Printer Friendly

Curcumin inhibits the SOS response induced by levofloxacin in Escherichia coli.

ABSTRACT

The role of RecA protein in bacterial resistance to antibiotics makes this protein attractive from a pharmacological point of view. In this study we demonstrate that curcumin is able to inhibit the SOS response in Escherichia coli induced by levofloxacin. The [bla.sub.TEM-1] gene has been placed under the control of the LexA-binding box and used as reporter gene. The expression of TEM-1 [beta]-lactamase enzyme was increased in the presence of ssDNA induced by levofloxacin, while, the presence of curcumin at 8 [micro]g/ml, reduced dramatically the expression of the reporter gene. Moreover a simple microplate assay suitable for high-throughput screening has been developed.

Keywords:

Curcumin

Levofloxacin

Bacterial SOS response

Introduction

Drug resistance has emerged in pathogenic bacteria since the beginning of antibiotic era as consequence of the selective pressure caused by the intensive use of antimicrobial agents in chemotherapy. Resistance can be extended to the entire repertoire of available therapeutic agents. Nowadays, bacteria expressing phenotype Multidrug Resistance (MDR) are amongst the most important cause of infections in nosocomial and community settings. The emergence of MDR bacteria has serious consequences both in terms of therapeutic failures and impact on Health Care System.

Bacteria can resist to the action of antimicrobial agents by several mechanisms: target modification (e.g. fluoroquinolones), target over-expression (e.g. folate inhibitors pathway), antibiotic inactivation (e.g. beta-lactams and aminoglycosides), and modifications of the outer membrane permeability by reducing the expression of outer membrane-proteins (OMPs) or by increasing the expression of multidrug transporters (Webber and Piddock 2003; Tenover 2006).

Resistance to chemotherapeutic agents can be the consequence of horizontal or vertical transfer of resistance genes and/or intrinsic resistance arising by adaptive response to antimicrobial exposure.

In this context, exposure to agents which interfere with DNA replication or which are able to cause DNA damages, induces the expression of a set of genes designed SOS response. Most of the SOS related genes are involved in DNA repair, recombination, replication, biofilm formation and cell division (Walker 1987; Michel 2005; Janion 2008).

In Escherichia coli the SOS gene network is under control of the RecA protein which, as consequence of DNA damage, induces the autoproteolysis of LexA repressor which binds the 16 bp palindromic consensus sequence named LexA-binding box.

RecA is an ATP-dependent protein able to bind single-stranded DNA (ssDNA) forming a nucleoprotein filament. It is essential for DNA repair and maintenance. Moreover structural and functional homologous can be found in every living organisms. The RecA filament promotes the LexA cleavage reaction inducing the expression of the SOS response genes (Kim et al. 2008).

In E. coli about thirteen operons are under control of the LexA regulon, and their products are involved in several functions, such as DNA repair and induced mutagenesis. Collectively these genes take part in SOS response (Yaguchi et al. 2011).

For instance, the activation of error-prone DNA polymerases may induce an intrinsic resistance in bacteria (Tang et al. 1999).

Thus, the inhibition of the RecA-LexA system would reduce the development and transmission of favorable genetic characters (Beaber et al. 2004; Hastings et al. 2004; Hersh et al. 2004; Foster 2004; Matic et al. 2004). As demonstrated, RecA protein is a potential target for a variety of inhibitors (Lee et al. 2005; Wigle et al. 2006). One of the most active inhibitor seems to be the Indian yellow spice curcumin, a polyphenolic compound isolated from Curcuma longa L. (Oda 1995; Wigle and Singleton 2007), whose anti-inflammatory, anticarcinogenic and antioxidant activities have been well characterized (Aggrawal et al. 2007).

As mentioned above, curcumin has been demonstrated to inhibit the SOS response induced by UV irradiation in E. coli and Salmonella tiphymurium (Oda 1995), and to inhibit, in vitro, the activity of RecA protein (Wigle and Singleton 2007). Based on these data, it is of great interest to investigate whether curcumin is able to modulate the SOS response in E. coli induced by levofloxacin. In order to achieve the goal, a reporter gene was placed under control of the LexA protein by cloning the regulon lexA box uptream the [bla.sub.TEM-1] gene, encoding for the [beta]-lactamase enzyme TEM-1. The ability of curcumin to down-regulate the SOS response was determined by a simple and robust microplate assay. The developed assay has been demonstrated to be reproducible and suitable for high-throughput screening of potential SOS inhibitors.

Materials and methods

Antibiotics and reagents

Levofloxacin, ampicillin, tetracycline were obtained by Sigma-Aldrich, as well as curcumin. Nitrocefin was kindly provided by Pr. Shahriar Mobashery, Notre Dame University, Indiana, USA.

Bacterial strains

E. coli strain BL21 (fhuA2 [lon] ompT gal ([lambda] DE3) [dcm] [DELTA]hsdS, [lambda] DE3 = [lambda] sBamHIo [DELTA]EcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 [DELTA]nin5) (Studier et al. 1990) and E. coli strain HB101 (F-[DELTA](gpt-proA)62leuB6glnV44 ara-14 galK2 lacY1 [DELTA](mcrC-mrr) rpsL20 (StrR) xyl-5-mtl-1 recA13 thi-1)(Sambrook et al. 1989; Boyer and Roulland-Dussoix 1969) were purchased by New England Biolabs, Inc., E. coli BL21 (DE3) strain is [recA.sup.+], while in E. coli HB101 strain the recA gene is mutated in order to obtain a non functional protein ([recA.sup.-]) (Dutreix et al. 1989; Kowalczykowski 1991).

pBR322 vector and oligonucleotides

The pBR322 vector was purchased by New England Biolabs, Inc. pBR322 is a low number copy plasmid, containing the genes conferring resistance to ampicillin ([bla.sub.TEM-1]) and tetracycline (TET). The plasmid lacks for the T7 promoter. The oligonucleotides (MWG Biotech AG) were designed in order to clone the lexA box consensus sequence into the pBR322 vector upstream the b/aTEM-i reporter gene. The primers used for cloning are reported in Table 1. The Kpnl_lexA.box_TEM forward primer was designed in order to contain the restriction site KpnI, the lexA regulon and the first twenty-two nucleotides of [bla.sub.tem-1] gene. The KpnI_pBR322 reverse primer contains the KpnI restriction site and was arranged to match the twenty-three nucleotides upstream the [bla.sub.TEM-1] gene in the pBR322 plasmid.

Cloning of the lexA_box-[bla.sub.TEM-1] reporter gene in pBR322 vector

The recombinant pBR322-lexA_box-[bla.sub.TEM-1] was constructed by a long-PCR using the high-fidelity Taq polymerase extender system (5-PRIME). The whole plasmid was amplified by PCR using the above mentioned primers. The amplification reaction generates a linear DNA amplicon with the KpnI restriction site and the lexA consensus sequence placed upstream the initial methionine of [bla.sub.TEM-1] gene, and the KpnI restriction site at the other end.

Sticky ends were subsequently generated by KpnI restriction enzyme (New England Biolabs, Inc.) following the manufacturer instructions. The linear fragment was then circularized by DNA ligation using T4 DNA ligase (New England Biolabs, Inc.).

Transformation of E. coli BL21 and HB101 was performed by heath shock. The selection was performed on LB agar plates supplemented with ampicillin 100 [micro]g/ml and tetracycline 40 [micro]g/ml for pBR322 positive colonies; and tetracycline 40 [micro]g/ml for recombinant plasmid pBR322-lexA_box-[bla.sub.TEM-1] positive colonies.

In order to verify the presence of the lexA regulon upstream the reporter gene, DNA sequence was performed by direct sequencing of the PCR amplicon obtained with the oligonucleotide pBR322_CS_seq, using DNA sequencer ABI Prism 310 (Applied Biosystems, Monza, Italy).

Minimal inhibitory concentration

The antimicrobial susceptibility pattern of the organisms used in this study was determined in accordance with the CLSI guidelines (CLSI 2010). In detail, 50 [micro]l of each bacterial suspension in 0.9% saline solution (NaCl) were added to the wells of a sterile 96-well microtitre plate already containing 50 [micro]l of twofold serially diluted antibiotics and curcumin in cation-adjusted Mueller-Hinton, to reach a final volume in each well of 100 [micro]l. Positive control wells were prepared with culture medium and bacterial suspension. Negative control wells were prepared with culture medium and antibiotics or curcumin. The microtitre plates were incubated for 18 h at 37[degrees]C. The growth in each well was quantified spectrophotometrically at 595 nm by a microplate reader iMark, BioRad (Milan, Italy). The minimum inhibitory concentration (MIC) for drugs and curcumin was defined as the concentration of drug that reduced growth by 80% compared to that of organisms grown in the absence of drug. The MIC value was determined as the median of at least three independent experiments.

Nitrocefin assay

The nitrocefin assay was performed as previously described with some modifications (O'Callaghan et al. 1972). Preheated BHI (brain heart infusion) at 37[degrees]C was inoculated with an overnight culture of each bacterial strain to OD595 of 0.05 and grown at 37[degrees]C to mid exponential phase corresponding to [OD.sub.595] of 0.5. An aliquot (1 ml) of culture was centrifuged at 12,000 rpm for 15min at 4[degrees]C and the pellet was then suspended in 1 ml of ice cold phosphate buffer (PB) lOOmM, pH 7.4 and kept in ice. This is the time zero control. Levofloxacin (3.9 x [10.sup.-4] [micro]g/ml for E. coli BL21 (DE3) and 7.8 x [10.sup.-3] [micro]g/ml for E. coli HB101) and curcumin at different concentrations (0, 2, 4, 8 [micro]g/ml) were added to several aliquots of bacterial culture and allowed to grow at 37[degrees]C for 60 min. Aliquots of E. coli BL21 (DE3) and HB101 cultures without levofloxacin and curcumin were conceived as control. After incubation the samples were separated in two equal aliquots. Both the fractions were centrifuged at 12,000 rpm for 15 min at 4[degrees]C and the pellets washed twice with ice cold PB. One aliquot was kept in ice and used for bacterial optical density determination, the other stored at -80[degrees]C for protein quantification.

500 [micro]l of each sample from the first aliquot was diluted 1:2 in PB. 50 [micro]l of bacterial suspension was added to the wells of a sterile 96-well microtitre plate already containing 50 [micro]l of PB. The bacterial density in each well was quantified spectrophotometrically at 595 nm by a microplate reader iMark, BioRad (Milan, Italy).

The pellets from the aliquot stored at -80[degrees]C were thawed, suspended in PB at 37[degrees]C containing 1 mg/ml of lysozyme and centrifuged for 30 min at 12,000 rpm at 4[degrees]C after 30 min incubation at 37[degrees]C. 50 [micro]l of diluted (1:2 in PB) supernatant was added to the wells of a sterile 96-well microtitre plate already containing 50 [micro]l of nitrocefin (180 [micro]M in PB). The hydrolysis of nitrocefin was quantified spectrophotometrically at 495 nm.

The initial velocity ([v.sub.0]) of nitrocefin hydrolysis determined for the first 10-20% of the reaction was normalized versus the bacterial density in order to obtain the specific activity of TEM-1 enzyme related to bacterial density.

Statistical analysis

All experiments were conducted at least in triplicate and the statistical significance of each difference observed among the mean values was determined by standard error analysis. The GraphPad software (Prism, version 5.00) was used to evaluate the significance of differences between group means by one-way analysis of variance (one-way ANOVA) followed by Bonferroni pairwise comparison test with a 95% of confidence interval. P<0.05 was considered to be statistically significant.

Results and discussion

pBR322 is one of the most commonly used E. coli cloning vectors. pBR322 is 4361 bp in length and contains the [bla.sub.TEM-1] gene, coding for the [beta]-lactamase enzyme TEM-1, which confers resistance to ampicillin. Since the lexA box consensus sequence is only 16 bp, in order to clone it upstream the [bla.sub.TEM-1] reporter gene the entire vector was amplified by long PCR by using a proofreading DNA polymerase. The insertion of the KpnI restriction site allowed the circularization of the linear amplicon.

E.coli BL21 ([recA.sup.+]) and HB101 ([recA.sup.-]) strains were transformed with the vectors pBR322-[bla.sub.TEM-1] and pBR322-lexA_box-[bla.sub.TEM-1].

For each of them the minimal inhibitory concentration was calculated. As shown in Table 2 the MIC values for the wild-type strains against ampicillin are comparable with those where the reporter gene blaTEM-1 is under the control of the repressor LexA. While MIC values for the strains carrying the pBR322-[bla.sub.TEM-1] are considerably higher. The simply calculation of MIC values confirmed that the expression of [bla.sub.TEM-1] gene is repressed by the presence of lexA box upstream the reporter gene.

The MICs for levofloxacin are comparable among the transformed E. coli cells; while it was not possible to determine the MIC value for curcumin (>16 [micro]g/ml) since this compound was insoluble at higher concentrations.

The expression of the reporter gene was evaluated by following the hydrolysis of the chromogenic substrate nitrocefin. The initial velocity of nitrocefin hydrolysis by TEM-1 [beta]-lactamase enzyme was measured and then normalized to bacterial density. The assay was arranged in order to obtain the maximum expression ofTEM-1 enzyme and lowest cellular death. The sub-inhibitory concentration of levofloxacin (0.25-fold the MIC value), at 60 min of incubation was demonstrated to be the best combination (data not shown).

Bacterial strains containing the repressed reporter gene were incubated in the presence and absence of levofloxacin and different concentrations of curcumin. In Fig. 1 the relative activity of TEM-1 enzyme for E. coli BL21 and HB101 pBR322-lexA_box-[bla.sub.TEM.1] is reported as percentage of activation or repression with respect to the relative activity of TEM-1 without levofloxacin and curcumin. In Fig. 1 it is possible to observe that when the concentration of levofloxacin is zero, as curcumin increases in concentration, the relative activity of the reporter enzyme decreases with the same fashion for both strains. However, when the same experiment is performed in the presence of sub-inhibitory concentration of levofloxacin, the behavior of the strains is significantly different. In fact, in the presence of levofloxacin and absence of curcumin, the relative activity of TEM-1 for the [recA.sup.+] strain (E. coli BL21), as expected, increases of the 30% with respect to the control (LVX = 0, CUR=0), while it decreases for the [recA.sup.+] strain (E. coli HB101). As the concentration of curcumin increases, the relative activity of the enzyme decreases, for E. coli BL21, up to be the 10% lower with respect to the control.

The statistical significance of each difference observed among the mean values is reported in Figs. 2 and 3 for E. coli BL21 and HB101, respectively. As shown in Fig. 2A, no statistical significance is observed when E. coli BL21 is incubated in the presence of the only curcumin, if compared with the control (LVX = 0, CUR = 0). The presence of levofloxacin induced a statistically significant increasing of activity which becomes not significant (p>0.05) at curcumin 4 [micro]g/ml and 8 [micro]g/ml (Fig. 2B). Finally, Fig. 2C shows as the decreasing of activity in the presence of curcumin, is significant when its concentration reaches 8 [micro]g/ml. This presumably reflects a negative regulation of the expression of [bla.sub.tem-1] gene.

As shown in Fig. 3A, the only presence of curcumin is able to induce a significant decreasing of activity in E. coli HB101. As expected in this strain, the presence of levofloxacin also induces a significant reduction of activity (Fig. 3B). The lack of RecA enzyme makes the cells not responsive to the presence of levofloxacin and curcumin, which otherwise, seems to down-regulate the expression of [bla.sub.TEM-1] gene. Fig. 3C shows as the simultaneous presence of sub-inhibitory concentration of levofloxacin and increasing concentrations of curcumin have no influence on the relative activity of the reporter protein.

In conclusion, the experiments confirmed that curcumin suppresses the SOS response induced by levofloxacin. The inhibition of the SOS response, visible by the reduction of the expression of reporter gene, is the result of the interference of curcumin with the RecA-LexA system. In consideration of the data available in literature (Wigle and Singleton 2007), it is plausible to presume that the inhibitory activity of curcumin is exerted on the RecA protein. For instance, curcumin might act as inhibitor of the binding of RecA protein to the ssDNA induced by levofloxacin.

In this study we also propose a new and robust method for the high-throughput screening of potential inhibitors of the SOS response mediated by the RecA-LexA system. Precisely, the proposed assay is able to investigate the modulation of the SOS response "in vivo", on the whole cell, making possible also to evaluate the ability of candidate molecules to permeate inside the bacterial cell. This method can be used as the "front experiment" for further investigations.

Conflict of interest

There was no conflict of interest.

ARTICLE INFO

Article history:

Received 7 August 2013

Received in revised form 4 September 2013

Accepted 5 October 2013

Acknowledgements

This work was partially supported by MIUR (Ministero dell'lstruzione, deH'Universita e della Ricerca) EX MURST 60%, Pr. Gianfranco Amicosante, Dr. Mariagrazia Perilli and Dr. Giuseppe Celenza.

References

Aggrawal, B.B., Sundaram, C., Malani, N., Ichkawa, H., 2007. Curcumin: the Indian solid gold. Adv. Exp. Med. Biol. 595, 1-75.

Beaber, J.W., Hochhut, B., Waldor, M.K., 2004. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature 427, 72-74.

Boyer, H.W., Roulland-Dussoix, D., 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41, 459-472.

Clinical Laboratory Standards Institute, 2010. Performance Standards for Antimicrobial Susceptibility Testing Twenty-First Informational Supplement M100-S21.

Dutreix, M., Moreau, P.L., Bailone, A., Galibert, F., Battista, J., Walker, G.C., Devoret, R., 1989. New recA mutations that dissociate the various RecA protein activities in Escherichia coli provide evidence for an additional role for RecA protein in UV mutagenesis. J. Bacteriol. 171, 2415-2423.

Foster, P.L., 2004. Stress responses and genetic variation in bacteria. Mutat. Res. 569, 3-11.

Hastings, P.J., Rosenberg, S.M., Slack, A., 2004. Antibiotic-induced lateral transfer of antibiotic resistance. Trends Microbiol. 12, 401-404.

Hersh, M.N., Ponder, R.G., Hastings, P.J., Rosenberg, S.M., 2004. Adaptive mutation and amplification in Escherichia coli: two pathways of genome adaptation under stress. Res. Microbiol. 155, 352-359.

Janion, C., 2008. Inducible SOS response system of DNA repair and mutagenesis in Escherichia coli. Int. J. Biol. Sci. 4, 338-344.

Kim, C.G., Christine, B.M., John, W.L., 2008. RecA-dependent cleavage of LexA dimers. J. Mol. Biol. 377, 148-161.

Kowalczykowski, S.C., 1991. Biochemical and biological function of Escherichia coli RecA protein: behavior of mutant RecA proteins. Biochimie 73, 289-304.

Lee, A.M., Ross, C.T., Zeng, B.B., Singleton, S.F., 2005. A molecular target for suppression of the evolution of antibiotic resistance: inhibition of the Escherichia coli RecA protein by N 6-(l-naphthyl)-ADP. J. Med. Chem. 48, 5408-5411.

Matic, L, Taddei, F., Radman, M., 2004. Survival versus maintenance of genetic stability: a conflict of priorities during stress. Res. Microbiol. 155, 337-341.

Michel, B., 2005. After 30 years of study, the bacterial SOS response still surprises us. PLoS Biol. 3, 1174-1176.

O'Callaghan, C.H., Morris, A., Kirby, S.M., Shingler, A.H., 1972. Novel method for detection of beta-lactamases by using a chromogenic cephalosporin substrate. Antimicrob. Agents Chemother. 1, 283-288.

Oda, Y., 1995. Inhibitory effect of curcumin on SOS functions induced by UV irradiation. Mutat. Res. 348, 67-73.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Studier, F.M., Rosenberg, A.H., Dunn, J.J., Dubendorff, J.W., 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89.

Tang, M., Shen, X., Frank, E.G., O'Donnel, M., Woodgate, R., Goodman, M.F., 1999. UmuD'(2)C is an error-prone DNA polymerase, Escherichia coli pol V. Proc. Natl. Acad. Sci. U.S.A. 96, 8919-8924.

Tenover, F.C., 2006. Mechanisms of antimicrobial resistance in bacteria. Am. J. Med. 119, S3-S10.

Walker, G.C., 1987, The SOS response of Escherichia coli. In: Ingraham, J., Low, K.B., Magasnik, B., Niedhart, F., Schaecter, M. (Eds.), Escherichia coli and Salmonella typhimurium, vols. I and II. American Society of Microbiology, Washington, DC (Chapter 84).

Webber, M.A., Piddock, L.J.V., 2003. The importance of efflux pumps in bacteria] antibiotic resistance.]. Antimicrob. Chemother. 51, 9-11.

Wigle, T.J., Lee, A.M., Singleton, S.F., 2006. Conformationally selective binding of nucleotide analogues to Escherichia coli RecA: a ligand-based analysis of the RecA ATP binding site. Biochemistry 45, 4502-4513.

Wigle, T.J., Singleton, S.F., 2007. Directed molecular screening for RecA ATPase inhibitors. Bioorg. Med. Chem. Lett. 17, 3249-3253.

Yaguchi, K., Mikami, T., Igari, K., Yoshida, Y., Yokoyama, K., Makino, K., 2011. Identification of LexA regulated promoters in Escherichia coli 0157:H7. J. Gen. Appl. Microbiol. 57, 219-230.

Pierangelo Bellio, Fabrizia Brisdelli, Mariagrazia Perilli, Alessia Sabatini, Carlo Bottoni, Bernardetta Segatore, Domenico Setacci, Gianfranco Amicosante, Giuseppe Celenza (*)

Department of Biotechnological and Applied Clinical Sciences, University of l'Aquila, Italy

* Corresponding author at: Biotechnological and Applied Clinical Sciences, University of l'Aquila, Via Vetoio, 1, 67100 l'Aquila, Italy. Tel.: +39 0862433444.

E-mail address: celenza@univaq.it (G. Celenza).

http://dx.doi.org/10.1016/j.phymed.2013.10.011

Table 1 Oligonucleotides used in this study.

Oligos           Sequences                         Tm
                                                   ([degrees]C)

KpnLLexBpx_TEM   GGTACCCTCTAWATATACACATGAGTATT     55
                 CAACATrrCCGTG
KpnLpBR322       GGTACCACTCTTCCTnTTCAAT ATT ATT    50
pBR322_CS_seq    AGCCTATGCCTACAGCATCCAG            62.1

In bold the restriction site for Kpnl, in italic the lexA box
consensus sequence, underlined the [bla.sub.TEM-1] gene.

Table 2 Minimum inhibitory concentration values of antibiotics
for the strains of E. coli.

Strains                                 Median MIC ([micro]g/ml)
                                          (range)

                                        Antibiotics

                                        AMP

BL21 WT                                 (2-4)4
BL21 pBR322-[bla.sub.TEM-1]             (16,384-32,768) 16,384
BL21 pBR322-lexA_box-[bla.sub.TEM-1]    (8-16)8
HB101 WT                                (4-8)8
HB101 pBR322-[bla.sub.TEM-1]            (8192-16,384) 16,384
HB101pBR322-lexA_box-[bla.sub.TEM-1]    16

Strains                                 Median MIC ([micro]g/ml)
                                          (range)

                                        Antibiotics

                                        LVX                  CUR

BL21 WT                                 3,90 x [10.sup.-2]   >16
BL21 pBR322-[bla.sub.TEM-1]             1.95 x [10.sup.-3]   >16
BL21 pBR322-lexA_box-[bla.sub.TEM-1]    1.56 x [lO.sup.-2]   >16
HB101 WT                                3.90 x [10.sup.-2]   >16
HB101 pBR322-[bla.sub.TEM-1]            1.56 x [10.sup.-2]   >16
HB101pBR322-lexA_box-[bla.sub.TEM-1]    1.56 x [10.sup.-2]   >16
COPYRIGHT 2014 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2014 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Bellio, Pierangelo; Brisdelli, Fabrizia; Perilli, Mariagrazia; Sabatini, Alessia; Bottoni, Carlo; Se
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Date:Mar 15, 2014
Words:3718
Previous Article:Zingerone regulates intestinal transit, attenuates behavioral and oxidative perturbations in irritable bowel disorder in rats.
Next Article:Alkamides from Echinacea disrupt the fungal cell wall-membrane complex.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |