Printer Friendly

Defense genes, enzymatic activity and capsidiol content in CM-334 chilli pepper inoculated with Phytophthora capsici/Genes de defensa, actividad enzimatica y contenido de capsidiol en chile CM-334 inoculado con Phytophthora capsici/Gens de defesa, atividade enzimatica e conteudo de capsidiol na pimenta CM-334 inoculada com Phytophthora capsici.

SUMMARY

In order to provide information about the mechanisms that restrict colonization and reproduction of Phytophthora capsici in roots of CM-334 chilli pepper resistant to the oomycete, the present study aimed 1) to compare the accumulation of POX (peroxidase), GLU ([beta]-1,3 glucanase), PR-1 (PR1 protein) and EAS (5-epi-aristolochene synthase) gene transcripts, and 2) to compare the total enzymatie activity of peroxidases and glucanases, and the total capsidol content, in roots of CM334 pepper inoculated or not with the oomycete. In CM-334 pepper roots inoculated with P. capsici the relative levels of POX, GLU and PR-1 were significantly increased from 6h post-inoculation (hpi), and the largest increases in compari son with the non-inoculated plants (15.4, 10.1 and 8.5 times, respectively) were recorded at 48hpi. EAS increased considerably from 6hpi (16.3 times), but in contrast to the other genes the accumulation maximum (23 times) was observed at 12hpi. The activity of glucanases and peroxidases increased as time after oomycete inoculation progressed and for both enzymes the increase was significant (P<-0.05) at 12, 24 and 48hpi. The capsidiol content of inoculated CM-334 plants was significantly higher (P<-0.05) with respect to non-inoculated plants, with increments of 69. 7, 165.1, 259.1 and 386. 7% at 6, 12, 24 and 48 hpi, respectively.

RESUMEN

Con la finalidad de aportar informacion de los mecanismos que restringen la colonizacion y reproduccion de Phytophthora capsici en raices de chile CM-334 resistente al oomiceto, el presente estudio tuvo por objetivos: 1) comparar la acumulacion de transcritos de los genes POX (peroxidasa), GLU ([beta]-1,3 glucanasa), PR-I (proteina PR1) y EAS (5-epi-aristoloqueno sintasa); y 2) comparar la actividad enzimatica total de peroxidasas y glucanasas, y el eontenido de capsidiol, en raiees de chile CM-334 inoculadas y no inoculadas con el oomiceto. En las raices de CM-334 inoculadas con P. capsici se incrementaron de manera significativa los niveles relativos de POX, GLU y PR-1 desde las 6h posteriores a la inoculacion (hpi), y los mayores incrementos (15,4; 10, 1 y 8,5 veces, respectivamente) se registraron a las 48 hpi en comparacion con las plantas no inoculadas. EAS se incremento considerablemente desde las 6 hpi (16,3 veees), pero a diferencia de los otros genes la maxima acumulacion (23 veces) se registro a las 12 hpi. La actividad de glucanasas y peroxidasas se incremento a medida que transcurrio el tiempo posterior a la inoculacion con el oomiceto y para ambas enzimas el incremento de su actividad fue significativo (P [menor que o igual a] 0,05) a las 12, 24 y 48 hpi. El contenido de capsidiol en plantas CM-334 inoculadas fue significativamente mayor (P [menor que o igual a] 0,05) respecto a las plantas no inoculadas; los incrementos fueron de 69, 7; 165, 1; 259,1 y 386, 7% a las 6, 12, 24 y 48 hpi, respectivamente.

RESUMO

Com a finalidade de aportar informacao dos mecanismos que restringem a colonizacao e reproducao de Phytophthora capsici em raizes de pimenta CM-334 resistente ao oomiceto, o presente estudo teve por objetivos: 1) comparar a acumulacao de transcritos dos genes POX (peroxidase), GLU ([beta]-1,3 glucanase), PR-1 (proteina PR1) e EAS (5-epi-aristoloqueno sintasa); e 2) comparar a atividade enzimatica total de peroxidases e glucanases, e o conteudo de capsidiol, em raizes de chile CM334 inoculadas e nao inoculadas com o oomiceto. Nas raizes de CM-334 inoculadas com P. capsici se incrementaram de maneira significativa os niveis relativos de POX, GLU e PR-I desde as 6h posteriores a inoculacao (hpi), e os maiores incre mentos (15,4; 10,1 e 8,5 vezes, respectivamente) se registraram as 48 hpi em comparacao com as plantas nao inoculadas. EAS se incrementou consideravelmente desde as 6 hpi (16,3 vezes), mas a diferenca dos outros genes a maxima acumulacao (23 vezes) se registrou as 12 hpi. A atividade de glucanases e peroxidases se incrementou a medida que transcorreu o tempo posterior a inoculacao com o oomiceto e para ambas enzimas o incremento de sua atividade foi significativo (P [less than or equal to] 0,05) as 12, 24 e 48 hpi. O conteudo de capsidiol em plantas CM-334 inoculadas foi significativamente maior (P [less than or equal to] 0,05) em relacao as plantas nao inoculadas; os incrementos foram de 69,7 165,1; 259,1 e 386, 7% as 6, 12, 24 e 48 hpi, respectivamente.

PALABRAS CLAVE / Capsicum annuum / Capsidiol / EAS / Genes de Defensa / [beta]- 1,3 Glucanasas l Peroxidasas / Phytophthora capsici / Proteina PR-1 / Proteinas Relacionadas con Patogenesis /

Recibido: 31/01/2011. Modificado: 19/03/2012. Aceptado: 23/03/2012.

Introduccion

En Mexico, el chile (Capsicum annuum L.) es una especie horticola de gran importancia economica y social. Sin embargo, un factor limitante en la productividad del cultivo es la marchitez causada por el oomiceto Phytophthora eapsici Leo. (Gonzalez et al., 2004). El control se ha realizado mediante practicas culturales y el empleo de fungicidas sinteticos; no obstante, se considera que el uso de variedades resistentes representa una estrategia amigable con el ambiente para el manejo de esta enfermedad y de otras inducidas por fitopatogenos con origen en el suelo (Perez et al., 1990). La linea Criollo de Morelos 334 (CM-334) del chile tipo serrano, es altamente resistente al oomiceto y su resistencia se ha mantenido aun cuando se ha inoculado con las cepas mas virulentas (Bonnet et al., 2007; Kim y Kim, 2009) y actualmente sele considera como el resistente universal a P. capsici (Oelke et al., 2003; Glosier et al., 2008).

Las plantas, como resultado del proceso de coevolucion con sus patogenos, han desarrollado diferentes mecanismos de defensa contra ellos, tanto de tipo constitutivo como inducido. Los mecanismos constitutivos incluyen barreras fisicas (como la cuticula y la pared celular) y compuestos toxicos preexistentes que inhiben el crecimiento del patogeno. Los inducidos se disparan en el momento en que el patogeno intenta invadir al hospedante y consisten en la formacion de barreras fisicas (como capas de corcho y deposicion de calosa, entre otras), la acumulacion de compuestos toxicos como las fitoalexinas y produccion de proteinas relacionadas con la patogenesis (PRs), todo lo anterior como resultado de la activacion de la expresion de genes. En algunos casos la planta presenta una respuesta de hipersensibilidad (RH), la cual es considerada la maxima expresion de resistencia (Fernandez et al., 1998; Sepulveda et al., 2003). Todas las plantas, tanto susceptibles como resistentes, poseen dichos mecanismos, y la compatibilidad e incompatibilidad hospedante-patogeno esta determinada por el grado de coordinacion entre las diferentes estrategias de defensa, la rapidez y la magnitud con la que ocurre la expresion de genes que codifican para las enzimas involucradas en la sintesis de metabolitos que forman barreras fisicas y quimicas que restringen el crecimiento y reproduccion del patogeno (Silvar et al., 2008).

En el caso particular de materiales de chile resistentes a P. capsici, la evidencia experimental hasta ahora generada indica que su resistencia al oomiceto puede explicarse por diferentes mecanismos que involucran: incrementos en la actividad de las enzimas [beta]-1,3 glucanasa (Egea et al., 1999), fenil alanina amonio liasa (PAL) y peroxidasas acidicas; cambios en compuestos fenolicos con propiedades toxicas (Candela et al., 1995; Fernandez, 1997); e incremento en la sintesis de la fitoalexina capsidiol (Egea et al., 1996a). Ademas de los transcritos de la PR [beta]-1,3 glucanasa (de la familia PR-2), tambien se han reportado incrementos rapidos y abundantes de transcritos de otras PRs que son miembros de las familias PR-1, PR-3 (quitinasas) y PR-9 (peroxidasas); y por consiguiente se ubican como parte fundamental de los mecanismos de defensa contra el oomiceto (Egea et al., 1999; Kim y Hwang, 2000; Hong y Hwang, 2005). Las PRs en general se consideran como uno de los principales mecanismos de defensa de las plantas (Van Loon et al., 2006).

El capsidiol es la fitoalexina sesquiterpenica mas importan te en chile y su acumulacion en las zonas de infeccion inhibe o restringe el crecimiento de P. capsici durante la interaccion incompatible P. capsici-chile (Egea et al., 1996a; Candela et al., 2000). La enzima clave en la biosintesis de la fitoalexina es la 5-epi-aristoloqueno sintasa, codificada por el gen PEAS (Zavala et al., 2000).

Con base en lo anterior y con la idea de aportar informacion que ayude al entendimiento de los mecanismos que restringen la colonizacion y reproduccion de P. capsici en las raices de plantas de chile CM-334, el presente estudio tuvo por objetivos: 1) comparar mediante PCR en tiempo real la acumulacion de transcritos de los genes POX, GLU, PR-1 y EAS, relacionados con la defensa, y 2) comparar la actividad enzimatica total de peroxidasas y glucanasas, y el contenido de capsidiol, en raices de plantas de chile CM-334 inoculadas y no inoculadas con el oomiceto.

Materiales y Metodos

Establecimiento de los experimentos

Plantulas de chile CM-334 se crecieron en macetas conteniendo arena esterilizada y se mantuvieron en camara de crecimiento a 26 [+ o -][grados]C con un fotoperiodo de 14h luz y 10h oscuridad. El aislamiento 6143 de P. capsici usado en este trabajo fue proporcionado por Sylvia Patricia Fernandez-Pavia, Universidad Michoacana de San Nicolas de Hidalgo, Mexico. EI cultivo del oomiceto, la induccion de la esporulacion y la cuantificacion de zoosporas se realizo de acuerdo a lo reportado por Villar et al. (2009). En cada ensayo se tuvieron dos tratamientos, plantas inoculadas con P. capsici y plantas testigo (no inoculadas), y para cada tratamiento se establecieron 52 plantas. Las plantas se inocularon con 300000 zoosporas cuando presentaron 5-6 bojas verdaderas. Para corroborar tanto la patogenicidad del aislamiento como la eficacia de la inoculacion, 10 plantas de chile del cv. J.E. Parker susceptible a P. eapsici fueron tambien inoculadas. El experimento completo se repitio una vez. A las 6, 12, 24 y 48h posteriores a la inoculacion (bpi) conel oomiceto, de cada tratamiento se tomaron 13 plantas para cada tiempo, se cortaron las raices, se lavaron, se congelaron con N2 liquido y se almacenaron a -80[grados]C.

Extraccion de RNA, sintesis de cDNA y PCR en tiempo real

El RNA total de raices de chile se extrajo a partir de 0,5g de tejido congelado usando el Kit RNeasy[R] (QIAGEN) de acuerdo con las indicaciones del fabricante. El RNA se almaceno a -80[grados]C. La calidad e integridad del RNA se verifico en gel de agarosa desnaturalizante al 1,2%.

La sintesis de cDNA se realizo en dos pasos: 1) la primera mezcla de reaccion estuvo constituida por 2 [micron]g de RNA total; 0,4 [micron]l de oligo [dT.sub.12-18] (Invitrogen[R]), se aforo a un volumen de 12 [micron]g con agua libre de RNAsas y DNAsas y se incubo a 70[grados]C por 10min, y al terminar se coloco la mezcla en hielo; 2) a la primera mezcla de reaccion se le adicionaron 8 [micron]l de una segunda mezcla, la cual contenia 4 [micron]l de amortiguador 5x para retrotranscripcion, 2[micron]l de ditiotreitol 0,1M; 1[micron]l dNTP mix 10mM y [[micron]l de la retro-transcriptasa (M-MLV Reverse transcriptase, Promega[R]). La mezcla se coloco en un termociclador (BIO-RAD[R]) durante 60min a 37[grados] y 10min a 70[grados]C.

Los pares de oligonucleotidos utilizados en el estudio se muestran en la Tabla I. Con excepcion de aquellos para el gen PR-1, los demas se disenaron usando el programa DNASTAR[R] a partir de las secuencias de genes disponibles en el GenBank del NCBI. La mezcla de reaccion de PCR en tiempo real consistio de 2,5 [micron]l de buffer 10 x para PCR; 1,25[micron]l de Mg[Cl.sub.2] 30mM; 1[micron]l de 10pM de cada primer; l[micron]l de dNTP mix 10mM; 1:150000 SYBR[R] Green (Molecular Probe, Eugene, OR); 0,25[micron]l de fluoresceina 1[micron]M; 1,5[micro]l de cDNA; 0,125[micron]l de Amplicasa (Biogenica[R]), y se aforo a un volumen de 25p.1 con agua libre de RNAsas y DNAsas, en un sistema estandar de PCR en tiempo real ABI7500 (Applied Biosystems). Las condiciones de amplificacion consistieron en una desnaturalizacion inicial a 94[grados]C/4min, seguido de 30 ciclos a 94[grados]C/30s, 60[grados]C/30s y 72[grados]C/30s, y un paso final de extension a 72[grados]C/4min. La especificidad de los oligonucleotidos se corroboro mediante el analisis de las curvas de disociacion y por la secuenciacion de los productos de PCR obtenidos. El gen de gliceraldehido 3-P deshidrogenasa (GAPDH) se uso como gen de expresion constitutiva para normalizar la expresion y las plantas no inoculadas representaron la expresion 1 x del gen de interes. El calculo de la expresion relativa de cada gen se realizo mediante el metodo [2.sup.[DELTA][DELTA]Ct] (Livak y Schmittgen, 2001). Para cada tratamiento se realizaron seis determinaciones por tiempo evaluado.

Extraccion de proteina y actividad de peroxidasas

La extraccion de proteina se realizo a partir de 0,2g de tejido macerandolo en un mortero que contenia buffer frio de Tris-HCL 50mM; pH 7,5. El extracto se centrifugo a 12000g a 4[grados]C por 5min y el sobrenadante recuperado se almaceno a -20[grados]C. La concentracion de proteinas se determino con el Kit Protein Assay (Bio-Rad Laboratories, EEUU) para lo cual se utilizo albumina serico-bovina, fraccion V (Sigma), como estandar. La actividad de peroxidasas se determino con el incremento de absorbancia a 470nm debido a la formacion de tetraguaiacol (Hammerschmidt et al., 1982). La mezcla de reaccion consistio de 220 [micron]l de amortiguador de Tris-HCl 50mM, pH 7,5; 15[micron]l de peroxido de hidrogeno 0,25%; 25[micron]l de guaiacol 0,1M; y 5[micron]g de proteina total. La actividad enzimatica se reporto como [micron]moles de tetraguaiacol / [micron]g de proteina. Se realizaron dos extracciones por cada tiempo de cada tratamiento, y cada extraccion se cuantifico por triplicado.

Extraccion de proteina y actividad de glucanasas

Se macero 0,25g de tejido de raices usando como buffer acetato de sodio 0,05M; pH 5,2. El extracto se centrifugo a 15000g a 4[grados]C por 10min y el sobrenadante recuperado se almaceno a -20[grados]C. La actividad de [beta]-1,3 glucanasas se determino usando el ensayo de laminarina-acido dinitrosalicilico de Abeles y Forrence (1970) con algunas modificaciones. A 25[micron]l de extracto crudo de la enzima se le adiciono 25 [micron]l de laminarina 1% y se incubo a 40[grados]C durante 10min. La reaccion se detuvo adicionando 375 [micron]l de acido dinitrosalicilico y calentando por 5min en agua hirviendo (100[grados]C). Enfriada la solucion esta, se agito en vortex y se leyo la absorbancia a 500nm. El blanco consistio del extracto de la enzima y laminarina al tiempo cero de incubacion. La reduccion de azucar se calculo usando una curva estandar de glucosa. Una unidad de actividad de [beta]-1,3-glucanasa se definio como la cantidad de enzima que libera 1[micron]mol de glucosa por 10min, bajo las condiciones arriba citadas (Pan et al., 1991). Se realizaron dos extracciones por cada tiempo de cada tratamiento, y cada extraccion se cuantifico por triplicado.

Extraccion y cuantificacion de capsidiol

El capsidiol se extrajo de acuerdo al metodo descrito por Egea et al. (1996b), con algunas modificaciones. De cada tratamiento y tiempo se tomo una muestra de 0,5g de tejido radical, se macero por 30s en [N.sub.2] liquido y posteriormente por 1min en una mezcla 2:1 de cloroformo:metanol. Cada extracto se filtro y evaporo a sequedad a temperatura ambiente y se disolvio nuevamente en cloroformo para su analisis por cromatografia en capa fina, la cual se desarrollo con una mezcla 1:6 de hexano:acetato de etilo, utilizando placas cromatograficas de silica gel 60 [F.sub.254] (Merck[R]). Las muestras fueron cromatografiadas en banda y eluidas conjuntamente con una muestra de capsidiol puro. Se recorto la porcion correspondiente al estandar, la cual se revelo con una disolucion de sulfato cerico amoniacal 2N en [H.sub.2]S[O.sub.4] y se confronto fisicamente con la porcion eluida y no revelada de cada tratamiento, las regiones correspondientes al Rf=0,28 caracteristico del capsidiol se rasparon, se lavaron con cloroformo, se filtraron y evaporaron a sequedad.

La estimacion del contenido de capsidiol se realizo segun el metodo descrito por Chavez y Lozoya (1996), con algunas modificaciones. Las muestras se disolvieron en 250 [micron]l de metanol, y para la cuantificacion se preparo una mezcla de reaccion de extracto y vainillina 2% en acido sulfurico en proporcion 1:1, la cual se incubo a temperatura ambiente durante 40min y posteriormente se leyo a una longitud de onda de 640nm en un Nanodrop[R]. Para la cuantificacion de la fitoalexina se utilizo una curva estandar previamente preparada con concentraciones conocidas de capsidiol puro, aislado e identificado por nuestro grupo de investigacion (Villar et al., 2009).

Analisis estadistico

Los datos obtenidos se sometieron a analisis de varianza para un modelo completamente al azar con el paquete estadistico SAS (1999), y para la comparacion de medias de tratamiento se aplico la prueba de Tukey (P[menor que o igual a]0,05).

[FIGURA 1 OMITIR]

Resultados

Niveles relativos de genes relacionados con la defensa

En comparacion con las plantas testigo (no inoculadas), en raices de chile CM-334 tratadas con P. capsici, se registro una acumulacion significativamente mayor de transcritos de los genes EAS (5-epi-aristoloqueno sintasa), POX (peroxidasa), GLU ([beta]-1,3 glucanasa) y PR-1 (proteina PR1). De entre de ellos el gen EAS presento el mayor incremento, 23 veces con respecto al testigo (Figura 1). Los transcritos de los genes POX, GLU y PR-1 se detectaron desde las 6 hpi en el tratamiento con el oomiceto, incrementandose gradualmente hasta las 48 hpi, cuando se registro el maximo valor. De igual manera, el gen EAS, responsable de codificar para la enzima 5-epi-aristoloqueno sintasa, clave en la sintesis de la fitoalexina capsidiol, se incremento considerablemente desde las 6 hpi, 16,3 veces respecto al testigo, pero alcanzo la maxima acumulacion (23 veces) a las 12 hpi y posteriormente declino drastica mente a 9,4 y 5,5 veces a las 24 y 48 hpi, respectivamente.

De los genes que codifican para la sintesis de proteinas relacionadas con la patogenesis, el gen POX destaco con un incremento de 15,4 veces, seguido por GLU (10,1 veces) y PR-1 (8,5 veces) a las 48 hpi con el oomiceto.

Actividad enzimatica

La actividad de las glucanasas y peroxidasas en las raices de las plantas testigo (no inoculadas), se mantuvo relativamente constante a lo largo de los cuatro tiempos evaluados (Figuras 2a y b); en contraste, en las plantas de chile CM-334 inoculadas con el oomiceto la actividad de las enzimas se incremento desde las 6 hpi y fue acrecentandose a medida que transcurrio el tiempo. Para ambas enzimas el incremento de su actividad fue significativo (P[menor que o igual a]0,05) a las 12, 24 y 48 hpi en raices inoculadas con P. capsici.

Contenido de capsidiol

El contenido de capsidiol en las raices de plantas CM-334 no inoculadas se mantuvo mas o menos constante sin incrementos significativos durante el periodo de evaluacion; en cambio los niveles de esta fitoalexina fueron significativamente mayores (P[menor que o igual a]0,05) en las plantas inoculadas con P. capsici (Figura 2C). Los incrementos fueron de 69,7%, 165,1%, 259,1% y 386,7% a las 6, 12, 24 y 48 hpi, respectivamente,

[FIGURA 2 OMITIR]

Discusion

Las plantas exhiben defensas tanto constitutivas como inducidas contra el ataque por patogenos. Sin embargo, la compatibilidad e incompatibilidad hospedante-patogeno esta determinada por el grado de coordinacion entre las diferentes estrategias de defensa, la rapidez, y la magnitud con la que ocurre la expresion de genes que codifican para la sintesis de metabolitos que inhiben el crecimiento del patogeno (Silvar et al. 2008). En general, en las interacciones chile-P, capsi ci tanto de tipo compatibles como incompatibles ocurren cambios en: la acumulacion de PRs (Kim y Hwang, 1994; Egea et al. 1999; Lee et al. 2000), el contenido de capsidiol (Egea et al. 1996a), y la expresion de genes (Hong y Hwang, 2005; Silvar et al. 2008), asi como alteraciones cito logicas (Hwang, 2001). Tales cambios son mas rapidos y de mayor magnitud en las interacciones incompatibles, En la interaccion in compatible CM-334-P. capsici del presente estudio, tambien hubo diferencias importantes en la expresion de transcritos de genes de defensa, el contenido de la fitoalexina capsidiol, y en la actividad de [beta]-1,3 glucanasas y peroxidasas, con respecto a las plantas no inoculadas.

En la interaccion incompatible CM-334-P. capsici, hubo una mayor expresion de los transcritos de los genes GLU y POX, la cual se asocio con incrementos significativos en la actividad de las enzimas para las que codifican. Tambien se obtuvieron incrementos significativos de transcritos de los genes PR-1 y EAS, y de la fitoalexina capsidiol. En concordancia con lo reportado por varios investigadores para otros genotipos de chile resistentes al oomiceto (Egea et al., 1999; Jung y Hwang, 2000; Lee et al., 2000; Do et al., 2003; Silvar et al., 2008) los presentes resultados soportan la idea de que tales genes y compuestos podrian estar directamente involucrados en la resistencia de CM-334 a P. capsici.

La acumulacion de transcritos del gen POX y el correspondiente incremento en la actividad de peroxidasas sugiere que este gen esta involucrado en la repuesta de defensa de CM-334 contra P. capsici. Se ha consignado que la expresion de POX y la actividad de peroxidasas se incrementa en las plantas como resultado del ataque por patogenos (Van Loon et al., 2006). Las peroxidasas contribuyen a la resistencia de las plantas al crear un ambiente toxico por la acumulacion de especies reactivas de [O.sub.2] y al participar en el reforzamiento de la pared celular por la deposicion de los polimeros lignina y suberina, que constituyen una barrera fisica al avance del patogeno (Passardi et al., 2005). Silvar et al. (2008), al inocular plantas de chile (cv. CM-331) resistente a P. capsici, encontraron que a las 24 hpi la expresion del RNAm del gen CAPO1, que codifica para peroxidasa, se incremento 11,6 veces respecto a las plantas sin inocular, mientras que en las plantas del cv. susceptible Yolo Wonder, la expresion del gen CAPO1 fue tres veces menor que en el cultivar resistente. De igual forma, Do et al. (2003) reportaron que en plantas de chile del cv. Hanbyul inoculadas con los aislamientos de P. capsici S197 (compatible) y CBS178.26 (incompatible), la expresion del gen CAPO1 fue mas rapida y abundante en la interaccion incompatible en comparacion con la compatible.

El incremento significativo en la expresion de transcritos del gen PR-1 en la interaccion del presente estudio concuerda con los resultados consignados por Kim y Hwang (2000), quienes observaron un incremento en los niveles de los RNAm del gen CABPR-1, que codifica para una proteina PR-1 basica de chile, en la interaccion incompatible chile cv. Hanbyul-P. capsici aislamiento CBS 178.26; el incremento fue mayor a los 3 y 4 dias posteriores a la inoculacion (dpi), mientras que en la interaccion compatible chile cv. Hanbyul-P. capsici (aislamiento S197) la acumulacion del gen empezo a declinar gradualmente a partir de los 3 dpi. La funcion y el mecanismo de accion de las proteinas PR-1 en la patogenesis es todavia desconocida; sin embargo, el hallazgo consignado por Lee at al. (2000) respecto a que las proteinas PR-1 se acumularon en los espacios intercelulares y en la interface entre el patogeno (P. capsici) y las celulas de la planta de chile (cv. Hanbyul), sugiere que estas podrian participar en la defensa contra el oomiceto, ejerciendo un efecto toxico directo que retrasa el desarrollo del patogeno.

Por un lado, el incremento tanto de la acumulacion de transcritos del gen GLU como de la actividad de la enzima correspondiente en la interaccion chile-P, capsici, y por el otro, el marcado incremento que ocurre en las interacciones incompatibles comparado con el de las compatibles, sustentan la idea de que las [beta]-1,3 glucanasas estan asociadas con las respuestas de defensa (Kim y Hwang, 1997; Jung y Hwang, 2000). Egea et al. (1999) al contrastar la expresion del gen que codifica para [beta]-1,3 glucanasa en la interaccion incompatible Smith-5-P. capsici con la compatible Yolo Wonder-P. capsici, encontraron que la expresion fue de mayor magnitud y mas duracion en las plantas del cv. Smith-5 con respecto a la interaccion compatible, la cual disminuyo a los 3 dpi; tambien la actividad total de [beta]-1,3 glucanasas fue mayor en la interaccion incompatible en comparacion con la compatible y, en esta ultima, la acumulacion tardia de [beta]-1,3 glucanasas no previno el crecimiento del patogeno. Las [beta]-1,3 glucanasas degradan la pared celular de los oomicetos al hidrolizar la [beta]-1,3 glucana que es su mayor componente. Ademas del efecto directo sobre el patogeno, la enzima tambien puede mediar las respuestas de defensa de las celulas vecinas, ya que los fragmentos de glucana liberados de la pared celular del patogeno o de la planta pueden funcionar como elicitores para activar otras respuestas de defensa (Takeuchi et al., 1990).

De los genes estudiados, EAS destaco por su mayor y mas rapida acumulacion, sugiriendo que es uno de los primeros genes que se expresa en las plantas CM-334 en respuesta a la inoculacion con P. capsici. La expresion del gen EAS como consecuencia de la inoculacion con P. capsici en plantas de chile de diferentes cultivares ha sido reportada por varios autores (Zavala et al., 2000; Sun-Hwa et al., 2003). Zavala et al. (2000) mencionan que la inoculacion de P. capsici en plantas de chile var. Sonora Anaheim indujo una expresion fuerte del gen EAS (PEAS) a las 24h de haber sido inoculadas con el oomiceto, mientras que en las plantas no inoculadas no se detecto la expresion del gen. Por su parte, Mandujano et al. (2000) en estudios con cultivos celulares de tabaco tratados con un elicitor fungico, determinaron que a las 36h posteriores a la estimulacion se incremento la actividad de una sesquiterpeno ciclasa, la cual se correlaciono con la acumulacion de capsidiol.

La continua acumulacion del capsidiol en raices de CM-334 inoculadas con P. capsici, registrada a lo largo de las evaluaciones, indica la importancia de la fitoalexina como parte de los mecanismos de resistencia de este genotipo al oomiceto. Se considera que el capsidiol es la principal fitoalexina sintetizada en chile, y la magnitud de su acumulacion se asocia con el grado de resistencia a P. capsici en diversos genotipos de chile (Egea et al., 1996a; Candela et al., 2000). La toxicidad del capsidiol a P. capsici ha sido demostrada en varios trabajos (Ward et al., 1974; Egea et al., 1996a).

Las proteinas PRs no solo son inducidas en los tejidos de plantas en respuesta a la infeccion por patogenos sino tambien como respuesta al estres abiotico (Hong y Hwang, 2005). En el presente estudio, en raices de chile CM-334 de las plantas testigo se observo una expresion constitutiva leve de los diferentes genes en estudio. Al respecto, se ha documentado que las [beta]-1,3 glucanasas, peroxidasas y proteinas PR-1 tambien intervienen en diversos procesos fisiologicos y del desarrollo de las plantas tales como maduracion y desarrollo de frutos (Gaspar et al., 1982), division celular (Fulcher et al., 1976), embriogenesis (Dong y Dunstan, 1997), germinacion de semillas (Leubner-Metzger y Meins, 1999), rompimiento de dormancia (Krabel et al., 1993) y respuestas a luz UV (Green y Fluhr, 1995; El Ghaouth et al., 2003), entre otros. Por ello, la resistencia de CM-334 a P. capsici podria deberse tambien, en parte, a la expresion constitutiva que sumada a la expresion rapida de genes que codifican para proteinas PRs, crean un ambiente perjudicial para la infeccion y/o establecimiento del oomiceto.

En la interaccion incompatible chile CM-334-P. capsici estudiada, las plantas inoculadas con el oomiceto mostraron un incremento significativo en la acumulacion de transcritos de los genes GLU y POX, hecho que se asocio con incrementos considerables en la actividad de [beta]-1,3 glucanasas y peroxidasas, respectivamente. De igual manera, los transcritos de los genes PR-1 y EAS (5-epi-aristoloqueno sintasa) y el contenido de la fitoalexina capsidiol, se incrementaron significativamente como repuesta a la inoculacion con P. capsici.

AGRADECIMIENTOS

Los autores agradecen a Diana Sanzon Gomez por su ayuda en el establecimiento de los ensayos y apoyo tecnico en laboratorio, y al Consejo Nacional de Ciencia y Tecnologia (CONACYT) por la beca otorgada al primer autor y el apoyo brindado a traves del proyecto de investigacion 46331-Z.

REFERENCIAS

Abeles FB, Forrence LE (1970) Temporal and hormonal control of [beta]-1,3-glucanase in Phaseolus vulgaris L. Plant Physiol. 45: 395-400.

Bonnet J, Danan S, Boudet C, Barchi L, Sage-Palloix AM, Caromel B, Palloix A, Lefebvre V (2007) Are the polygenic architectures of resistance to Phytophthora capsici and P. parasitica independent in pepper?. Theor. Appl. Genet. 115: 253-264.

Candela EM, Alcazar DM, Espin A, Egea C, Almela L (1995) Soluble phenolic acids in Capsicum annuum stems infected with Phytophthora capsici Plant Pathol. 44:116-123

Candela EM, Egea C, Garcia MDP, Costa J, Candela M (2000) Breeding papryka type peppers resistant to Phytophthora capsici. Acta Hort. 522:79-86

Chavez MMP, Lozoya GE (1996) Biosynthesis of the sesquiter-penic phytoalexin capsidiol in elicited root cultures of chili pepper (Capsicum annuum). Plant Cell Rep. 15: 360-366.

Do HM, Hong JK, Jung HW, Kim SH, Ham JH, Hwang BK (2003) Expression of peroxidase-like genes, [H.sub.2][O.sub.2] production, and peroxidase activity during the hypersensitive response to Xanthomonas campestris pv. vesicatoria in Capsicum annuum. Mol. Plant-Microbe Interact. 16: 196-205.

Dong JZ, Dunstan DI (1997) Endochitinase and [beta]-1,3-glucanase genes are developmentally regulated during somatic embryogenesis in Picea glauca. Planta 201: 189-194.

Egea C, Alcazar MD, Candela ME (1996a) Capsidiol: Its role in the resistance of Capsicum annuum to Phytophthora capsici. Physiol. Plant. 98: 737-742.

Egea C, Garcia MDP, Candela ME (1996b) Capsidiol accumulation in Capsicum annuum stems during the hypersensitive reaction to Phytophthora capsici. J. Plant Physiol. 149: 762-764.

Egea C, Dickinson M J, Candela M, Candela ME (1999) [beta]-1,3-glucanasa isoenzymes and genes in resistant and susceptible pepper (Capsicum annuum) cultivars infected with Phytophthora capsici. Physiol. Plant. 107: 312-318.

El Ghaouth A, Wilson CL, Callahan AM (2003) Induction of chitinase, [beta]-1,3-glucanase, and phenylalanine ammonia lyase in peach fruit by UV-treatment. Phytopathology 93: 349-355.

Fernandez A, Peteira B, Solorzano E, Diaz M, Leon O (1998) Mecanismos bioquimicos de defensa en la interaccion hospedante-patogeno. Rev. Protec. Veg. 13: 1-12.

Fernandez PS (1997) Host-Pathogen Interactions In The Root Rot Phytophthora capsici/Capsicum annuum Resistant CM-334 Pathosystem. Tesis. New Mexico State University. EEUU 109 pp.

Fulcher RG, Mc Cully ME, Setterfield G, Sutherland J (1976) [beta], 1-3 glucans may be associated with cell plate formation during cytokinesis. Can. J. Bot. 54: 459-542.

Gaspar T, Penel C, Greppin H (1982) Peroxidases 1970-1980. A Survey of their Biochemical and Physiological Roles in Higher Plants. University of Geneva Press. Ginebra, Suiza. 324 pp.

Gayoso C, Martinez de Ilarduya O, Pomar F, Merino F (2007) Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanace-ae cultivars. Eur. J. Plant Pathol. 118: 199-209.

Glosier BR, Ogundiwin EA, Sidhu GS, Sischo DR, Prince JP (2008) A differential series of pepper (Capsicum annuum L.) lines delineates fourteen physiological races of Phytophthora capsici. Euphytica 162: 23-30.

Gonzalez E, Yanez MM, Santiago VS, Montero AP (2004) Biodiversidad fungosa en la marchitez del chile y algunos factores involucrados, en Tlacotepec de Jose Manzo, El Verde, Puebla. Agrociencia 38: 653-661.

Green R, Fluhr R (1995) UV-B induced PR-1 accumulation is mediated by active oxygen species. Plant Cell 7: 203-212.

Hammerschmidt R, Nuckles EM, Ku F (1982) Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol. 20: 73-82.

Hong JK, Hwang BK (2005) Functional characterization of PR-1 protein, [beta]-1,3-glucanase and chitinase genes during defense response to biotic and abiotic stresses in Capsicum annuum. Plant Pathol. J. 21: 195 -206.

Hwang BK (2001) Cytology, physiology and molecular genetics of resistance to Phytophthora blight in pepper plants. Plant Pathol. J. 17: 9-21.

Jung HW, Hwang BK (2000) Pepper gene encoding a basic [beta]-1,3-glucanase is differentially expressed in pepper tissues upon pathogen infection and ethephon or methyl jasmonate. Plant Sci. 159: 97-106.

Kim SG, Kim YH (2009) Histological and cytological changes associated with susceptible and resistant responses of chili pepper root and stem to Phytophthora capsici infection. Plant Pathol. J. 25: 113-120.

Kim YJ, Hwang BK (1994) Differential accumulation of [beta]-1,3-glucanase and chitinase isoforms in pepper stems infected by compatible and incompatible isolates of Phytophthora capsici. Physiol. Mol. Plant Pathol. 45: 195-209.

Kim YJ, Hwang BK (1997) Isolation of a basic 34-kDa [beta]-1,3-glucanase with inhibitory activity against Phytophthora capsici from pepper stems. Physiol. Mol. Plant Pathol. 50: 103-115.

Kim YJ, Hwang BK (2000) Pepper gene encoding a basic pathogenesis-related 1 protein is pathogen and ethylene inducible. Physiol. Plant. 108: 51-60.

Krabel D, Eschrich W, Wirth S, Wolf G (1993) Callase (l,3-[beta]-D-glucanase) activity during spring reactivation in deciduous trees, Plant Sci. 93: 19-23.

Lee YK, S Hippe-Sanwald S, Lee SC, Hohenberg H, Hwang BK (2000) In situ localization of PR-1 mRNA and PR-1 protein in compatible and incompatible interactions of pepper stems with Phytophthora capsici. Protoplasma 211: 64-75.

Leubner-Metzger G, Meins F (1999) Functions and regulation of plant [beta]- 1,3 glucanases (PR-2). En Datta SK, Muthukrishnan S (Eds.) Pathogenesis-Related Proteins in Plants. CRC Press. Boca Raton, FL, EEUU. pp. 49-66.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the [2.sup.-[DELTA][DELTA]ct] method. Methods 25: 402-408.

Mandujano CA, Schoenbeck MA, Ralston LF, Lozoya GE, Chappell J (2000) Differential induction of sesquiterpene metabolism in tobacco cell suspension cultures by methyl jasmonate and fungal elicitor. Arch. Biochem. Biophys. 381: 285-294.

Oelke ML, Bosland PW, Steiner P (2003) Differentiation of races specific resistance to Phytophthora root rot and foliar blight in Capsicum annuum. J. Am. Soc. Hort. Sci. 128: 213-218.

Pan SQ, Ye SX, Kuc J (1991) Asociation of [beta]- 1,3- glucanase activity and isoform pattern with systemic resistance to blue mould in tobacco induced by stem injection with Peronospora tabacina or leaf inoculation with tobacco mosaic virus. Physiol. Mol. Plant Pathol. 39: 25-39.

Passardi F, Cosio C, Penel C, Dunand C (2005) Peroxidases have more functions than army knife. Plant Cell Rep. 24: 255-265.

Perez, L, Medina LO, Salinas, GJG (1990) Control genetico y quimico de la marchitez del chile Capsicum annuum L. causada por el hongo Phytophthora capsici Leo., en la region de Irapuato, Guanajuato, Mexico. Rev. Mex. Fitopatol. 8: 71-76.

SAS (1999) SAS User's Guide: Statistics. Ver. 8.0. SAS Institute, Inc. Cary, NC, EEUU. 956 pp.

Sepulveda JG, Porta DH, Rocha SM (2003) La participacion de los metabolitos secundarios en la defensa de las plantas. Rev. Mex. Fitopatol. 21: 355-363.

Silvar C, Merino F, Diaz J (2008) Differential activation of defense-related genes in susceptible and resistant pepper cultivars infected with Phytophthora capsici. J. Plant Physiol. 165: 1120-1124.

Sun-Hwa H, Kim JB, Hwang YS, Lee SW (2003) Molecular characterization of three 3-hydroxy-3-methylglutaryl-CoA reductase genes including pathogen-induced Hmg2 form pepper (Capsicum annuum). Biochim. Biophys. Acta 1625: 253-260.

Takeuchi Y, Yoshikawa M, Takeba G, Kunisuke T, Shibata D, Horino O (1990) Molecular cloning and ethylene induction of mRNA encoding a phytoalexin elicitor-releasing factor, [beta]-1,3-endoglucanase, in soybean. Plant Physiol. 93: 673-682.

Van Loon LC, Rep M, Pieterse CMJ (2006) Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 44: 135-162.

Villar LE, Reyes TB, Rojas MRI, Gomez RO, Hernandez AAM, E Zavaleta-Mejia (2009) Respuesta hipersensitiva en el follaje de chile CM-334 resistente a Phytophthora capsici infectado con Nacobbus aberrans. Nematropica 39: 143-155.

Ward EWB, Unwin C, Stoessl A (1974) Post infectional inhibitors from plants. III. Fungitoxicity of the phytoalexin capsidiol and related sesquiterpenes. Can. J. Bot. 52: 2481-2488.

Zavala PG, Chavez MMP, Garcia PE, Yin S, Chappell J, Lozoya GE (2000) Isolation of an elicitor-stimulated 5-epi-aristolochene synthase gene (Gpeasl) from chilli pepper (Capsicum annuum). Physiol. Plant. 110: 410-418.

Ernesto Fernandez-Herrera. Maestro en Cieneias en Proteccion Vegetal, Universidad Autonoma Chapingo (UACh), Mexico. Doctor en Ciencias en Fitopatologia, Colegio de Postgraduados (COLPOS), Mexico. Posdoctorante, Centro Interdisciplinario de Investigacion para el Desarrollo Integral Regional (CIIDIR-IPN), Sinaloa, Mexico.

Reyna I. Rojas Martinez. Doctora en Ciencias en Fitopatolo gia, COLPOS. Profesora Investigadora, COLPOS, Mexico.

Olga Gomez Rodriguez. Doctora en Ciencias en Fitopatologia, COLPOS, Mexico. Investigadora, COLPOS, Mexico.

Lorenzo Guevara Olvera. Doctor en Ciencias en Biotecnologia de Plantas, Centro de Investigacion y Estudios Avanzados del Instituto Politecnico Nacional (CINVESTAV-IPN). Profesor Investigador, Instituto Tecnologico de Celaya, Mexico.

Maria Esther Rivas Davila. Ph.D. en Fitopatologia, Auburn University, EEUU. Gerente, Bidasem, Productora y Comercializadora de Semillas, S.A. de C. V. Celaya, Mexico.

Ernestina Valadez Moctezuma. Doctora en Ciencias, Universidad Nacional Autonoma de Mexico. Profesora Investigadora, UACh, Mexico.

Emma Zavaleta-Mejia. Ph.D. en Fitopatologia, University of California, Riverside, EEUU. Profesora Investigadora, COLPOS. Direccion: Km. 36.5, Carretera Mexico-Texcoco, Montecillo, Edo. de Mexico, C. P. 56230, Mexico. e-mail: zavaleta@eolpos.mx
ABLA I
OLIGONUCLEOTIDOS USADOS PARA ANALIZAR LA ACUMULACION DE ALGUNOS
GENES RELACIONADOS CON LA DEFENSA EN PLANTAS DE CM-334 INOCULADAS
CON P. capsici

Gen                       Acceso        Referencia

Gliceraldehido 3-P       AJ246011   DPE
deshidrogenasa (GAPDH)

PR-1                     AF053343   Gayoso, et al. 2007
(CABPRI)

Peroxidasa               AF442386   DPE
(CAPO])

[beta]-1,3-glucanasa     AF227953   DPE
(CABGLU)

5-epi-aristoloqueno      AJ005588   DPE
sintasa (PEAS)

                                           Primer

Gen                      Nombre   Secuencia primer (5'- 3')   Amplicon

Gliceraldehido 3-P       GLIFW    GGCCTTATGACTACAGTTCACTCC     217pb
deshidrogenasa (GAPDH)   GLIRV    GATCAACCACAGAGACATCCACAG

PR-1                     PR1FW    GTTGTGCTAGGGTTCGGTGT         301pb
(CABPRI)                 PR1RV    CAAGCAATTATTTAAACGATCCA

Peroxidasa               POXFW    CCAGTACGTGCCCAAGAGCTG        560pb
(CAPO])                  POXRV    GGATGCGTCGATTGAAGGGTC

[beta]-1,3-glucanasa     GLUFW    GAGGCTCCAACATTGAAGTTATG      480pb
(CABGLU)                 GLURV    CATCTTGTACCACCACATTAGGTGC

5-epi-aristoloqueno      EASFW    GCTCAAGAAATTGAACCGCCGAAG     200pb
sintasa (PEAS)           EASREV   TCTTCATTATAGACATCGCCCTCG

DPE: disenados en el presente estudio. CABPRI=PR-1; CAP01=POX
CABGLU=GLU PEAS=EAS.
COPYRIGHT 2012 Interciencia Association
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Fernandez-Herrera, Ernesto; Rojas-Martinez, Reyna I.; Gomez-Rodriguez, Olga; Guevara-Olvera, Lorenzo
Publication:Interciencia
Date:May 1, 2012
Words:6350
Previous Article:Effect of irrigation suspension in pre-flowering and grain filling in the contents of lysine, tryptophan and yield in two high protein quality...
Next Article:Non-preference for oviposition and nymphal viability of Bemisia tabaci biotype B (hemiptera: aleyrodidae) on BT cotton and on its non-transgenic...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters