Printer Friendly

DNA Methylation Changes in Pleurotus eryngii Subsp. tuoliensis (Bailinggu) in Response to Low Temperature Stress.

Byline: Shuang Hua, Bao Qi, Yong-Ping Fu and Yu Li

Abstract

The methylation sensitive amplified polymorphism (MSAP) was used to induce DNA methylation transformation in mushroom mycelia. DNA obtained from the mycelial stages of P. eryngii subsp. tuoliensis was digested with isoschizomers Msp I or Hpa II (mixture of EcoR I), the ability to digest the sequence CpCpGpG as influenced by their methylation state. The data analysis demonstrated that full-methylated and unmethylation modifications were primary and the hemi-methylated ratio was significantly lower. These results indicated that the pattern of CG hypermethylation is abundant in P. eryngii subsp. tuoliensis. All fragments that were differentially amplified upon low temperature induction illustrated the feasibility of MSAP in edible mushrooms. Moreover, this study confirmed that genetic and epigenetic changes in P. eryngii subsp. tuoliensis were induced under low temperature.

Keywords: DNA methylation; Pleurotus eryngii subsp. tuoliensis (Bailinggu); Low temperature induction; MSAP

Introduction

DNA methylation in eukaryotes is a significant crucial epigenetic modification and is the most well-studied phenomenon at present (Gavery and Roberts, 2010). Pleurotus eryngii subsp. tuoliensis (Bailinggu) is one of the most diffusely cultivated edible mushrooms in China. Together with the white mushroom Ganoderma lucidum and P. eryngii subsp. tuoliensis constitutes a delicious and nutritious food and has antihypertensive, antiviral, enhancement-immunity and antitumor properties (Choi et al., 2006; Miyazawa et al., 2008; Lv et al., 2009). The optimal temperature for P. eryngii subsp. tuoliensis mycelium growth in 25degC, while induction and formation of fruit within 13-18degC Moreover, induction stress during environmental temperature of 0-4degC is a significant factor for primordium growth and development.

Epigenetic processes were necessary for growth and variation and the environment may affect the epigenetic phenomenon to cause phenotypic changes. Therefore, the epigenome is tightly in connection to environmental inducement and developmental variation (Yaish et al., 2011).

Many studies have highlighted the relevance of DNA methylation in developmental processes (Fang and Chao, 2007). Moreover, mounting evidence from previous studies indicates environmental stresses, such as light (Omidvar and Fellner, 2015), temperature (Steward et al., 2002; Zemach et al., 2010; Naydenov et al., 2015), salt stress (Tan, 2010), Nitric Monoxide (Wang et al., 2015) and drought (Wang et al., 2011; Zeng et al., 2015), diversity of phenotypes were detected through the DNA methylation. Thus, there is an epigenetic relation between environmental stress and plants developmental processes (Boyko and Kovalchuk, 2008).

Many studies demonstrated that DNA methylation of fungi genomes shows change at low levels (Antequera et al., 1984; Magill and Magill, 1989; Zemach et al., 2010; Foulongne-Oriol et al., 2013). The genome of Neurospora showed approximately 1.5% methylcytosines and insufficient 0.1% methylcytosines in Schizosaccharomyces pombe and Anacystis nidulans (Antequera et al., 1984; Selker and Stevens, 1987; Foss et al., 1993). DNA methylation is speculated to occur transiently during the sexual stage (Liu et al., 2012), DNA methylation may be not exist in Aspergillus flavus. DNA methylation prevents extension, transcription in Neurospora crassa and Candida albicans (Rountree and Selker, 1997; Mishra et al., 2011). In Magnaporthe oryzae, methylcytosines content (0.4%) and level (0.39%) of DNA methylation are similar during asexual development (Jeon et al., 2015). However, we need to know with respect to the methylation connection between the environmental and developmental influences of edible mushrooms.

We applied MSAP to survey DNA methylation in P. eryngii subsp. tuoliensis to address the concern on the methylation levels and patterns of edible mushroom under low temperature induction.

Materials and Methods

Strain Culture

P. eryngii subsp. tuoliensis was provided by Hengdaxing. Strains were maintained at 4degC on culture slants of potato dextrose agar (PDA) medium. Mycelial block of inoculation (diameter, 5 mm) was sliced from PDA that had grown on PDA medium for 12 days at 25degC in a petri dish (diameter, 9 cm). The medium was autoclaved at 121degC for 15 min.

Temperature Treatments

P. eryngii subsp. tuoliensis mycelia were grown at 25degC for 7d (control). After 25degC growth for 7 d, the mycelia were subjected to 4degC low temperature stimulation treatments for 3 d, and then incubated at 13degC under a 12/12 h dark/light cycle for primordium.

Isolation of DNA

Genomic DNA was extracted from mycelia tissues given different treatment using the Cetyl trimethylammonium bromide (CTAB) method (Kidwell et al., 1992). The quality and quantity of genomic DNA was detected by 1.0% agarose gel and spectrophotometer.

Methylation Sensitive Amplified Polymorphism (MSAP) Analysis

MSAP is a improved method of the AFLP fingerprinting technique (Vos et al., 1995). Highly quality genomic DNA is extracted, EcoR I /Hpa II and EcoR I /Msp I enzyme combination were used to digest DNA, and linked to adapters, then design pre-amplification primers and PCR amplification. (Salmon et al., 2008; Herrera and Bazaga, 2010; Liramedeiros et al., 2010; Paun et al., 2010; Richards et al., 2012).

Each sample mycelium genomic DNA 300 ng was cut off using EcoR I (4 units, NEB, USA), Msp I / Hpa II (4 units, NEB, USA) and cut smart buffer in a total of 10ul, at 37degC for 5.0 h. Then 3 pM EcoR I, 30 pM Msp I /Hpa II specific adopters (Table 1), 4 units T4 DNA ligase (NEB, USA) were added to the digested reaction at 16degC for overnight. The pre-selective amplification DNA (25uL) was acquired with the template (digestion), EcoR I + X and Msp I /Hpa II + X (X is one of A, T, C and G nucleotide) primers (Table 1), 5 unit of Taq DNA polymerase (TaKaRa, China), 2.5 mM dNTP, 10xPCR Buffer(Mg2+ plus).

The PCR reaction profile were considered at 94degC for 5 min, 30 cycles of 94degC for 30 s, 56degC for 30s, at 72degC for 60s, 10 min extension 72degC. There were 96 primer combinations add Hpa II /Msp I +XYZ (X, Y, Z is one of A,T,C and G nucleotide) for selective amplification. The PCR product (first PCR) was diluted 30 times in TE buffer (pH 8.0). The second PCR reaction profile were considered at 94degC for 5 min, 10 cycles of 94degC for 30s,65degC for 30s (from 65degC to 56degC was reduced by 1degC) and at 72degC for 80s, 30 cycles of 94degC for 5 min, 55degC for 30s and at 72degC for 80s, 10 min extension 72degC. The gel method and silver staining were similar to already described (Bassam et al., 1991; Zhang et al., 2009). The electrophoretic results were noted by sequencing system (Junyi, Beijing, China).

The methylation status were dividied into four classes under MSAP dates analysis: Type I showed that EcoR I/Hpa II and EcoR I /Msp I have bands(E-H/E-M, +/+), Type II showed that EcoR I /Hpa II has band, but absent in EcoR I /Msp I (E-H/E-M, +/-), Type III showed that EcoR I / Msp I has band, but absent in EcoR I / Hpa II (E-H/E-M, -/+), Type IV showed that EcoR I /Hpa II and EcoR I /Msp I bands were absent (Keyte et al., 2006; Zhang et al., 2009).

The specific bands were cut from gel. In BLAST (NCBI, http://www.ncbi.nlm.nih.gov/), the gene fragments were describled by find the homology.

Results

DNA Methylation of P. eryngii Subsp. tuoliensis by MSAP Analysis

Bailinggu (China) is widely considered as one of the most popular edible mushroom in Asia. Environmental factors that affect mycelium grown require, special low temperature situations to germinate primordia and fruiting bodies. Low temperature (4degC 3 d) stimulation of mycelium growth is the key stage for primordia initiation in edible mushroom. Statistical analysis of MSAP markers bands was used to assess changes in methylated DNA of P. eryngii subsp. tuoliensis. Nucleotide specificity MSAP primers combinations EcoR I and enzymes Msp I/ Hpa II+ XY (XYZ) are used to generate the MSAP fingerprints of P. eryngii subsp. tuoliensis. We used 96 primer combinations (three technical replicates) to amplify 2005 to 2022 clear and reproducible bands from P. eryngii subsp. tuoliensis cultivars. The total methylation of cytosine averaged 28.31%, and 11.85% under low temperature induction (4degC 3 days), which was more than that induced by 25degC (control).

Moreover, the full-methylated level was significantly higher than the hemi-methylated level at all times. The number of full-methylated bands (from 12.62 to 19.10%) and hemi-methylated lines (from 3.84 to 9.21%) were significantly greater compared with low temperature induction (Fig. 3).

DNA Methylation Patterns under Low Temperature Stress

DNA fragments are known as more than one CG cover end point from the same recognized site (CCGG) and cut by one or both restriction enzymes (Schulz et al., 2013). To survey the DNA methylation hyper- or hypo-diversity under low temperature induction and control, we defined all differential lines as four patterns (CG hypo-, CHG hypo-, CG hyper- and CHG hyper-) (Zhang et al., 2009; Qi et al., 2010) (Fig. 1). We determined the methylation changes analyzed from four methylation patterns compared with the genetics. Low temperature induction caused a more abundant change in CG hyper- and least abundant in CG hypo-compared with the control (Fig. 2). Fig. 2 shows that different methylation patterns changed the relative consistency for three individuals. CG hyper-showed a dramatic difference in the three changed methylation patterns, while CHG hypo-, CG hypo- and CHG hyper-showed similar methylation patterns.

These results suggest that low temperature induces a diversity in methylation patterns.

Table 1: Sequences of adapters and pre-selective and selective primers used for MSAP analysis

Primers/adapters###Sequence (5-3)

EcoR I adapter###5'-CTCGTAGACTGCGTACC-3'

###3'-CATCTGACGCATGGTTAA-5'

EcoR I+1 primer###5'-GACTGCGTACCAATTCA- 3'

Msp I-Hpa II adapter###5'-GACGATGAGTCTAGAA-3'

###3'-CGTTCTAGACTCATC-5'

Msp I-Hpa II+1 primer###5'-GATGAGTCTAGAACGGT-3'

DNA methylation patterns in control and low temperature induction were analyzed as described by Karan (Karan et al., 2012). We count all bands in the gel and compare them for surveying DNA methylation patterns. We observed fifteen different banding patterns in the statistical data. Table 2 showed that from A to C patterns had no change in methylation in response to both control and low temperature induction. From D to I described cytosine demethylation and J-O represented DNA methylation induction of low temperature (Table 2).

All bands averaged 84.97% of the 5'-CCGG-3' sites that showed unchanged methylation under low temperature induction (Table 2). The percentage of demethylation bands averaged 5.36% under low temperature induction while the methylated bands averaged 9.68% in P. eryngii subsp. tuoliensis under low temperature induction.

BLAST Result of Poplymorphic Fragment Sequences

Twenty two differential bands were collected and sequenced from different primers (Table 3). BLAST was used to search DNA sequences that are significantly homologous to known-function genes. Most of the DNA fragments showed "No significant similarity found". L6 was 74% homologous to the Agaricus bisporus var. bisporus H97 chromosome 10 sequence. The sequence of L8 was related to Trametes versicolor FP-101664 SS1 PR-1-like protein mRNA. The sequence of L20 was associated with Mesocestoides corti genome assembly M_ corti_ Specht_ Voge.

Discussion

Over 100 publications described the use of MSAP primarily to study developmental biology (Portis et al., 2004; Hanai et al., 2010; Moran and Perezfigueroa, 2011; Meng et al., 2012). DNA methylation plays critical roles in various aspects of biological processes (Jullien et al., 2012; Diez et al., 2014; Heard and Martienssen, 2014; Matzke and Mosher, 2014). Environmental stresses can induce varying patterns of DNA methylation (Steward et al., 2002; Wada et al., 2004; Verhoeven et al., 2010), the regulation of gene expression may be speculated. In plant development, MSAP (Xiong et al., 1999) was put into use to study genome methylation under stress (Portis et al., 2004; Salmon et al., 2008; Xuelin et al., 2009; Zhong et al., 2009; Yi et al., 2010; Wang et al., 2011; Karan et al., 2012; Albertini and Marconi, 2013; Ou et al., 2015).

DNA demethylation often has been related to temperature induction or stress, such as Arabidopsis, maize, Antirrhinum majus and wheat (Steward et al., 2002; Hashida et al., 2003; Sherman and Talbert, 2011). However, DNA methylation in edible mushrooms development is not well-studied, and there is a dearth of information that could be potentially useful for mushroom breeders.

Table 2: Variation in the major methylation patterns, including No change, Demethylation and Methylation in Control and Low temperature induction of P. eryngii subsp. Tuoliensis

Patterns###Class Control###Stress-induced###Low temperature induction

###H###M###H###M

No change###A###1###0###1###0###24

###B###0###1###0###1###46

###C###1###1###1###1###1640

###Total###1710 (84.57%)

Demethylation D###1###0###1###1###19

###E###0###1###1###1###8

###F###0###0###1###1###6

###G###0###1###1###0###7

###H###0###0###1###0###71

###I###0###0###0###1###1

###Total###112 (5.54%)

Methylation###J###1###1###1###0###23

###K###1###1###0###1###151

###L###1###1###0###0###12

###M###1###0###0###1###1

###N###1###0###0###0###1

###O###0###1###0###0###12

###Total###200 (9.89%)

Table 3: Results of the BLAST analysis of the methylated DNA polymorphic sequences

Code###Length (bp)###Identity (%) BLAST results###84###Control

H3###90###-###Ns

H5###99###-###Ns

H7###100###-###Ns

H8###113###-###Ns

H10###99###-###Ns

H17###242###-###Ns

H18###136###-###Ns

H22###100###-###Ns

H24###117###-###Ns

H29###141###-###Ns

L1###101###-###Ns

L3###90###-###Ns

L5###110###-###Ns

L6###389###74###Agaricus bisporus var. bisporus H97

###chromosome 10 sequence, CP015466.1

L8###437###74###Trametes versicolor FP-101664 SS1 PR-

###1-like protein mRNA, XM_008034883.1

L9###157###-###Ns

L15###92###-###Ns

L20###86###85###Mesocestoides corti genome assembly

###M_ corti_ Specht_ Voge, scaffold

###MCOS_scaffold0001241, LM533338.1

L24###98###-###Ns

L21###105###-###Ns

L22###133###-###Ns

01102###134###-###Ns

In our study, the MSAP method was used to determine whether low temperature induction caused changes DNA methylation of P. eryngii subsp. tuoliensis. Our results showed the level of DNA methylation rise during mycelium growth in Control and Low temperature induction. Variable frequencies for MSAP bands, different changes in demonstrated genotypes and epigenetic changes, and loss and gain indicated function indicated hypo- and hyper-methylated, which are possibly the primary function of DNA methylation. This is accordingly reflected relation in the relation of various stress-induction environment and re-patterning. Thus, our study showed that low temperature induced genetic and epigenetic changes are relevant for each other. CG hyper- and loss of bands are significantly correlated in stress-induction.

Table S1: List of 96 selective primers combinations used in the MSAP markers

EcoR I+3 (a-h)###H/M+3 (1-12)

a GACTGCGTACCAATTCAAC###1 GATGAGTCTAGAACGGTAC

b GACTGCGTACCAATTCAAG###2 GATGAGTCTAGAACGGTAG

c GACTGCGTACCAATTCACA###3 GATGAGTCTAGAACGGTCT

d GACTGCGTACCAATTCACT###4 GATGAGTCTAGAACGGTCG

e GACTGCGTACCAATTCACG###5 GATGAGTCTAGAACGGTA

f GACTGCGTACCAATTCAGC###6 GATGAGTCTAGAACGGTT

g GACTGCGTACCAATTCAGG###7 GATGAGTCTAGAACGGTC

h GACTGCGTACCAATTCAGA###8 GATGAGTCTAGAACGGTG

###9 GATGAGTCTAGAACGGAAC

###10 GATGAGTCTAGAACGGAAG

###11 GATGAGTCTAGAACGGAAA

###12 GATGAGTCTAGAACGGAGA

Table S2: BLAST sequence of twenty-two

Code BLAST sequence

H3###GCAAAAAAATATGATAATTTCGGTAGATCGACTTGGAATCACGTCAGCTCTAGAAGTGAGCATGAACGAGAGAGCGTACCGTTCTAGACA

H5###GAATCATCGTGCTGGAGACTGCATAGCAAGGTAGCGCCTGGTAGCGTCTAGCGAAAAAAATATTACCTTTATATCCCCCAGACCGTTCTAGAC

###TCATCA

H7###CCCCCATCGCCAAGGTACTATTCCCTGGATGCAGCAGGCCGCCGTGAGTCCAGCGGTACGGGGCATGCTGCGCATCCAAGGACCGTTCTAG

###ACTCATCAA

H8###CCAACGTTAGGTTATATGTCATTCAACGGGACGTTGTTCATCCGAGCGGCGGGGTTGACAGCCAAGTGGATGGGTAGGATTAGGGAAGGAG

###AGAGACCGTTCTAGACTCATCA

H10###GGAAGGTTCCTAATAAGATATTTCGGTAGAACGACTTGAAAACACGTCAGCTCAAAGAAGTGAGCATGAACGAGAGAGCGTACCGTTCTAG

###ACTCATCA

H17###GGTCCATGCAGCTCAGCCGTTGGGCTTGCGGAGTTCGATATCGGTGGCCATGCAATTAATAGAACAGTGTCTGATCGGTGTGAACCTGGAAG

###TTCCGAATGATGTCGACCTGACACTTGCATGTTTCTATTCGCTTCAGTGTTCGCTAAGCAAGCAACTTCGCAAGCAACCAACGGAAATTACT

###CCGTGACAGTGCATGCCAACGTCTTCAGATCTTCAAAATGACCGTTCTAGACTCATCA

H18###ACCTATGGATTGACGGAGTGGCAGGTGATGAACGTCTGTGCGCTTGACATAGACTTAGTTCCGCGAATGGCCAAGGAGCGAGAGGCAGCAG

###CCACGAGCCTGAGACCGCTATGACATGACCGTTCTAGACTCATCA

H22###GTCCCTAAGAAGAGCGTCTCTGCGGTGGGTGGCGTGATAACTGGTGAGAGGAGCGGGAATAAATCCCACGGTCACTACTGCCACCGTTCTA

###GACTCATCA

H24###TGATGAGTCTAGAACGGTGGCAGTAGTGACCGTGGGATTTATTCCCGCCCTCTCACCAGTTATCACGCCACACGCGTCTTTCTTGCCATTCCT

###CAGCTCTGAATTGGTACGCAGTCA

H29###TGACTGCGTACCAATTCAGACGCTGCGTCCTGGATCATACACGCGAAACAAGTACGTCCATCTCGTCTCGTCGAGCTGAGCTGCCCTCACCT

###ATTGACGTTTCCTCAGTTCTACTGTATATCCACCGTTCTAGACTCATCA

L1###CAATTGCTGACTGAATGCGTGTGAGGCGTGTGATGGGTGGCTTACATTGGCAAATATCTCGAGCAAATTAAGAATTGCTGTATACCGTTCTAG

###ACTCATCA

L3###GGGACTATAAGCTCCGAGTTCTTGATTGTCACGGCACCTGTGGTGTTCGGCGGGTATACTAAGATTCTATGGACCGTTCTAGACTCATCA

L5###ACCCCTCACTTTAAACTTAAAAACTCTGCAGAGGCGTGTGATAAGGTGGCTTACATTGGCAAATATCTCGAGCAAATTAAGAATTGCTGTAG

###ACCGTTCTAGACTCATCA

L6###TGATGAGTCTAGAACGGTAGACTGAATACAACGTTAGTTACCGATTTCATCTGGCATCGAGGCTGGCCGTTCAAGATGATGGCATTGGGTATA

###GACTTGAAACAAAAGTGTCGTGGTAATTACCTGTGCTATATTGATGAAACCTTCTCCGTGCTCATCCATTTCGACCTCACCCTCAACGGCCTC

###CGTCCCCTACCTCACTTTGGCTTTCTTATCCCGTTCTTCATCGCTGTGTGTCGGTGGCGGTTGTTCGCGAACCTCAAATATACGAAGCAGGTTT

###GTACGCGCGACTACCACATTGCAAAGGACCTTGGTTCCATCGTCTATCCCCGAATTTTGCGTCGTTGAAGGAGTCAATTTCAAACTGACGAT

###GAATTGGTACGCAGTCA

L8###TGACTGCGTACCAATTCATCGCATAAGCTCTGAGAATTGAACGGGGATTCATGGGAGAAGACGTACGCAAATTGGCCAATAATATTTCCCTGG

###GCAGAGTATTCACAAACGAAATATTTCGCCTTCTGCGGCACAACAGAACGCGCGGTCAGTTAATTATTACGGACGAGCCGACAAGACGTGT

###ACTCACCCCAAACTTAGCGTCGAAAATGCCGTCGCAAAGCGCTTCAGCACATCCAACTTGGCTGCTCCCTTTCCAGACCACTTGGGTGAAA

###TGGGATGGAACAGGGTTGTTAGGGTTGTAGTCCTCTACGTATTGAGGTGAGCACGTTCCCAGGTAGTTGGAGCGACAACCACTACTCACTG

###ACTTCGTCCGTCCACGACTTGATGGCAGACTGAATGTCATAAGCGCTCCCAGTACCGTTCTAGACTCATCA

L9###GCCGTAGGTATGCAGATGCGTGCCTTTGGAGCGTGATTCCAGAATGGTGAGGTCGTCTTCACCAGTCGGGGAAATTTCTCCTTCCAGGGCGG

###GGCCGAGGTGGTTCGCCTCGACATCCCGCTCCTCGATCCTGTCCACCGTTCTAGACTCATCAATG

L15###CCCCTCCATCACGGTCACACCAAGATAGCATTAGGGTCTTGGCTGTGTTGCCAGGAAGATGAGGATGAGCCGTAACCGTTCTAGACTCATCA

L20###GTCCTGACAGGATTTCCGCTCACGTCCCACCGTCACCACCACCACTGTCTCGCCCTCCTCCTCGTCGTACCGTTCTAGACTCATCA

L24###CCCCTGAATCACGGTCACAACCAAGATAGCATTAGGGTCTTGGCTGTGTTGCCAGGAAGATGAGGATGAGCCGTGACCGTTCTAGACTCATC

###ACAGTG

L21###CCTTCATGACTTAGAGCCAGTAGAGGATGACTGAATGAGTTTCACTCACTCACAACGAGTCTGATTAGGGCATATCGGGGTAGCCTGACCGT

###TCTAGACTCATCA

L22###TGATGAGTCTAGAACGGTCAGGCTACCCCGATATGCCCTAATCAGACTCGTTGTGAGTGAGTGAAACTCATTCAGTCATCCTCTACTTGGCAT

###CTTCACCAGGACATGTTTGATCTGAATTGGTACGCAGTCA

01102 CCGGACCTCAGCGTCGCGCTCTTTTCTGGGGCAGGTATATCCCCGCTTGGATACAATCTTCAATAAGGCCATACTTGAGGTTAAACTTGTGAA

###ACACCTGGTCGGGGAGTTTGTGAACCGTTCTAGACTCATCA

A dramatic change in methylation occurs when there is low temperature induction. However, it is evident that P. eryngii subsp. tuoliensis responds to low temperature induction by increasing the level of DNA methylation. Our results indicate that low temperature induce DNA methylation (16.47% to avg. 28.31%). Moreover, hemi-methylated bands raised under low temperature induction. However, it was not clear whether this increase was caused by segmental methylation of unmethylated DNA or incomplete CG or CHG hypomethylated of fully methylated bands.

Conclusion

The role of environmental factors that contribute to the methylation process is well-known. P. eryngii subsp. tuoliensis is the earliest variety from Xinjiang in China; it needs low temperatures for bud stage and temperature <4degC for the differentiation of mushroom primordia, which are the bottleneck of P. eryngii subsp. tuoliensis industry development. Therefore, genomic changes are a result of the environment and genotypes, as shown by their markedly variable frequencies and different patterns of methylation changes. These investigations may enhance our comprehension of stress inducted epigenetic transformation in edible mushroom.

Acknowledgements

This study was financially supported by National Natural Science Foundation of China (31471926). The authors thank Bao Liu for his molecualr epigenetic expertise and SOSSAH FREDERICK LEO for English correction of the manuscript.

References

Albertini, E. and G. Marconi, 2013. Methylation-Based Markers, pp: 251-264. Diagnostics in Plant Breeding

Antequera, F., M. Tamame, J.R. Villanueva and T. Santos, 1984. DNA methylation in the fungi. J. Biol. Chem., 259: 8033-8036

Bassam, B.J., G. Caetanoanolles and P.M. Gresshoff, 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem., 196: 80-83

Boyko, A. and I. Kovalchuk, 2008. Epigenetic control of plant stress response. Environ. Mol. Mutagen, 49: 61-72

Choi, D.B., H.G. Nam and W. Cha, 2006. Studies on cultivation and biological activities of Pleurotus nebrodensis inzenga. Kor. J. Chem. Eng., 23: 241-246

Diez, C.M., K. Roessler and B.S. Gaut, 2014. Epigenetics and plant genome evolution. Curr. Opin. Plant Biol., 18: 1-8

Fang, J.G. and C.T. Chao, 2007. Methylation-Sensitive Amplification Polymorphism in Date Palms (Phoenix dactylifera L.) and their Off-Shoots. Plant Biol., 9: 526-533

Foss, H.M., C. Roberts, K.M. Claeys and E.U. Selker, 1993. Abnormal chromosome behavior in Neurospora mutants defective in DNA methylation. Science, 262: 1737-1741

Foulongne-Oriol, M., C. Murat, R. Castanera, L. Ramirez and A.S. Sonnenberg, 2013. Genome-wide survey of repetitive DNA elements in the button mushroom Agaricus bisporus. Fungal Genet. Biol., 55: 6-21

Gavery, M. and S. Roberts, 2010. DNA methylation patterns provide insight into epigenetic regulation in the Pacific oyster (Crassostrea gigas). BMC Genomics, 11: 483-483

Hanai, L.R., E.I.S. Floh, M.H.P. Fungaro, C. Santacatarina, F.M. De Paula, A.M. Viana and M.L.C. Vieira, 2010. Methylation patterns revealed by MSAP profiling in genetically stable somatic embryogenic cultures of Ocotea catharinensis (Lauraceae). In Vitro Cell Dev-PL, 46: 368-377

Hashida, S., K. Kitamura, T. Mikami and Y. Kishima, 2003. Temperature Shift Coordinately Changes the Activity and the Methylation State of Transposon Tam3 in Antirrhinum majus. Plant Physiol., 132: 1207-1216

Heard, E. and R.A. Martienssen, 2014. Transgenerational Epigenetic Inheritance: Myths and Mechanisms. Cell, 157: 95-109

Herrera, C.M. and P. Bazaga, 2010. Epigenetic differentiation and relationship to adaptive genetic divergence in discrete populations of the violet Viola cazorlensis. New Phytol., 187: 867-876

Jeon, J., J. Choi, G.W. Lee, S.Y. Park, A. Huh, R.A. Dean and Y.H. Lee, 2015. Genome-wide profiling of DNA methylation provides insights into epigenetic regulation of fungal development in a plant pathogenic fungus, Magnaporthe oryzae. Sci. Rep., 5: 8567-8567

Jullien, P.E., D. Susaki, R. Yelagandula, T. Higashiyama and F. Berger, 2012. DNA Methylation Dynamics during Sexual Reproduction in Arabidopsis thaliana. Curr. Biol., 22: 1825-1830

Karan, R., T. Deleon, H. Biradar and P.K. Subudhi, 2012. Salt Stress Induced Variation in DNA Methylation Pattern and Its Influence on Gene Expression in Contrasting Rice Genotypes. PLoS ONE, 7: 1-10

Keyte, A.L., R. Percifield, B. Liu and J.F. Wendel, 2006. Infraspecific DNA Methylation Polymorphism in Cotton (Gossypium hirsutum L.). J. Hered., 97: 444-450

Kidwell, K.K., T.C. Osborn and J.S. Beckman, 1992. Simple Plant DNA Isolation Procedures, Plant Genomes: Methods for Genetic and Physical Mapping, pp: 250-232

Liramedeiros, C.F., C. Parisod, R. Fernandes, C.S. Mata, M.A. Cardoso and P.C.G. Ferreira, 2010. Epigenetic variation in mangrove plants occurring in contrasting natural environment. PLoS ONE, 5: 1-8

Liu, S., J. Lin, H. Wu, C. Wang, S. Huang, Y. Luo, J. Sun, J. Zhou, S. Yan and J. He, 2012. Bisulfite Sequencing Reveals That Aspergillus flavus Holds a Hollow in DNA Methylation. PLoS ONE, 7: 1-9

Lv, H., Y. Kong, Q. Yao, B. Zhang, F. Leng, H. Bian, J. Balzarini, E. Van Damme and J. Bao, 2009. Nebrodeolysin, a novel hemolytic protein from mushroom Pleurotus nebrodensis with apoptosis-inducing and anti-HIV-1 effects. Phytomedicine, 16: 198-205

Magill, J.M. and C.W. Magill, 1989. DNA methylation in fungi. Genesis, 10: 63-69

Matzke, M. and R.A. Mosher, 2014. RNA-directed DNA methylation: an epigenetic pathway of increasing complexity. Nat. Rev. Genet., 15: 394-408

Meng, F.R., Y.C. Li, J. Yin, H. Liu, X.J. Chen, Z.F. Ni and Q.X. Sun, 2012. Analysis of DNA methylation during the germination of wheat seeds. Biol. Plant., 56: 269-275

Mishra, P.K., M. Baum and J. Carbon, 2011. DNA methylation regulates phenotype-dependent transcriptional activity in Candida albicans. Proc. Natl. Acad. Sci. USA, 108: 11965-11970

Miyazawa, N., M. Okazaki and S. Ohga, 2008. Antihypertensive Effect of Pleurotus nebrodensis in Spontaneously Hypertensive Rats. J. Oleo Sci., 57: 675-681

Moran, P. and A. Perezfigueroa, 2011. Methylation changes associated with early maturation stages in the Atlantic salmon. BMC Genet., 12: 86-94

Naydenov, M., V. Baev, E. Apostolova, N. Gospodinova, G. Sablok, M. Gozmanova and G. Yahubyan, 2015. High-temperature effect on genes engaged in DNA methylation and affected by DNA methylation in Arabidopsis. Plant Physiol. Bioch., 87: 102-108

Omidvar, V. and M. Fellner, 2015. DNA Methylation and Transcriptomic Changes in Response to Different Lights and Stresses in 7B-1 Male- Sterile Tomato. PLoS ONE, 10: 1-23

Ou, X., T. Zhuang, W. Yin, Y. Miao, B. Wang, Y. Zhang, X. Lin, C. Xu, D. Von Wettstein and S. Rustgi, 2015. DNA Methylation Changes Induced in Rice by Exposure to High Concentrations of the Nitric Oxide Modulator, Sodium Nitroprusside. Plant. Mol. Biol. Rep., 33: 1428-1440

Paun, O., R.M. Bateman, M.F. Fay, M. Hedren, L. Civeyrel and M.W. Chase, 2010. Stable Epigenetic Effects Impact Adaptation in Allopolyploid Orchids (Dactylorhiza: Orchidaceae). Mol. Biol. Evol., 27: 2465-2473

Portis, E., A. Acquadro, C. Comino and S. Lanteri, 2004. Analysis of DNA methylation during germination of pepper (Capsicum annuum L.) seeds using methylation-sensitive amplification polymorphism (MSAP). Plant Sci., 1: 169-178

Qi, B., X. Zhong, B. Zhu, N. Zhao, L. Xu, H. Zhang, X. Yu and B. Liu, 2010. Generality and characteristics of genetic and epigenetic changes in newly synthesized allotetraploid wheat lines. J. Genet. Genom., 37: 737-748

Richards, C.L., A.W. Schrey and M. Pigliucci, 2012. Invasion of diverse habitats by few Japanese knotweed genotypes is correlated with epigenetic differentiation. Ecol. Lett., 15: 1016-1025

Rountree, M.R. and E.U. Selker, 1997. DNA methylation inhibits elongation but not initiation of transcription in Neurospora crassa. Gene. Dev., 11: 2383-2395

Salmon, A., J. Clotault, E. Jenczewski, V. Chable and M.J. Manzanaresdauleux, 2008. Brassica oleracea displays a high level of DNA methylation polymorphism. Plant Sci., 174: 61-70

Schulz, B., R.L. Eckstein and W. Durka, 2013. Scoring and analysis of methylation-sensitive amplification polymorphisms for epigenetic population studies. Mol. Ecol. Resour., 13: 642-653

Selker, E.U. and J.N. Stevens, 1987. Signal for DNA methylation associated with tandem duplication in Neurospora crassa. Mol. Cell Biol., 7: 1032-1038

Sherman, J.D. and L.E. Talbert, 2002. Vernalization-induced changes of the DNA methylation pattern in winter wheat. Genome, 45: 253-260

Steward, N., M. Ito, Y. Yamaguchi, N. Koizumi and H. Sano, 2002. Periodic DNA Methylation in Maize Nucleosomes and Demethylation by Environmental Stress. J. Biol. Chem., 277: 37741-37746

Tan, M., 2010. Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism. Plant Physiol. Bioch., 48: 21-26

Verhoeven, K.J.F., J.J. Jansen, P.J. Van Dijk and A. Biere, 2010. Stress-induced DNA methylation changes and their heritability in asexual dandelions. New Phytol., 185: 1108-1118

Vos, P., R. Hogers, M. Bleeker, M. Reijans, T.V. De Lee, M. Hornes, A. Friters, J. Pot, J. Paleman and M. Kuiper, 1995. AFLP: a new technique for DNA fingerprinting. Nucl. Acids Res., 23: 4407-4414

Wada, Y., K. Miyamoto, T. Kusano and H. Sano, 2004. Association between up-regulation of stress-responsive genes and hypomethylation of genomic DNA in tobacco plants. Mol. Genet. Genom., 271: 658-666

Wang, W., Y. Pan, X. Zhao, D.J. Dwivedi, L. Zhu, J.R. Ali, B. Fu and Z. Li, 2011. Drought-induced site-specific DNA methylation and its association with drought tolerance in rice (Oryza sativa L.). J. Exp. Bot., 62: 1951-1960

Wang, Y., Z. Wang, C. Liu, S. Wang and H. Bo, 2015. Genome-wide analysis of DNA methylation in the sexual stage of the insect pathogenic fungus Cordyceps militaris. Fungal Biol., 119: 1246-1254

Xiong, L.Z., C.G. Xu, S.M. Ma and Q. Zhang, 1999. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique. Mol. Gen. Genet., 261: 439-446

Xuelin, L.I., Z. Lin, Y. Nie, X. Guo and X. Zhang, 2009. Methylation-Sensitive Amplification Polymorphism of Epigenetic Changes in Cotton Under Salt Stress. Acta Agron. Sin., 35: 588-596

Yaish, M.W., J. Colasanti and S.J. Rothstein, 2011. The role of epigenetic processes in controlling flowering time in plants exposed to stress. J. Exp. Bot., 62: 3727-3735

Yi, C., S. Zhang, X. Liu, H.T. Bui and Y. Hong, 2010. Does epigenetic polymorphism contribute to phenotypic variances in Jatropha curcas L. BMC Plant Biol., 10: 259-268

Zemach, A., I.E. Mcdaniel, P. Silva and D. Zilberman, 2010. Genome-Wide Evolutionary Analysis of Eukaryotic DNA Methylation. Science, 328: 916-919

Zeng, F., L. Li, N. Liang, X. Wang, X. Li and Y. Zhan, 2015. Salt tolerance and alterations in cytosine methylation in the interspecific hybrids of Fraxinus velutina and Fraxinus mandshurica. Euphytica, 205: 721-737

Zhang, M., C. Xu, H. Yan, N. Zhao, D. Von Wettstein and B. Liu, 2009. Limited tissue culture-induced mutations and linked epigenetic modifications in F1 hybrids of sorghum pure lines are accompanied by increased transcription of DNA methyltransferases and 5-methylcytosine glycosylases. Plant J., 57: 666-679

Zhong, L., Y. Xu and J. Wang, 2009. DNA-methylation changes induced by salt stress in wheat Triticum aestivum. Afr. J. Biotechnol., 8: 6201-6207
COPYRIGHT 2017 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2017 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Hua, Shuang; Qi, Bao; Fu, Yong-Ping; Li, Yu
Publication:International Journal of Agriculture and Biology
Article Type:Report
Date:Apr 30, 2017
Words:4789
Previous Article:Comparison of Biochemical Components within White and Brown Cysts in the Cereal Cyst Nematode Heterodera avenae.
Next Article:Enhancing Growth of Buckwheat Sprouts and Microgreens by Endophytic Bacterium Inoculation.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters