Printer Friendly

DETERMINATION OF DOPAMINE RECEPTOR D2 GENE RS1800497 POLYMORPHISM USING REAL-TIME POLYMERASE CHAIN REACTION/DETERMINACIJA POLIMORFIZMA GENA ZA DOPAMINSKI RECEPTOR D2 RS1800497 PRIMENOM REAL-TIME POLIMERAZNE LANCANE REAKCIJE.

Introduction

The dopamine receptor D2 (DRD2) is a transmembrane protein which belongs to the class of G-protein-coupled receptors (also known as the seven-transmembrane domain receptors) [1]. Its role is reflected in the dopamine binding and inhibiting the activity of adenylyl cyclase, an enzyme from the lyase group which is a part of the cyclic adenosine monophosphate (cAMP) signal pathway which, in addition to the phosphatidylinositol pathway, represents the way in which the G-protein coupled receptors transmit a signal. G-proteins consist of alpha, beta and gamma chains. Guanosine diphosphate (GDP) or guanosine triphosphate (GTP) is bound to the alpha chain, while the remaining two chains provide a connection to the cell membrane. At the moment when the ligand is bound to the receptor, the G-protein, which is connected to it, releases GDP in order to bind GTP. Then, the alpha chain to which GTP is bound, dissociates from the complex that it builds with other chains and goes to the inactivated adenylyl cyclase molecule and activates it. Adenylyl cyclase acts by converting adenosine triphosphate (ATP) into cAMP. The resulting cAMP further causes a cascade activation of the whole family of protein kinases that phosphorylate, thereby activating a large number of specific cell enzymes, which ultimately leads to the final intra-cellular effect of ligand. Accordingly, the indirect inhibitory effect of dopamine on the adenylate-cyclase prevents this cascade of events. A large number of hormones, such as adrenaline, noradrenaline, antidiuretic hormone, glucagon, and others, act through the cAMP signal pathway [2]. The DRD2 gene, localized on chromosome 11 (11q23.2), encodes the D2 dopamine receptor synthesis [3]. The aforementioned DRD2 gene is located within the genomic region that is significant because of the single-nucleotide polymorphism (SNP) rs1800497 (Taq1A). Earlier it was believed that the SNP rs1800497 was 10 kb away downstream from the DRD2 gene and was placed in the 3' non-coding region. However, it was proven that the SNP rs1800497 is a part of the exon 8 of ankyrin repeat and protein kinase domain-containing protein 1 (ANKK1) gene [4]. The function of this gene is reflected in the encoding of ANKK1 enzyme (commonly known as non-specific protein kinase - PKK1) [5]. The mentioned enzyme is a part of the Ser/Thr protein kinase family, whose function is to phosphorylate a hydroxyl (-OH) group of serine or threonine in proteins with the help of cAMP-dependent protein kinase which activates it through phosphorylation [6, 7]. Studies have shown that the SNP rs1800497 leads to the replacement of glutamic acid with lysine at position 713 (Glu713Lys) in protein [8], thereby affecting the expression of the DRD2 receptor by changing its density and affinity [9]. As a result, two alleles (genetic variants) of the DRD2 gene, A1-A and A2-G, occur and A is a mutated allele [10].
Abbreviations

DNA   - deoxyribonucleic acid
DRD2  - dopamine receptor D2
SNP   - single nucleotide polymorphism
cAMP  - cyclic adenosine monophosphate
GDP   - guanosine diphosphate
GTP   - guanosine triphosphate
qPCR  - real-time polymerase chain reaction
Ct    - cycle threshold


Studies conducted in vivo, using positron emission tomography (PET), showed significant individual variations in terms of the density of DRD2 receptors in human striatum. A higher incidence of A2-G allele was observed in schizophrenic patients, which are claimed to have an increased density of DRD2 receptors [8]. The correlation of the Taq1A rs1800497 polymorphism with the reduced density of DRD2 receptors was also proven in persons who abuse alcohol, cocaine and opiates compared to healthy individuals [11].

Dopamine receptors D2 are also present in the kidneys where they have an anti-inflammatory role and are involved in blood pressure control. Deficit of DRD2 receptors in the kidneys, caused by rs1800497 polymorphism disrupts their protective function, which increases the incidence of inflammatory kidney diseases. An example of such a disease is the inflammation of the cells of the proximal kidney tubules which occurs due to the consequent increased expression of the pro-inflammatory tumor necrosis factor alpha (TNF[alpha]). In addition to inducing inflammatory reactions, the tumor necrosis factor stimulates the production of the transforming growth factor [beta]1 (TGF[beta]1), the main mediator in the kidney fibrosis development. Also, a reduced number of these receptors are associated with increased blood pressure. This is explained by the fact that DRD2 receptors participate in the inhibition of ion transport through proximal tubule cells in conditions when there is an optimal quantity of water (euvolemia) and a moderate increase in the volume of body fluids. A reduced number of DRD2 receptors can lead to increased transport of ions from proximal tubules to the interstitium, which is associated with the development of essential hypertension [12].

Certain studies demonstrated the correlation between the Taq1A rs1800497 polymorphism and obesity. Namely, as the Taq1A rs1800497 polymorphism affects the DRD2 receptor density, it is considered that the reduced density of the DRD2 receptor lies in the basis of the increased need for food. An analysis of the results obtained using the functional magnetic resonance imaging (fMRI) showed a reduced activation of dopamine pathways at the level of the orbitofrontal cortex and striatum of individuals who are carriers of the Taq1A rs1800497 polymorphism. This contributes to development of an unhealthy diet pattern that is characterized by excessive eating, weight gain and obesity [13].

The research is based on the hypothesis that the application of the real-time polymerase chain reaction (qPCR) method represents an optimal method for detecting the rs1800497 polymorphism of the DRD2 gene.

The main goal of the research is optimization of the qPCR method for detection of the DRD2 gene rs1800497 polymorphism.

Material and Methods

In this prospective study, five venous whole blood samples of healthy voluntary blood donors were used, from which the deoxyribonucleic acid (DNA) was isolated in order to test the outcome of the qPCR method. A total of 2 ml of venous blood was collected from each person into glass test tubes with 3.2% sodium citrate. Signed informed consents were obtained from all participants, and the study was approved by the Institutional Ethics Committee. The research was performed according to the Declaration of Helsinki. The samples were kept at -20[degrees] C until analysis. The DNA was extracted from all samples using DNA Blood Prep Isolation Kit (Quiagen, Hilden, Germany) according to the manufacturer's instructions. The genotyping of the DRD2 gene rs1800497 (context sequence part containing targeted SNP:CACAGCCATCCTCAAAGTGCTGGT C[A/G]AGGCAGGCGCCCAGCTGGACGTCCA) was carried out using qPCR and a set of reagents (assays) in order to determine the polymorphisms of a nucleotide with the corresponding fluorescent probes (TaqMan SNP, Applied Biosystems, Warrington, UK). The PCR was performed using 20 ng of genomic DNA together with 1[micro]l TaqMan genotyping assay (TaqMan fluorescent probes with targeted specific primers) and 12.5 [micro]l of TaqMan universal master mix supplied at a 2X concentration. The mix contained AmpliTaq Gold[R] DNA polymerase, Uracil-DNA glycosylase, dNTPs with dUTP, Passive Reference dye Rox and optimized buffer components. Genotyping was done in final 25[micro]l reaction mix in separate PCR tubes using ABI 7500 Fast PCR platform (Applied Biosystems, Foster City, California, USA). Two TaqMan probes were marked with "VIC[R]" and "FAM[R]" fluorescent dyes with two target-specific primers obtained from the manufacturer's assay kit (TaqMan SNP, Applied Biosystems, Warrington, UK) emitting fluorescence of different wavelengths. If the device detected one dye it was a VIC homozygote (A1A1-AA); if it detected another dye, it was a homozygote FAM (A2A2-GG); the detection of both dyes signified a heterozygote (A1A2-AG) [14, 15].

Results

The allele with the specific fluorescence curve was detected and analyzed using the 7500 System SDS program, integrated into the ABI 7500 Fast PCR platform. Ten samples gave the following results (Table 1):

When interpreting the results, two values, determined by the program in the exponential phase of the amplification, are important. The threshold line determines the level of detection at which the reaction reaches the threshold (the intensity of the fluorescence above the background "noise"). The cycle threshold (Ct) is the PCR cycle in which the threshold value is reached. The greater the initial quantity of a gene in the sample, the fewer cycles are required in order for the fluorescence to reach the threshold value, therefore the Ct value is lower. For the purpose of determining polymorphism, in the amplification plot section, we analyzed whether the sample is homozygote or heterozygote based on the fluorescence of the curve of a particular color. It is important that, in the case of heterozygote A1A2, the curves are close to each other and that the threshold is reached at about the same time, which confirms this genotype (Graph 1). In case where the distance of two curves is greater, the second curve is delayed and reflects a non-specific binding, which confirms the presence of the homozygote (Graph 2). The multicomponent plot section shows which alleles are present in the sample based on the dyes they are marked with (Graph 3) and (Graph 4). A1 allele (with polymorphism) was marked with FAM[R] and A2 allele with VIC.

Discussion

By applying the PCR method, a successful detection of the DRD2 gene polymorphism rs1800497 was carried out. Through analyzing the results of the PCR method, the presence of genetic variants of the DRD2 gene were successfully observed, and A1 and A2 alleles were found. One of ten samples was a A1A1 homozygote for mutated allele, three of ten were A2A2 homozygotes for wild type allele and six were A1A2 heterozygotes for mutated allele.

In earlier works, long-range PCRs with capillary electrophoresis, Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP), Polymerase Chain Reaction - Single-Strand Conformation Polymorphism (PCR-SSCP) and Southern blot technique were used to genotype the DRD2 gene rs1800497 polymorphism. These methods have proven to be successful in genotyping the specific polymorphism of DRD2 gene rs1800497. However, they are technically demanding, their performance is time consuming, the analysis of the results is more complex, and the reagent prices are higher; therefore, PCR method is more suitable in routine diagnostics.

Conclusion

The results of this research have shown that the application of the real-time polymerase chain reaction method is currently optimal for detecting the polymorphism. Although financially more demanding than other methods, due to its simplicity, speed, and reliability, it is recommended for detecting the rs180049 of the dopamine receptor D2 gene polymorphism in routine diagnostics.

References

[1.] Girault JA, Greengard P. The neurobiology of dopamine signaling. Arch Neurol. 2004;61(5):641-4.

[2.] Marinkov S, Borota J. Medicinska biohemija. 2nd ed. Novi Sad: Radnicki univerzitet ,,Radivoj Cirpanov"; 2006. p. 354-60.

[3.] DRD2 dopamine receptor D2 [Homo sapiens (human)] [Internet]. [updated 2019 Apr 15; cited 2019 Apr 17]. Available from: expressionhttps://www.ncbi.nlm.nih.gov/gene/1813#gene-expression.

[4.] Neville MJ, Johnstone EC, Walton RT. Identification and characterization of ANKK1: a novel kinase gene closely linked to DRD2 on chromosome band 11q23.1. Hum Mutat. 2004;23(6):540-5.

[5.] ANKK1 ankyrin repeat and kinase domain containing 1 [Homo sapiens (human)] [Internet]. [updated 2019 Apr 9; cited 2019 Apr 17]. Available from: https://www.ncbi.nlm.nih.gov/gene/255239.

[6.] ENZYME entry: EC 2.7.11.1 [Internet]. [updated 2018 Feb 28; cited 2018 Mar 16]. Available from: https://enzyme.expasy.org/EC/2.7.11.1.

[7.] Smith AD, Datta SP, Smith GH, Campbell PN, Bentley R, McKenzie HA, editors. Oxford dictionary of biochemistry and molecular biology. Revised ed. Oxford: Oxford University Press; 2000.

[8.] Cordeiro Q, Vallada H. Association study between the Taq1A (rs1800497) polymorphism and schizophrenia in a Brazilian sample. Arq Neuropsiquiatr. 2014;72(8):582-6.

[9.] Savitz J, Hodgkinson CA, Martin Soelch C, Shen PH, Szczepanik J, Nugent AC, et al. DRD2/ANKK1 Taq1A polymorphism (rs1800497) has opposing effects on D2/3 receptor binding in healthy controls and patients with major depressive disorder. Int J Neuropsychopharmacol. 2013;16(9):2095-101.

[10.] Lawford BR, Barnes M, Swagell CD, Connor JP, Burton SC, Heslop K, et al. DRD2/ANKK1 Taq1A (rs 1800497 C>T) genotypes are associated with susceptibility to second generation antipsychotic-induced akathisia. J Psychopharmacol. 2013;27(4):343-8.

[11.] Pohjalainen T, Rinne JO, Nagren K, Lehikoinen P, Anttila K, Syvalahti EK, et al. The A1 allele of the human D2 dopamine receptor gene predicts low D2 receptor availability in healthy volunteers. Mol Psychiatry. 1998;3(3):256-60.

[12.] Armando I, Villar VA, Jose PA. Dopamine and renal function and blood pressure regulation. Compr Physiol. 2011;1(3):1075-117.

[13.] Obregon AM, Valladares M, Goldfield G. Association of the dopamine D2 receptor rs1800497 polymorphism and eating behavior in Chilean children. Nutrition. 2017;35:139-45.

[14.] Maletic JS. Detekcija mutacija gena za alfa1-antitripsin primenom lancane reakcije polimeraze kod pacijenata sa hronicnom opstruktivnom bolesti pluca [dissertation]. Novi Sad: Univerzitet u Novom Sadu, Medicinski fakultet; 2012.

[15.] Rapley R. Molecular biology, bioinformatics and basic techniques. In: Wilson K, Walker J, editors. Principles and techniques of biochemistry and molecular biology. Cambridge: Cambridge University Press; 2010. p. 138-94.

Katarina BACULOV (1,2), Natasa S. VUCINIC (1,3), Jelena STOJCEVIC MALETIC (1,4) and Iva BARJAKTAROVIC (1,2)

University of Novi Sad, Faculty of Medicine Novi Sad (1)

Department of General Education Subjects, Novi Sad (2)

Department of Pharmacy (3)

Department of Biochemistry (4)

Doc. dr Natasa Vucinic, Medicinski fakultet Novi Sad, Zavod za farmaciju,21000 Novi Sad, Hajduk Veljkova 3,

E-mail: natasa.vucinic@mf.uns.ac.rs.

Rad je primljen 29. III 2019.

Recenziran 8. IV 2019.

Prihvacen za stampu 11. IV 2019.

BIBLID.0025-8105:(2019):LXXII:3-4:110-114.

https://doi.org/10.2298/MPNS1904110B
Table 1. Results of genotyping
Tabela 1. Rezultati genotipizacije

Heterozygote/Heterozigot     Homozygote          /Homozigot
A1A2                            A1A1                A2A2

6 samples/6 uzoraka       1 sample/1 uzorak  3 samples/3 uzorka
COPYRIGHT 2019 Drustvo Lekara Vojvodine
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2019 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Baculov, Katarina; Vucinic, Natasa S.; Maletic, Jelena Stojcevic; Barjaktarovic, Iva
Publication:Medicinski Pregled
Date:Mar 1, 2019
Words:2265
Previous Article:DRY EYE SYNDROME AND CATARACT SURGERY/SINDROM SUVOG OKA I OPERACIJA KATARAKTE.
Next Article:DUODENAL DIVERTICULUM ASSOCIATED WITH PANCREATITIS - A CASE REPORT/DIVERTIKULUM DUODENUMA UDRUZEN SA PANKREATITISOM - PRIKAZ SLUCAJA.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters