Printer Friendly

Cross Species Transfer of Microsatellite Loci in Scolytidae Species Mostly Associated with Mango (Mangifera indica L., Anacardiaceae) Quick Decline Disease.

Byline: Asad Masood, Bernhard C. Stoeckle, Ralph Kuehn and Shafqat Saeed

Abstract

Mango bark beetle, Hypocryphalus mangiferae Stebbing (Coleoptera: Curculionidae: Scolytinae) is frequently associated with mango quick decline disease in Pakistan, since it is also reported as a potential vector of quick decline disease. Hereby, we report the cross-amplification of five microsatellite markers in Hypocryphalus mangiferae, which were primarily characterized for other Scolytidae species. The markers were tested on 45 mango bark beetles individuals from nine different locations of Pakistan. Allelic richness ranged from two to eight alleles, the observed heterozygosity from 0.03 to 0.67, and the expected heterozygosity from 0.10 to 0.70. Two loci showed significant deviation from Hardy- Weinberg equilibrium and no linkage between the loci was detected. We also investigated cross-species amplification in Xyleborus spp. using the same five microsatellites . Three of the loci were monomorphic and two showed three and two alleles, respectively.

Observed heterozygosity val es ranged from 0.3824 to 0.0882, those for expected heterozygosity from 0. to 0.2752. These markers could potentially contribute in the management of the mango bark beetle.

Keywords: Mango, bark beetle, Hypocryphalus mangiferae, quick decline, microsatellite loci.

Bark and ambrosia beetles (Scolytidae:Coleoptera) are among the most economically important forest insects. Approximately 6000 species of scolytids have been described in the tropical and sub tropical regions world wide (Lieutier et al., 2004). Typically, beetles breed in the woody plants and bore characteristic galleries either in the phloem (bark beetle) or in the wood (ambrosia beetles) (Beaver, 1967). Mostly infection by all fungi on mango is facilitated by bark beetles as a wounding agent for their penetration within the vascular system (Batista, 1960; Al Adawi et al., 2006) that resulted in the infection and transmission of the pathogens to the mango tree (Ploetz, 2003). It was observed that bark beetle, Hypocryphalus mangiferae Stebbing (Coleoptera: Scolytidae) was most frequently found in diseased (Mango Sudden Death Syndrome i.e., MSDS) in early stages while Xyleborus sp. appeared in later stages but comparatively less in number (Masood et al., 2008).

MSDS is regarded as one of the most serious thre ts not only in Pakistan but all over the mango growing regions of the world and bark beetle species are suspected to be involved as putative vectors (Ribeiro, 1980; Adwai et al., 2006; Masood et al., 2008). The insect vector, Xyleborus sp. found in Ceratocystis canker of deciduous fruit trees caused by Ceratocysis fimbiriata which invades the xylem parenchyma and inner bark (phloem) as well (Webber and Gibbs, 1989). In "vascular wilts" like Dutch elm disease caused by Ophiostoma ulmi that was considered to be spread throughout Europe, Central Asia and North America and transported by various elm bark beetles of genus Scolytus (Lanier and Peacock, 1981; Brasier, 1987).

Being a potential threat for the dissemination of MSDS, several aspects of bark beetle biology, together with monitoring and management measurements have been investigated (Masood et al. , 2009; Saeed et al., 2010). On the contrary, not so many things have been done so far regarding the study of genetic diversity of mango bark beetles that could be supportive for molecular ecology studies and ultimately lead to the formation of even more efficient management strategies.

Nuclear microsatellites can be transferred between species something that provides insight comparison among closely related species for investigating the pattern of speciation, divergence and diversity at genetic and community levels interactions (Noor and Feder, 2006; Whitham et al., 2006). Therefore we tested a panel of microsatellites that were established in several scolytid species for cross amplification in H. mangiferae and Xyleborus affinis which were associated with diseased mango tree.

Materials and methods Study site

The survey was primarily conducted in Multan District of Punjab, Pakistan. Mango orchards situated in the four nearby areas within 20 kilometers from the main city were surveyed for bark beetle during 2008-09. This survey was also extended to Southern Punjab (Sahiwal, Faisalabad), Northern Punjab (Rahim Yar Khan and Bahawalpur) and Sindh Province including the main mango growing areas: Tandojam, Tando Muhammad and Hyderabad (Table I). Each location is separated at a distance of greater than 100 km from each others. We have collected at least 60 specimens of Hypocryphalus mangiferae and Xyleborus affinis from each location.

Microsatellite amplification and analysis

A total of 125 microsatellite markers primarily characterized for other Scolytidae species (Kerdelhue et al., 2003; Salle et al., 2003; Simon et al., 2003; Gauthier and Rasplus, 2004; Stoeckle et al., 2010) were examined for transfer into H. mangiferae and X. affinis. Individuals of the bark beetles (H. mangiferae and X. affinis) were collected from disease infested mango trees in different regions in Pakistan (Table I). We isolated genomic

Table I.-###Sampled Populations of mango bark beetles,

###Hypocryphalus mangiferae and Xyleborus affinis

Population of###Number of###GPS position

beetle###individuals###North###East

###(Latitude)###(Longitude)

Hypocryphalus mangiferae###

Multan###60###30.27###71.51

Shujabad###70###29.88###71.29

Sahiwal###50###30.65###73.12

R.Y. Khan###50###28.39###70.32

Faisalabad###60###31.41###73.05

Bahawalpur###60###29.40###71.66

Tandojam###60###25.43###68.54

Tando Muhammad###50###25.46###68.72

Hyderabad###50###25.37###68.35

Xyleborus affinis###

Multan###50###30.27###71.51

Tandojam###50###25.43###68.54

Hyderabad###50###25.37###68.35

Khanewal###50###30.20###71.59

DNA from 45 beetle bodies of H. mangiferae and 36 inidviduals of X. affinis according to Hogan et al. (1986), following the standard phenol-chloroform extraction. PCR was performed in a total volume of 15ul with the following components: 50- 60 ng of genomic DNA, 200 nM of each primer, 0.2 mM each dNTP (Solis BioDyne), 1.5 - 3.0 mM MgCl2 (Table I), 1x PCR buffer (Solis BioDyne), and 0.5 U Taq DNA Polymerase (Solis BioDyne). PCR was carried out on a Mastercycler Gradient thermal cycler (Eppendorf) under the following cycling conditions: initial denaturation at 94degC for 3 min; 35 cycles of 94degC for 30 s, 50-55degC (Table II) for 30 s, 72degC for 30s, and a final extension at 72degC for 3 min. PCR products (Cy5 labeled) were separated on 6% polyacrylamide gels on an ALFexpressII DNA Analyser and scored with ALLELELINKS 1.02 software. Electrophoresis was carried out on standard plate gels with external and internal standards for exact scoring.

GENEPOP4.0 software (Raymond and Rousset, 1995) was used to generate allele frequencies, to calculate expected and observed heterozygosities (He, Ho ) and to test the loci for linkage disequilibrium and Hardy-Weinberg equilibrium.

Table II.- Characteristics of 5 microsatellite loci transfered to Hypocryphalus mangiferae: locus designation, primer sequences (forward primers 5'Cy5-labelled), optimal annealing temperature (Ta) and MgCl2 concentration, number of observed alleles (NA), allele size range, level of observed (Ho) and expected (He) heterozygositiy per locus and number (bold) of populations deviated from Hardy-Weinberg equilibrium

Locus###Primer sequences (5'-3')###MgCl2###NA###Allele size###Ho###He###HW###

###Ta (degC)###(mM)###range (bp)###

ITY81###F: CATGCATAAAACAGTTCGTT###50###3###2###317-119###0.352###0.490###

###R: CGCACTAGCGCTTCTATTTA###

ITGT3432###F: ATCGTGGTGCCCGGATAAG*###50###3###8###191-205###0.696###0.678###

###R: AAGCCGGCGATGTCATACAG###

ITY843###F: GCGCTAAAGTTGGATTGTAA###50###3###5###274-282###0.440###0.704###1###

###R: TTGCTGTGTTGTAGCAATTC###

HHK.3.4.4###F: GATCCCGCGACTCGAGAC###50###3###2###181-187###0.028###0.441###

###R: GAGTTACAAGCGGCAGGC###

MS715###F: TCCTTTTAAGGACCACAACT###55###1.5###2###147-149###0.237###

Stoeckle and Kuehn (submitted); 2Salle et al. (2003); 3Stoeckle et al. (2010); 4Gauthier and Rasplus (2004) and 5Simon et al. (2003).

Results and Discussion

Out of the 125 loci tested on 45 individuals from 9 different H. mangiferae populations, five loci were found to be polymorphic with two to eight alleles, averaging 3.8 alleles per locus. Details regarding their sequences, their composition and their amplification conditions are given in Table II. Observed heterozygosity values (Ho) ranged from 0.028 to 0.696, those for expected heterozygosity (He) from 0.095 to 0.704. The test of linkage equilibrium revealed no significant values. Tests on Hardy-Weinberg equilibrium for each locus in each population revealed one deviation in population Multan (ITY84) and one in population Tandojam (MS71) (Table II).

In addition to that we investigated cross-species amplification in Xyleborus spp. using the same five microsatellites as transferred to

Hypocryphalus mangiferae. Three of the loci were monomorphic (MS71, ITY84 and ITY8). ITGT343 and HHK.3.4 showed three and two alleles, respectively. Observed heterozygosity values (Ho) ranged from 0.3824 (ITGT343) to 0.0882 (HHK.3.4), those for expected heterozygosity (He) from 0.5079 (ITGT343) to 0.2752 (HHK.3.4). Since only two of the microsatellites were polymorphic in

Xyleborus spp. We did not perform the test on linkage and Hardy Weinberg equilibrium.

The molecular genetic discrimination of different populations of a bark beetle would be very helpful to support the management strategy for the species. It allows the determination of genetic relatedness of populations and therefore the identification of migration routes. Consequently the increased combat against the bark beetle in the migration routes may help to contain the further spread of the pest species.

Acknowledgements

This financial assistance is highly appreciated from Higher Education Commission (HEC) of Pakistan as Indigenous scholarship batch -III. We also give special gratitude to Prof. Dr. Roland Gerstmeier (Technische Universitaet Muenchen, Lehrstuhl fuer Tieroekologie) for providing first time collaboration between Technische Universitaet Muenchen-Germany and Bahauddin Zakariya University- Pakistan. We also thank the laboratory staff (Unit of Molecular Zoology, Freising) for assistance in this work.

References

Al-Adawi, A.O., Deadman, M.L., Al Rawahi, A.K., Al Maqbali, Y.M., Al Jahwari, A.A., Al Saadi, B.A., Al Amri, I.S. and Wingfield, M.J., 2006. Eur. J. Plant Pathol., 116: 247 - 254.

Brasier, C. M., 1987. Recent genetic changes in the Ophiostoma ulmi population: the threat to the future of the elm. In:

Populations of plant pathogens: Their dynamics and genetics (eds. Wolfe, M. S. and C. E. Caten), Blackwell Publ. Oxford, pp. 213-226.

Beaver, R.A., 1967. Ent. Month. Mag., 102: 156-162.

Gauthier, N. and Rasplus, J.Y., 2004. Mol. Ecol. Notes, 4: 294 - 296.

Hogan, B.L.M., Costantini, F. and Lacy, E., 1986. A laboratory manual. Cold Spring Harbor Laboratory Press, Woodbury, NY, USA.pp. 21-23.

Kerdelhue, C., Mondor-Genson, G., Rasplus, J.Y., Robert, A. and Lieutier, F., 2003. Mol. Ecol. Notes, 3: 100-101.

Knizek, M. and Beaver, R., 2004. Bark and Wood Boring Insects in Living Trees in Europe, A Synthesis. In:

Taxonomy and sytematics of Bark and Ambrosia Beetles

(eds. F. Lieutier, K.R. Day, A.J. Battisti, C. Gregoire and H.F. Evans), Khuwer Academic Publisher, Netherland. pp. 41-54.

Masood, A., Saeed, S. and Sajjad, A., 2008. Pak. Entomol., 30:

Masood, A., Saeed, S., Sajjad, A. and Ali, M., 2009. Pakistan J. Zool., 14: 281-288.

Noor, M.A.F. and Feder, J.L., 2006. Nat. Rev. Gen., 7: 851-861.

Ploetz, R.C., 2003. Diseases of mango (ed. R.C. Ploetz). CABI Publisher. pp. 327-363.

Raymond, M. and Rousset, F., 1995. J. Hered., 86, 248-249.

Ribeiro, I.J.A., 1980. In: Anais do I Simposio Brasiliero Sobre a Cultura de Mangeura. Sociedad Brasileira de Fruticultura, Jacoticobal.p.123-130.

Saeed, S., Masood, A. and Sajjad, A., 2010. Pakistan J. Zool., 42: 273-279.

Salle, A., Kerdelhue, C., Breton, M. and Lieutier, F., 2003. Mol. Ecol. Notes, 3: 336-337.

Simon, U., Gruppe, A., Zeller, T., Kuehn, R., Liepold, K. and Simon, U., 2003. Landesanstalt fur Wald- und Forstwirtschaft, 33: 30-35.

Stoeckle, B.C., Dworschak, K., Gossner, M.M. and Kuehn, R., 2010. Ent. Exp. Appl. doi: 10.1111/j.1570-7458.2010.00977.x.

Whitham, T.G., Bailey, J.K. and Schweitzer, J.A., 2006. Nature Rev. Gene., 7: 510-523.

(Received 24 June 2010, revised 23 July 1University College of Agriculture, BahauddinZakariya University, Multan, PakistanUnit of Molecular Zoology, Department of AnimalScience, Technische Universitaet Muenchen, Hans-Carl-von-Carlowitz-Platz 2, 85354 Freising, Germany
COPYRIGHT 2011 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Publication:Pakistan Journal of Zoology
Article Type:Report
Geographic Code:9PAKI
Date:Apr 30, 2011
Words:1967
Previous Article:Phallectomy and Urethrostomy in a Paraphimosed Race Horse.
Next Article:Phylogenetics of Entomopathogenic Fungi Isolated Paecilomyces spp. (Ascomycota) From the Soils of Different Ecosystems.
Topics:

Terms of use | Privacy policy | Copyright © 2020 Farlex, Inc. | Feedback | For webmasters