Printer Friendly

Culture & characterisation of limbal epithelial cells & oral mucosal cells.

Limbal stem cell deficiency (LSCD) has been increasingly implicated as a cause of ocular surface diseases including pterygium. Limbal stem cells act as a physiological barrier to the ingress of conjunctival cells across the cornea (1). Deficiency leads to conjunctivalisation of the cornea, surface irregularity, and vascularisation. Limbal stem cells may be depleted by a wide range of pathological processes affecting the ocular surface including topical medications, ultraviolet, and ionizing radiation. Limbal cells can be absent because of chronic conditions like radiation, keratitis, drug toxicity and ocular cicatrical pemphegoid (2). One of the most serious pathological conditions in which limbal epithelial stem cells are deficient is Stevens-Johnson Syndrome also known as erythema multiform.

Bilateral LSCD requires allogenous limbal tissue as a source of limbal stem cells, and this necessitates long-term use of systemic immunosuppressants to avoid graft rejection (3,4). Therefore, sources of autologous tissue that can functionally replace the corneal epithelium have been considered as an alternative to allogenous limbal transplants. Since the corneal epithelium is of the stratified squamous type, autologous epithelial cells such as oral, conjunctival, nasal and oesophageal epithelia, all having a similar morphology, could be considered as an alternative to allogenous limbal transplants.

Extensive studies have been performed to investigate the feasibility of oral mucosal epithelium for this purpose, as it is easily available and can be harvested without invasive surgery (5). Keratin 3 (K3) is a reliable marker for corneal type differentiation and it is positive for epithelial cells of oral mucosa. Oral epithelial cells are considered as an ideal substitute for corneal epithelial cells for use in ocular surface reconstruction (6).

The wet-surfaced epithelia, produces a group of highly glycosylated protective membrane glycoproteins termed mucins--MUC (7). Mucin lubricates the apical surface of epithelium and provides a barrier against pathogen. Although the function of these mucins in the oral cavity remains to be elucidated, it is possible that these contribute to the epithelial protective mucin layer and act as receptors initiating one or more intracellular signal transduction pathways (8). At the ocular surface, at least three membrane-associated mucins (MUC1, 4, and 16) and two secreted mucins (MUC 5 and 7) are expressed (9).

Oral and corneal epithelium also plays a critical role as a microbial barrier (10). Various antimicrobial peptides (AMP) are known to be present on the epithelial cells of ocular and oral surface. The AMP produced by oral epithelial cells may act to control many commensal and pathogenic bacteria in oral cavity and play a critical role as a microbial barrier (10). The human [beta]-defensins (hBD) are peptides expressed by epithelia throughout the body including epithelia of oral cavity. There are now 28 known [beta]-defensin genes found in human, however; expression of hBD1, 2, and 3 has been most investigated (11).

Here, we report the explant culture method of cultivating oral mucosal epithelial cells and their characteristics in comparison to the limbal explant culture.

Material & Methods

Chemicals & reagents: Dulbecco's modified Eagle's medium (DMEM), Ham's F12 (HF12), Hanks balanced salt solution (HBSS), phosphate buffer saline (PBS), Trypan blue dye, antibiotics solution, foetal bovine serum (FBS), Haematoxylin and Eosin (H&E) staining solutions were purchased from Hi-Media, Mumbai, India. Streptomycin, amphotericin, mouse epidermal growth factor (EGF), transferrin, selenium, keratinocyte growth supplement and hydrocortisone were purchased from Invitrogen CA, USA. The tissue culture plastic plates were from Becton Dickinson, USA. RNA extraction and cDNA conversion (sensiscript reverse transcriptase) kit was obtained from Qiagen, Germany. The BrdU assay kit was purchased from Roche Applied Sciences, Germany. The specific primer sequences were obtained from Sigma Chemicals Co., USA.

Collection of oral mucosal and corneal limbal tissue: Institutional ethics committee board approved the study protocol. Oral tissues (n=6) were collected from (n=6) patients who underwent oral mucosal graft for bilateral LSCD at Sankara Nethralaya eye hospital, Chennai during 2006-07. After obtaining written consent from each patient, oral cavity was sterilized with topical povidone-iodine; 3x3mm specimen of mucosal tissue was surgically excised from the interior buccal mucosal epithelium under local anaesthesia. The tissue was excised carefully to exclude underlying submucosal connective or fat tissue and collected for further processing in DMEM with 3 per cent FBS and antibiotics as the transport medium.

Corneal limbal tissue (n=6) of 2 [mm.sup.3] from the cadaveric donor eye from the C U Shah eye bank of Medical Research Foundation, Sankara Nethralaya, Chennai, with the consent of donor or donor family was collected in the transport medium for further processing. The donor blood samples were screened for human immunodeficiency virus (HIV) type1 and 2, hepatitis B virus (HBV), hepatitis C virus (HCV) and Treponema pallidum infections. Data were collected on parameters; like age, sex, cause of death, time of death, time of donation and time of biopsy collection.

Explant culture of oral mucosal and limbal epithelial tissue: Both the tissues were processed by same methodology separately. The tissues were washed thrice with PBS containing double strength antibiotics and the epithelial tissues were cut into multiple bits using sterile bard-parker blade and were placed on the centre of the wells (plastic) using a sterile needle. The plates were incubated at 37[degrees]C and 5 per cent C[O.sub.2] for 5 min for adhesion. Two ml of the culture medium [equal volume of DMEM and F12 with 50 ng/ml of streptomycin, 1.25 ng/ml of amphotericin B 2 ng/ml of mouse epidermal growth factor (EGF), 5 ng/ml of insulin, 5 ng/ml of transferrin, 5 ng/ml of selenium, 5 mg of keratinocyte growth supplement, 0.5 mg/ml of hydrocortisone] supplemented with 10 per cent FBS was added to each well. The plates were incubated at 37[degrees]C and 5 per cent C[O.sub.2] for 21 days. The medium was changed once in two days until they reached confluence and cell growth was monitored daily for three weeks with an inverted phase contrast microscope (Nikon, Japan). Confluent cells were collected for further characterization.

Morphology and viability of cultivated cells: Cultures were monitored under an inverted phase contrast microscope (Nikon, Japan). The viability of cultivated cells was determined by staining with trypan blue. The cells were harvested, washed twice with PBS and 0.5 per cent trypan blue solution in PBS was added to the cell pellet and incubated at room temperature. About 10 [micro]l of the sample was loaded on heamocytometer chamber and numbers of viable and nonviable cells were counted.

Hematoxylin and eosin (H&E) staining: The cultures were fixed in 10 per cent neutral buffered formalin, processed and embedded in paraffin wax. The paraffin sections were generated, deparaffinized and stained with H & E stain. Sections were observed under a light microscope.

BrdU retention assay: Cell proliferation was assessed by measuring 5-bromo-2-deoxyuridine incorporation during DNA synthesis in proliferating cultured cells on the sixth day of passage. The detection of BrdU was performed according to manufacturer's instruction and chased for 1-21 days. The BrdU labelling indices were assessed by counting the nuclei through a microscope using 40X objective. The labelling index was expressed (12) as number of positively labelled nuclei/ total number of nuclei X 100 per cent.

RNA isolation and RT-PCR analysis: At the end of 21st day limbal and oral mucosal cells were treated with 0.02 per cent trypsin and harvested in RNAse free vial to extract total RNA. Semiquantitative RT-PCR was performed using sensiscript reverse transcriptases to study the expression of different putative stem cell markers designed (9,13,14) from published human gene sequences (Table I) along with respective positive control and housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control in eppendorf PCR systems. PCR products were fractionated by electrophoresis using 2 per cent agarose gel containing 0.5 per cent ethidium bromide with molecular marker HinfI [phi]pX digest to confirm the size of resultant product of amplification and documented in BioRad gel documentation system; Bio-Rad Laboratories, UK.

Statistical analysis: All experiments were performed in triplicate. Summary data were reported as the mean [+ or -] SD. Student's t test was used for comparison between the two cultures.

Results

Morphological characterization of limbal and oral epithelial cells: Epithelial migration from both limbal and oral mucosal biopsies was noted at the end of 48 h (Fig. 1a, b). The cells further multiplied with outgrowth forming monolayer. Oral epithelial cells cultured under these conditions resembled corneal epithelium. The optical transparency of harvested cell sheets was equal to that of corneal epithelial- cell sheets originating from limbal stem cell. By the end of fifteenth day 90-100 per cent confluent growth, was seen and cells were harvested (Fig. 1c, d) which is shown by H & E staining (Fig. 1e, f). A slight elevated growth was seen in oral mucosal epithelial cells comparatively to limbal culture. Viable count, as estimated by trypan blue exclusion test, ranged from 95-98 per cent approximate yield of 4x10 (4) cells per [mm.sup.3] of the plate in both the cultures. There was rapid incorporation of BrdU at the end of 24 h in both the cultures. The cultures were chased continuously for 7, 14 and 21 days and the labelling index were calculated to plot a graph (Fig. 2). There were no statistically significant differences between two cultures.

Phenotypic characterization of limbal and oral epithelial cells: Molecular markers expression in the cultures of oral epithelial cells was compared with limbal epithelial cells (Table II). The mRNA expression of ABCG2, K3, p63, delta Np63 and isoforms of p63, (Fig. 3), MUC (Fig. 4) and AMP (Fig. 5) in both limbus and oral mucosal culture were studied with respective positive and internal controls. All the corneal/limbal phenotype stem cell markers were found to be expressed in oral mucosal epithelial cells. The isoforms of p63 were found to be expressed in oral mucosal cells though a few were absent in limbal cells. The oral cells did not express K12 gene. The MUC 1, 4 and 16 were expressed in oral mucosal culture whereas MUC 16 was absent in limbus. There was complete absence of AMP in limbal cells. hBD 1, 2 and 3 were expressed in oral mucosal epithelial cells. However, the expression of cathelicidin (LL37) was absent in both limbal and oral epithelial cells.

Discussion

Studies have shown that oral epithelial cells can be cultured and used as an alternative for allogenous limbal transplants in case of bilateral LSCD. ABCG2 is considered as a side population stem cell marker (15). In our study, the presence of this side population marker on cultured oral epithelial cells and limbal epithelial cells confirmed the presence of stem cell population. K3, the marker of corneal epithelial cell was found to be expressed by cultured oral epithelial cells, whereas K12 marker was not expressed. In this study we chose to investigate the expression of p63 among the novel markers that might be used to validate the phenotype of cultivated oral epithelial cells. Pellegrini et al (16) suggested that p63 is the first gene product that distinguishes stem cells from their transient amplified progeny in stratified squamous epithelia. The finding that p63 is specifically expressed by stem cells of human epidermis, limbal and oral epithelia and not by transient cells strongly suggests that p63 can be recognized as a stem cell marker (17). Both cultured oral and limbal epithelium expressed all the isoforms of p63 ([alpha],[beta],[gamma]). However, tranactivating (TA) domain variants were expressed only in the cultured oral epithelium and not in the limbal epithelium. Both oral mucosal and limbal epithelial sheets expressed transcripts for MUC1 and 4. MUC 16 was expressed only in oral epithelial cells and was absent in limbal cells. Several studies18 have shown alterations in the expression of carbohydrates and mucin-associated molecules on the ocular surface of patients with ocular cicatricial pemphigoid or other ocular surface diseases. The fact that similar expression pattern of membrane-associated mucins occurs in cultivated oral mucosal epithelial sheets and in limbal epithelium may be one of the reasons for the efficient of ectopic transplantation of a cultivated oral mucosal epithelial sheet on the cornea of patients with ocular surface diseases (9,19). Hence these expressions of mucin gene may contribute to the maintenance of a wet and healthy ocular surface after transplantation. In this study, we also investigated the expression of the AMP, hBD 1, 2 and 3 in limbal and oral mucosa epithelial cells. Despite constant threat from pathogenic microbes in the air and foreign objects, the incidence of ocular surface infection is amazingly low20. The limbal epithelium failed to express any of AMPs which may be due to the presence of antibiotics in culture. Inspite of same culture condition, there is presence of AMP's in oral epithelial cells which can be explained due to the source of environment. In the oral cavity the buccal epithelium is regularly perturbed by mechanical forces in mastication, acids in food or those produced by bacteria, proteases in saliva, toothpaste, alcohol, thermal insult, etc. and responds effectively to bacteria by producing antimicrobial peptides. The oral mucosal model is differentiated, expresses all three defensin group AMPs and has an intact sterile surface with a functional antimicrobial barrier. However, the expression of LL37 was absent in both oral and limbal epithelial cells. This model can serve as a useful basic tool for the study of tissue innate immune responses as a purely epithelial model.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

[FIGURE 5 OMITTED]

In conclusion, findings of this study, showed that oral epithelial cells can be cultured in vitro by explant culture method similar to limbal epithelial cells. Oral epithelial cultures have similar morphological features and express markers resembling limbal epithelial cells. Therefore in future, the feasibility of oral epithelial cells in clinical use should be evaluated for allogenous limbal transplants.

Acknowledgment

Authors acknowledge the Indian Council of Medical Research, New Delhi, for financial support.

Received September 19, 2008

References

(1.) Zaidi FH, Bloom PA, Corbett MC. Limbal stem cell deficiency: a clinical chameleon. Eye 2003; 17 : 837-9.

(2.) Dua HS, Azuara BA. Limbal stem cells of the corneal epithelium. Surv Ophthalmol 2000; 44 : 415-25.

(3.) Tsubota K, Satake Y, Kaido M, Shinozaki N, Shimmura S, Bissen MH, et al. Treatment of severe ocular-surface disorders with corneal epithelial stem-cell transplantation. N Engl J Med 1999; 340 : 1697-03.

(4.) Daya SM, Ilari FA. Living related conjunctival limbal allograft for the treatment of stem cell deficiency. Ophthalmology 2001; 108 : 126-33.

(5.) Soundarya LM, Geeta KV, Anirban B, Subhash G, Virender SS, Yashoda G. Culture and characterization of oral mucosal epithelial cells on human amniotic membrane for ocular surface reconstruction. Mol Vis 2008; 14 : 189-96.

(6.) Nakamura T, Inatomi T, Sotozono C, Amemiya T, Kanamura N, Kinoshita S. Transplantation of cultivated autologous oral mucosal epithelial cells in patients with severe ocular surface disorders. Br J Ophthalmol 2004; 88 : 1280-4.

(7.) Ilene KG. The ocular surface: The challenge to enable and protect vision. Invest Ophthalmol Vis Sci 2007; 48 : 4391-8.

(8.) Pablo A, Sandra SM, Cindy LR, Ann T, Ilene KG. MUC16: Mucin is expressed by the human ocular surface epithelia and carries the H185 carbohydrate epitope. Invest Ophthalmol Vis Sci 2003; 44 : 2487-95.

(9.) Yuichi H, Hiroaki S, Takeshi S, Kohji N. Expression of membrane-associated mucins in cultivated human oral mucosal epithelial cells. Cornea 2007; 26 : 65-9.

(10.) Alison MM. Defensins and other antimicrobial peptides at the ocular surface. Ocul Surf 2004; 2 : 229-47.

(11.) Maltsevai A, Fleiszig SM, Evans DJ, Kerr S, Sidhu SS, McNamaran A, et al. Exposure of human corneal epithelial cells to contact lenses in vitro suppresses the upregulation of human P-defensin-2 in response to antigens of Pseudomonas aeruginosa. Exp Eye Res 2007; 85 : 142-53.

(12.) Sasirekha K, Ambily V, Krishnakumar S. Comparative study in ex vivo expansion of human limbal epithelial cells with fetal bovine serum and human serum. J TamilNadu Ophtalmic Ass 2007; 45 : 61-3.

(13.) Janet RK, Wipawee N, Mitchell K, Whasun OC, Beverly AD. Antimicrobial barrier of an in vitro oral epithelial model. Arch Oral Biol 2006; 51 : 775-83.

(14.) Sudha B, Madhavan H, Sitalakshmi G, Malathi J, Krishnakumar S, Mori Y, et al. Cultivation of human corneal limbal stem cells in Mebiol gel[R]--A thermo-reversible gelation polymer. Indian J Med Res 2006; 124 : 655-64.

(15.) Sudha B, Sitalakshmi G, Geetha KI, Krishnakumar S. Comparison of pututative stem cell markers in limbal epithelial cells cultured on intact and denuded human amniotic membrane. Indian J Med Res 2008; 128 : 149-56.

(16.) Pellegrini G, Golisano O, Paterna P, Lambiase A, Bonini S, Rama P, et al. Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface. J Cell Biol 1999; 145 : 769-82."

(17.) Annie Y, Schweitzer R, Sun D, Kaghad M, Walker N, Bronson RT, et al. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 1999; 398 : 714-8.

(18.) Pablo A, Ann T, Sandra SM, Mika S, Ilene KG. Mucin characteristics of human corneal-limbal epithelial cells that exclude the Rose Bengal anionic dye. Invest Ophthalmol Vis Sci 2006; 47 : 113-9.

(19.) Bing L, Jessica RL, David PN, Paul T, Frank GO, Rodrigo VS, et al. Expression of membrane-associated mucins MUC1 and MUC4 in major human salivary glands. J Histochem Cytochem 2002; 50 : 811-20.

(20.) Richard SM, Jennie EC, Mashael A, Vijay S, Rajen G, Archana B, et al. The spectrum of antimicrobial peptide expression at the ocular surface. Invest Ophthalmol Vis Sci 2005; 46 : 1379-85.

Sasirekha Krishnan, Geetha Krishnan Iyer * & Subramanian Krishnakumar

L & T Department of Ocular Pathology, Vision Research Foundation & * Department of Cornea Services Medical Research Foundation, Sankara Nethralaya, India

Reprint requests: Dr Subramanian Krishnakumar, Department of Ocular Pathology, Vision Research Foundation, Sankara Nethralaya 18 College Road, Chennai 600 006, India

e-mail: drkrishnakumar_2000@yahoo.com
Table I. Primer sequences and reaction conditions for the RT-PCR

 Annealing
Gene Name Primer sequence--3'-5' temperature
 ([degrees]C)
ABCG2 FP: AGTTCCATGGCACTGGCCATA
 RP: TCAGGTAGGCAATTGTGAAGG 62
Keratin 3 FP: GGCAGAGATCGAGGGTCTC
 RP: GTCATCCTTCGCCTGCTGTAG 64
Keratin 12 FP: CATGAAGAAGAACCACGAGGATG
 RP: TCTGCTCAGCGATGGTTTCA 63

 Isoforms of p63

[DELTA]Np63 FP: CAGACTCAATTTAGTGAG
 RP: AGCTCATGGTTGGGGCAC 54
P63[alpha] FP: AGGGGCTGACCACCATCTAT
 RP: GTCTCACTGGAGCCCACACT 64
P63[alpha][beta] FP: CCACAGATTGCAGCATTGTC
 RP: GTGAATCGCACAGCATCAAT 64
P63[gamma] FP: CCCGGAGAGAAACTCCAAA
 RP: TTGGGTCTCTGAGCCAAAGT 64
TAp63[alpha] FP: GAAGATGGTGCGACAAACAA
 RP: ATGATGAACAGCCCAACCTC 63
TAp63[beta] FP: ATCGCATGTCGAAATTGCTC
 RP: TTACTACCTCAGGCGGTTCTG 63
TAp63[gamma] FP: TTACTACCTCAGGCGGTTCTG
 RP: ATGTGCTTCGAAAATCTCTAA 63

 Membrane protein--mucin--MUC

MUC1 FP: GCATCAGGCTCAGCTTCTACT
 RP: GTCTCTCTGCAGCTCTTGGTA 64
MUC4 FP: GCATCAGGCTCAGCTTCTACT
 RP: GTCTCTCTGCAGCTCTTGGTA 62
MUC16 FP: GCCTCTACCTTAACGGTTACAATGAA RP:
 GGTACCCCATGGCTGTTGTG 60

 Antimicrobial peptide--AMP

hBD-1 FP: GCCTCCAAAGGAGCCAGCGT
 RP: CTTCTGGTCACTCCCAGCTCA 54
hBD-2 FP: CAGCCATCAGCCATGAGG
 RP: TGGCTTTTTGCAGCATTTT 55
hBD-3 FP: AGCCTAGCAGCTATGAGGATC
 RP: CTTCGGCAGCATTTTCGGCCA 61
LL37 FP: CAGGACGACACAGCAGTCAC
 RP: CAGCAGGGCAAATCTCTTGT 54
GAPDH FP: GCCAAGGTCATCCATGACAAC
 RP: GTCCACCACCCTGTTGCTGTA 63

Gene Name Base pair size
 (bp)

ABCG2 379
Keratin 3 145
Keratin 12 150

 Isoforms of p63

[DELTA]Np63 440
P63[alpha] 196
P63[alpha][beta] 304,210
P63[gamma] 211
TAp63[alpha] 1436
TAp63[beta] 1547
TAp63[gamma] 1453

Membrane protein--mucin--MUC

MUC1 321
MUC4 243
MUC16 114

 Antimicrobial peptide--AMP

hBD-1 287
hBD-2 204
hBD-3 205
LL37 145
GAPDH 498

bp, Base pair; FP, Forward primer; RP, Reverse primer.
Glyceroldehyde-3-phosphate dehydrogenase (GAPDH) is an
internal control

Table II. mRNA expression on the cultured cells harvested at
the end of 21 days

Gene name Limbus Oral mucosa

ABCG2 + +
Keratin 3 + +
Keratin 12 + -

 Isoforms of p63

[DELTA]Np63 + +
p63[alpha] + +
p63[alpha][beta] + +
p63[gamma] + +
TAp63[alpha] - +
TAp63[beta] - +
TAp63[gamma] - +

 Membrane protein--mucin

MUC1 + +
MUC4 + +
MUC16 - +

 Antimicrobial peptide

hBD-1 - +
hBD-2 - +
hBD-3 - +
LL37 - -
GAPDH + +

GAPDH is an internal control. (+ Positive; - Negative)
COPYRIGHT 2010 Indian Council of Medical Research
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Krishnan, Sasirekha; Iyer, Geetha Krishnan; Krishnakumar, Subramanian
Publication:Indian Journal of Medical Research
Article Type:Report
Geographic Code:9INDI
Date:Mar 1, 2010
Words:3238
Previous Article:Ampullary tumours (ampullomas) in the elderly--an interdisciplinary problem.
Next Article:Plasma exchange with immunosuppression in pulmonary alveolar haemorrhage due to leptospirosis.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters