amplification products of powdery mildew resistant genotypes remained un- digested by using dCAPS-Ple1 and dCAPS-Tth111I (along with corresponding restriction enzymes), hence confirming the results of detached leaf assay (Fig. 4).

Table 1: Response of 30 pea genotypes to Erysiphe pisi under field conditions, 15 DAI using 0-9 scale of Warkentin et al. (1996) in two independent experiments =The values for resistant cultivars are given in bold font, =The values for susceptible cultivars are given in normal font. The abbreviations used are % I = Percentage of leaf area affected with powdery mildew, DAI= Days after infection, SEa= Standard Error of values within experiment, SEb= Standard Error of values between experiments Fig. 2: Disease response groups of pea genotypes on the basis of average percentage of leaf area affected (%I) under field conditions 15 DAI

Genotype###Field Experiment 1###Field Experiment 2###Mean % I###Mean Score###Delta % I###SEb

###%I###Score###%I###Score

Climax###91###9###83###8###87###8###8###4.0

It-96###0###0###0###0###0###0###0###0

KQP-6121###81###8###75###7###78###7###6###3.0

KQP-6173###83###8###82###8###82.5###8###1###0.5

KQP-6185###93###9###86###8###89.5###8###7###3.5

Meteor-VRI###92###9###93###9###92.5###9###1###0.5

No. 267###0###0###0###0###0###0###0###0

No. 380###9###3###11###4###10###3###4###1.0

P1###83###8###87###8###85###8###4###2.0

PF-400###92###9###86###8###89###8###6###3.0

Premium###83###8###78###7###80.5###7###5###2.5

9057###11###4###3###2###7###3###8###4.0

9370###14###4###5###2###9.5###3###9###4.5

9375###9###3###13###4###11###4###4###2.0

10609###11###4###9###3###10###3###2###1.0

10612###17###4###9###3###13###4###8###4.0

10649###86###8###72###7###79###7###14###7.0

18293###17###4###29###5###23###5###12###6.0

18412###15###4###11###4###13###4###4###2.0

19598###13###4###19###4###16###4###6###3.0

19611###11###4###13###4###12###4###2###1.0

19616###43###6###39###5###41###6###4###2.0

19727###19###4###15###4###17###4###4###2.0

19750###14###4###21###5###17.5###4###7###3.5

19782###11###4###7###3###9###3###4###2.0

20126###33###5###41###6###37###5###8###4.0

20152###11###4###9###3###10###3###2###1.0

20171###7###3###4###2###5.5###2###3###1.5

9800-10###83###8###87###8###85###8###4###2.0

9800-5###87###8###85###8###86###8###2###1.0

Min###0###0###0###0###0###0###0###0

Max###93###9###93###9###92.5###9###14###7.02

Ave###40.63###5.33###39.07###4.97###39.85###5###4.97###2.54

SD###36.62###2.62###35.48###2.57###35.94###2.51###3.34###1.69

SEa###8.19###0.59###7.94###0.57###8.04###0.56###0.61###0.31

=The values for resistant cultivars are given in bold font, =The values for susceptible cultivars are given in normal font. The abbreviations used are % I

= Percentage of leaf area affected with powdery mildew, DAI= Days after infection, SEa= Standard Error of values within experiment, SEb= Standard

Error of values between experiments

Discussion

Regardless the nature and number of gene(s) governing powdery mildew resistance in pea, the development of high yielding and disease resistant cultivars is a lengthy procedure. Therefore, a simple, reliable and reproducible

Table 2: Response of pea genotypes to Erysiphe pisi48 HAI using detached leaf assay coupled with microscopic quantification of disease on a 0-5 scale under controlled condition in two independent experiments

Genotype###Lab Experiment 1###Lab Experiment 2###Mean % S###Mean % S###SEb

###Total conidia###Conidia with Mycelia###% S###Total conidia Conidia with mycelia###% S###Score

Climax###267###261###97.75###193###188###97.41###97.58###5###0.34###0.17

It-96###293###2###0.68###225###3###1.33###1.01###1###0.65###0.33

KQP-6121###314###278###88.54###311###274###88.10###88.32###5###0.43###0.22

KQP-6173###219###198###90.41###217###198###91.24###90.83###5###0.83###0.42

KQP-6185###242###229###94.63###253###242###95.65###95.14###5###1.02###0.51

Meteor-VRI###301###291###96.68###267###258###96.63###96.65###5###0.05###0.02

No. 267###307###3###0.98###291###2###0.69###0.83###1###0.29###0.15

No. 380###248###47###18.95###261###47###18.01###18.48###3###0.94###0.47

P1###270###253###93.70###253###237###93.68###93.69###5###0.03###0.01

PF-400###198###189###95.45###237###224###94.51###94.98###5###0.94###0.47

Premium###213###190###89.20###241###216###89.63###89.41###5###0.42###0.21

9057###221###35###15.84###197###31###15.74###15.79###3###0.10###0.05

9370###224###39###17.41###257###45###17.51###17.46###3###0.10###0.05

9375###231###56###24.24###305###73###23.93###24.09###3###0.31###0.15

10609###228###43###18.86###316###59###18.67###18.77###3###0.19###0.09

10612###211###47###22.27###207###47###22.71###22.49###3###0.43###0.22

10649###273###237###86.81###279###239###85.66###86.24###5###1.15###0.58

18293###245###67###27.35###281###77###27.40###27.37###3###0.06###0.03

18412###312###44###14.10###274###41###14.96###14.53###3###0.86###0.43

19598###231###65###28.14###209###60###28.71###28.42###3###0.57###0.29

19611###253###37###14.62###239###35###14.64###14.63###3###0.02###0.01

19616###306###147###48.04###287###140###48.78###48.41###4###0.74###0.37

19727###287###49###17.07###313###57###18.21###17.64###3###1.14###0.57

19750###255###50###19.61###272###54###19.85###19.73###3###0.25###0.12

19782###243###43###17.70###261###46###17.62###17.66###3###0.07###0.04

20126###251###132###52.59###254###134###52.76###52.67###4###0.17###0.08

20152###271###72###26.57###249###65###26.10###26.34###3###0.46###0.23

20171###235###14###5.96###283###18###6.4###6.16###2###0.40###0.20

9800-10###287###253###88.15###291###258###88.66###88.41###5###0.51###0.25

9800-5###254###239###94.09###221###209###94.57###94.33###5###0.48###0.24

Min###198###2###0.68###193###2###0.69###0.83###1###0.02###0.01

Max###314###291###97.75###316###274###97.41###97.58###5###1.15###0.58

Ave###256.33###120.33###46.88 258.13###119.23###46.99###46.94###3.63###0.47###0.24

SD###33.04###97.52###36.70###34.69###92.41###36.65###36.67###1.22###0.35###0.18

=The values for resistant cultivars are given in bold font, =The values for susceptible cultivars are given in normal font. The abbreviations used are %

S = Susceptibility percentage, HAI= Hours after infection, SEa= Standard Error of values within experiment, SEb= Standard Error of values between

experiments

Fig. 3: Six groups of pea genotypes on the basis of susceptibility percentage (%S) against powdery mildew using detached leaf assay and quantitative disease scale method of identifying resistant plants is imperative for a successful breeding program. Field screening method is preferred, because of its ease to execute, although it has many serious limitations. Detached leaf assay has been used for disease resistance screening in different crops including barley (Edwards, 1983), tobacco (Rufty et al.,1987), peanuts (Foster et al., 1980) and beans (Tu, 1986). There are many advantages of detach leaf assay as it provides a reliable method of screening for foliar diseases under controlled atmospheric conditions.

Two different disease screening and scoring methods for powdery mildew resistance in pea were evaluated.

Fig. 4: dCAPS markers validating the results of detached leaf assay, Where 1= It-96, 2= No.267, 3= No. 20171 and 4= Meteor-Fsd

Sixteen of 30 pea genotypes were ranked as resistant in response to field screening on the basis of disease scale reported by Warkentin et al. (1996).When these genotypes were challenged by the same isolates of powdery mildew under controlled atmospheric conditions using detached leaf assay and were classified using microscopic disease quantification scale,13 (9057, 9370, 9375, 10609, 10612, 18412, 19598, 19611, 19727, 19782, 20152, 19616 and No.380) of 16 resistant genotypes were placed in different classes of susceptibility. The detached leaf assay coupled with microscopic quantification of conidia is an effective method of screening for resistance against powdery mildew in pea. The statistical attributes of data have shown that results obtained by counting germinated conidia with/without mycelial growth on detached leaves are 10 times more precise and reproducible as compared to just visual assessment of percentage of leaf area affected with powdery mildew as in case of field screening.

Different explanations for such results can be speculated viz.,(i) by employing field screening it is difficult to distinguish between the escape and resistance mechanism (Azmat et al.,2012a); while no such risk is involved in detached leaf assay as it is based on precise counting of germinated conidia only. (ii) Chances of human error are more in visual assessment of disease scoring which is not an issue in detached leaf assay, as precise counting of conidia with mycelial growth is done in this method, (iii) Under field conditions, the results of powdery mildew screening can be misleading even if uniform application of inoculum had been ensured due to unpredictable fluctuations in weather. While in case of detached leaf assay atmospheric conditions were optimized for having maximum disease severity, (iv) For precise selection of powdery mildew resistant pea genotypes a more robust and strict scale was devised.

On the basis of the scale reported here, only the genotypes having 0-10% susceptibility were considered as resistant, while the scale provided by Warkentin et al. (1996) was more relaxed where genotypes with 0-20% leaf area affected with disease were selected as resistant.

Two genotypes It-96 and No. 267 have shown highly resistant diseases response to E. pisi using detached leaf assay based on microscopic quantification of disease susceptibility. The resistant genotypes selected on the basis of newly devised more robust scale can be effectively used in breeding programs to incorporate powdery mildew resistance in well adapted high yielding pea cultivars. Detached leaf assay can also be used effectively for the screening of individual plants from segregating populations against different isolates of E. pisi simultaneously. The use of detached leaf assay along with microscopic quantification of disease has the potential to reduce the erroneous selection of resistant plants due to escape mechanism.

Reference

Agrios, G.N., 1988. "Plant Pathology", 3rd edition. Academic Press, San Diego, California, USA

Azmat, M.A., A.A. Khan, A. Saeed, M. Ashraf and S. Niaz, 2012a. Pathogenicity and Characterization of Geographically Distributed Isolates of Erysiphe polygoni , Int. J. Veg. Sci., 18: 211-222

Azmat, M.A., A.A. Khan, A. Saeed, M. Ashraf and S. Niaz, 2012b. Screening pea germplasm against Erysiphe polygoni for disease severity and latent period. Int. J. Veg. Sci., 18: 153-160

Azmat, M.A., I.A. Khan, H.M.N. Cheema, I.A. Rajwana, A.S. Khan and A.A. Khan, 2012c. Extraction of DNA suitable for PCR applications from mature leaves of Mangifera indica L. J. Zhejiang Univ. Sci. B.,13: 239-243

Azmat, M.A., N.N. Nawab, A.A. Khan, M. Ashraf, S. Niaz and K.Mahmood, 2011. Characterization of pea germplasm. Int. J. Veg. Sci., 17: 246-258

Azmat, M.A., N.N. Nawab, S. Niaz, A. Rashid, K. Mahmood, A.A. Khan and S.H. Khan, 2010. Single recessive gene controls powdery mildew resistance in pea. Int. J. Veg. Sci., 16: 278-286

Belanger, R.R., W.R. Bushnell, A.J. Dik and W. Carver, 2002. The Powdery Mildews: A Comprehensive Treatise. American Phytopathology Society, St. Paul, Minn

Dixon, G.R., 1978. Powdery mildews of vegetable and allied crops. In: The Powdery Mildews, pp: 502-506. Spencer, D.M. (ed.). Academic Press, London

Edwards, H.H., 1983. The effect of kinetin, abscisic acid and cations on host parasite relations of barley (Hordeumvulgare) inoculated with Erysiphegraminis f. sp. Hordei. Phytopathol. Z., 107: 22-30

Foster, D.J., J.C. Wynne and M.K. Beute, 1980. Evaluation of detached leaf culture for screening peanuts for leaf spot resistance. Peanut Sci., 7: 98-100

Gritton, E.T. and R.D. Ebert, 1975. Interaction of planting date and powdery mildew on pea plant performance. J. Amer. Soc. Hort. Sci., 100: 137-142

Huckelhoven, R., 2005. Powdery mildew susceptibility and biotrophic infection strategies. FEMS Microbial. Lett., 245: 9-17

Mendgen, K. and M. Hahn, 2002. Plant infection and the establishment of fungal biotrophy. Trend. Plant Sci., 7: 352-356

Perfect, S.E. and J.R. Green, 2001. Infection structures of biotrophic and hemibiotrophic fungal plant pathogens. Mol. Plant Pathol., 2: 101- 108

Reeser, P., D. J. Hagedorn and D.I. Rouse, 1983. Quantitative inoculations with Erysiphe pisi to assess variation of infection efficiency on peas. Phytopathology, 73: 1238-1240

Reiling, T.P., 1984. Powdery mildew. In: Compendium of Pea Diseases, pp: 21-22. Hagedorn, D.J. (ed.). The American Phytopathological Society, St. Paul, Minnesota, USA

Rufty, R.C., E.A. Wernsman and G.V. Jr. Gooding, 1987. Use of detached leaves to evaluate tobacco haploids for resistance to tobacco mosaic virus. Meloidogyne incognita, and Pseudomonas syringaepv. Tabaci. Phytopathology, 77: 60-62

Tu, J.C., 1986. A detached leaf technique for screening beans (Phaseolus vulgaris) in vitro against anthracnose (Colletotrichum lindemuthianum). Can. J. Plant Sci., 66: 805-810

Warkentin, T.D., K.Y. Rashid and A.G. Xue, 1996. Fungicidal control of powdery mildew in field pea. Can. J. Plant Sci., 76: 933-935

Department of Plant Breeding and Genetics, University of Agriculture, Faisalabad, Pakistan

Department of Botany, University of Agriculture, Faisalabad, Pakistan

Vegetable Research Institute, AARI, Faisalabad, Pakistan

For correspondence: knnike@yahoo.com; asifpbg@uaf.edu.pk

To cite this paper: Azmat, M.A., A.A. Khan, H.M.N. Cheema, M. Ashraf and S. Niaz, 2013. Detached leaf assay coupled with microscopic conidial quantification: an efficient screening method for powdery mildew resistance in pea. Int. J. Agric. Biol., 15: 957-962
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Azmat, Muhammad Abubakkar; Khan, Asif Ali; Masooma, Hafiza; Cheema, Naseer; Ashraf, Muhammad; Niaz,
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9PAKI
Date:Oct 31, 2013
Words:4644
Previous Article:New Records of Uredinales (Basidiomycota) from Azad Jammu and Kashmir and Adjacent Northern Areas of Pakistan.
Next Article:Design and Analysis of Full-state Feedback Controller for a Tractor Active Suspension: Implications for Crop Yield.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |