Printer Friendly

Contaminacao ambiental e perfil toxigenico de Bacillus cereus isolados em servicos de alimentacao.

Environmental contamination and enterotoxigenic profile of Bacillus cereus isolated in food services

INTRODUCAO

Bacillus cereus e um microrganismo Gram positivo amplamente distribuido na natureza, sendo o solo seu reservatorio natural. A presenca da bacteria ou de seus esporos em alimentos e relativamente frequente. Devido a algumas propriedades dos esporos - como a sobrevivencia em diferentes temperaturas e valores de pH, resistencia a desidratacao e irradiacao e capacidade de adesao as superficies que contatam alimentos - a industria de alimentos encontra dificuldades para eliminar o microrganismo do ambiente industrial (ANDERSSON et al., 1995; KOTIRANTA et al., 2000). B. cereus e isolado a partir de produtos crus e processados, como arroz, condimentos, vegetais, preparacoes carneas e laticinios. Esse microrganismo esta associado a duas doencas transmitidas por alimentos, denominadas de "sindrome emetica" e "sindrome diarreica" (KRAMER & GILBERT, 1989).

A sindrome diarreica e caracterizada por dor abdominal, diarreia e nauseas que se estendem por 12 a 24h (GRANUM, 1994). Essa doenca esta associada a varias enterotoxinas, dentre elas, a enterotoxina hemolisina BL (HBL) e a enterotoxina nao-hemolitica (NHE). Essas enterotoxinas foram estudadas e caracterizadas por alguns pesquisadores (BEECHER & MACMILLAN, 1991; HEINRICHS et al., 1993; LUND & GRANUM, 1996; RYAN et al., 1997; GRANUM et al., 1999). O complexo HBL e formado por tres componentes denominados B, L1 e L2 (pesos moleculares de 35, 36 e 45kDa, respectivamente) (BEECHER & MACMILLAN, 1991) e requer os tres componentes para intensificar ao maximo as atividades hemolitica, citotoxica e dermonecrotica, alem da acao de permeabilidade vascular e de acumulo de fluido em alcas intestinais de coelho (BEECHER et al., 1995). O gene do componente B da HBL, denominado de hblA, foi sequenciado por HEINRICHS et al. (1993). Os genes responsaveis pelas fracoes [L.sub.1] e [L.sub.2], foram sequenciados por RYAN et al. (1997) e denominados respectivamente por hblD e hblC. O complexo NHE e composto por tres proteinas de peso molecular igual a 39, 45 e 105kDa e tambem requer todos os componentes para a sua maxima toxicidade em testes com celulas Vero (african green monkey kidney) e Caco-2 (human intestinal epithelial cells) (LUND & GRANUM, 1996). Os genes que codificam as tres proteinas que compoem a NHE foram sequenciados por GRANUM et al. (1999) e denominados nheA, nheB e nheC.

No presente estudo, avaliou-se a contaminacao ambiental por B. cereus em servicos de alimentacao atraves de analises microbiologicas. O perfil toxigenico dos isolados foi investigado utilizando-se as tecnicas de ELISA e da reacao da polimerase em cadeia (PCR), considerando-se os complexos HBL e NHE. A pesquisa foi realizada em dois restaurantes institucionais, atraves da analise de amostras do ar ambiente e de superficies de bancadas e equipamentos.

MATERIAL E METODOS

Amostras ambientais

As amostras ambientais foram coletadas em dois restaurantes institucionais: restaurante 1 (R1), que prepara cerca de 6 mil refeicoes diarias, e restaurante 2 (R2), onde sao preparadas cerca de 2 mil refeicoes diarias. A coleta das amostras foi realizada conforme metodologia descrita por EVANCHO et al. (2001).

Amostras de ar ambiente (500 l) foram aspiradas por 5 min para placas de Petri contendo meio seletivo para B. cereus - agar MYP (Mannitol yolk polymixin agar; Difco), suplementado com 0,1% de Sulfato de Polimixina B (Sigma). As coletas foram realizadas atraves do equipamento Microbiological Air Sampler (MAS 100; Merck).

A amostragem das superficies de bancadas e dos equipamentos foi realizada utilizando-se o "metodo de contato com esponja", atraves de esponjas previamente umedecidas com solucao de tampao fosfato (Butterfield's phosphate-buffered dilution water, pH 7,2) suplementado com polisorbato e tiossulfato de sodio a 0,5%. A area amostrada por bancada foi de 60x70cm e o resultado expresso em cm[.sup.2]. Quanto aos equipamentos, as amostras foram coletadas das areas que tem contato com os alimentos, sendo o resultado expresso como ausencia ou presenca de B. cereus. Apos a amostragem, as esponjas foram "massageadas" por 15s com diluente (solucao tampao fosfato, pH 7,2). Em seguida, foram realizadas inoculacoes (0,1ml) de cada uma das amostras, em placas contendo meio seletivo para B. cereus (agar MYP).

Isolamento, confirmacao e identificacao de Bacillus cereus

A contagem, o isolamento, a confirmacao e a identificacao de B. cereus foram realizadas conforme metodologia recomendada por RHODEHAMEL & HARMON (1998). Uma cepa padrao (B. cereus ATCC 11145) foi utilizada como controle. Apos as analises para a confirmacao, foram realizados testes para a diferenciacao de outros membros do grupo do B. cereus (Bacillus anthracis, Bacillus thuringiensis e Bacillus mycoides).

As placas contendo agar MYP, inoculadas com amostras ambientais, foram incubadas a 30[grados]C/24h. Posteriormente, de cada placa contendo colonias tipicas do microrganismo (colonias nao fermentadoras de manitol e produtoras de lecitinase), foram isoladas entre tres e cinco colonias tipicas. Esses isolados suspeitos para B. cereus foram mantidos em agar nutriente (Nutrient agar; Merck) a 4[grados]C. Em seguida, eles foram confirmados e identificados atraves da coloracao de Gram, da reacao da catalase, da mentacao anaerobia da glicose, da reducao de nitrato, do teste VP (Voges-Proskauer) modificado, da decomposicao da tirosina, da resistencia a lisozima, do teste de motilidade, do crescimento rizoide e da atividade hemolitica. A deteccao de cristais de toxinas para a diferenciacao da especie B. thuringiensis foi realizada segundo metodologia descrita por SHARIF & ALAEDDINOGLU (1988).

Avaliacao da producao de enterotoxinas atraves de ELISA e PCR

Culturas

Setenta isolados, provenientes de amostras de ar e de superficies, com perfil classico de B. cereus nos testes bioquimicos de confirmacao e de identificacao da especie, foram cultivados em caldo BHI (Brain heart infusion broth; Difco), suplementado com 0,1% de glicose, e incubados a 30[grados]C/18h para a avaliacao da producao de enterotoxinas. Uma cepa padrao (B. cereus ATCC 14579) foi utilizada como controle.

ELISA e PCR

A producao da enteroxina nao-hemolitica foi avaliada atraves de ELISA, utilizando-se o Bacillus Diarrhoeal Enterotoxin Visual Immunoassay (kit BDE, vs MS2207 05/01; Tecra, Roseville New South Wales, Australia). Este ensaio detecta a proteina de 45kDa da NHE, codificada pelo gene nheA, e foi realizado conforme as instrucoes do fabricante.

A presenca de genes que codificam os complexos HBL e NHE foi verificada atraves da tecnica da PCR. Os iniciadores (primers) utilizados para a amplificacao dos genes associados a producao das enterotoxinas estao listados na tabela 1. A extracao e as condicoes de amplificacao do DNA foram realizadas conforme metodologia adotada por HANSEN & HENDRIKSEN (2001). Para a extracao, uma alcada da massa bacteriana crescida em meio solido foi transferida para um tubo Eppendorf, onde foram adicionados 200[micron]l de agua Milli-Q esterilizada. As celulas bacterianas foram lisadas atraves da incubacao a 102[grados]C por 10min e os fragmentos foram removidos por centrifugacao a 13.000 x g por 3min. O sobrenadante com o DNA bacteriano foi estocado a 4[grados]C. A amplificacao do DNA foi realizada em Termociclador Mastercycler[R] gradient (Eppendorf), utilizando-se 30 ciclos de desnaturacao a 94[grados]C por 15s, anelamento a 55[grados]C por 45s e extensao a 72[grados]C por 2min. Para cada reacao de amplificacao, foi preparado um volume total de reacao de 30[micron]l, contendo 1[micron]l da enzima Taq DNA polimerase (1U [micron][l.sup.-1]); 3[micron]l de tampao 10x (200mM Tris-HCl -- pH 8,0; 500mM de KCl); 1[micron]l de Mg[Cl.sub.2]; 0,24[micron]l de dNTPs 25mM; 1[micron]l de cada um dos primers; 7[micron]l do DNA extraido e agua Milli-Q esterilizada (qsp 30[micron]l). Os produtos da PCR foram visualizados em gel de agarose a 2%, atraves do sistema de eletroforese horizontal submersa (SAMBROOK et al., 1989). A identificacao dos produtos amplificados foi efetuada com o auxilio de um marcador de peso molecular (100pb ladder, Biotools), utilizado em todos os geis de agarose analisados.

RESULTADOS E DISCUSSAO

Trezentas e trinta e uma colonias suspeitas, isoladas de amostras de ar ambiente e de superficies, foram submetidas aos testes microbiologicos e bioquimicos de confirmacao e identificacao. Deste total, 76,1% foram identificados como B. cereus. Outras duas especies do grupo do B. cereus tambem foram identificadas: B. mycoides (4,5%) e B. thuringiensis (3,6%). Tal como B. cereus, essas especies foram identificadas em amostras de ar ambiente e de superficies.

Os resultados obtidos atraves das analises microbiologicas revelaram a presenca de B. cereus no ar ambiente de 84,4% do total das amostras coletadas em ambos os restaurantes (Tabelas 2 e 3). No R1, as contagens de B. cereus variaram entre 2,0 e 38,4UFC [m.sup.-3] de ar (Tabela 2). Nesse estabelecimento, as areas onde foram observados os maiores pontos de contaminacao foram as areas de coccao (38,4UFC [m.sup.-3]), distribuicao (28,0UFC [m.sup.-3]) e self-service (27,6UFC [m.sup.-3]). No R2, as contagens de B. cereus em amostras de ar ambiente variaram entre 2,0 e 20,0UFC [m.sup.-3] de ar (Tabela 3), sendo observado o maior valor na area recepcao de generos (20,0UFC [m.sup.-3]).

Do total de amostras de superficies de bancadas e de equipamentos analisadas, 44,8% foram positivas para a presenca do microrganismo (Tabelas 2 e 3), conforme resultados obtidos nas analises microbiologicas. As maiores contaminacoes foram observadas nas bancadas do R1 (area de alimentos processados - carnes preparadas) com contagens compreendidas entre 0,07 e 2,20UFC [cm.sup.-2] (Tabela 2).

Na analise dos resultados obtidos utilizando-se a PCR (Tabela 4 e Figura 1), foi observado que, dos 70 isolados de B. cereus investigados, 14,3% foram positivos para os tres genes que codificam a hemolisina BL (hblA, hblD e hblC); 55,7% apresentaram um ou dois desses genes e nenhum dos tres genes foi detectado em 25,7% dos isolados. Os tres genes que codificam o complexo NHE (nheA, nheB e nheC) foram detectados em 12,8% dos isolados. Um ou dois desses genes foram detectados em 60,0% dos isolados e nenhum dos tres genes foi observado em 22,8% dos isolados. Os tres genes da HBL e os tres genes da NHE foram detectados em tres isolados (4,3%), provenientes de amostras de ar ambiente coletada em area de alimentos nao-processados (almoxarifado), de amostras de superficies de bancada da area de pre-vegetais e de fatiador.

Entre os 70 isolados de B. cereus foram identificados 35 perfis toxigenicos distintos. Os 43 isolados provenientes do R1 foram agrupados em 24 perfis, enquanto os 27 isolados do R2 foram agrupados em 22 perfis. Estudos recentes (HANSEN & HENDRIKSEN, 2001; GHELARDI et al., 2002; PHELPS & MCKILIP, 2002), em que foram utilizados metodos baseados na PCR, atestam a heterogeneidade em B. cereus quanto a presenca de fatores de virulencia.

[FIGURA 1 OMITIR]

O teste com o kit BDE (Tecra), que detecta a proteina codificada pelo gene nheA do complexo NHE (Lund; Granum, 1996), revelou que 61,4% dos 70 isolados de B. cereus testados produzem essa toxina. Estes resultados confirmam a eficiencia do teste, ja relatada por outros pesquisadores (LUND & GRANUM, 1996; LUND & GRANUM, 1997; HANSEN & HENDRIKSEN, 2001). Entretanto, entre os 70 isolados, oito apresentaram resultados positivos para o teste ELISA, mesmo sendo negativos para a presenca do gene nheA utilizando-se a PCR. Cabe ressaltar que o kit, alem de detectar proteina de 45kDa, tambem pode identificar o componente proteico de 105kDa do complexo NHE, embora com sensibilidade 10 vezes menor (GRANUM, 1997). De fato, o gene nheC, que codifica esse componente, foi detectado em cinco dos oito isolados que apresentaram resultados positivos no imunoensaio. As propriedades do teste BDE e os possiveis diferencas nas sequencias dos genes codificadores das enterotoxinas devem ser consideradas na analise comparativa entre os resultados obtidos com a aplicacao do kit e com a pesquisa de genes do complexo NHE pela PCR, como observaram HANSEN & HENDRIKSEN (2001).

A presenca de B. cereus potencialmente produtores de enterotoxinas em amostras ambientais coletadas nos servicos de alimentacao, observada atraves da analise dos resultados obtidos com a PCR e o teste ELISA, indica a importancia do risco de contaminacao de alimentos a partir dessas fontes. A identificacao dos principais locais como origens potenciais do microrganismo ou de seus esporos deve ser considerada para evitar ou reduzir a contaminacao dos alimentos na linha de processamento, como relatam alguns pesquisadores (GUINEBRETIERE & NGUYENTHE, 2003). Neste trabalho, ficou evidente a importancia do ar ambiente como fonte de B. cereus em estabelecimentos processadores de alimentos.

CONCLUSAO

Devido a frequencia com que determinadas situacoes sao observadas em servicos de alimentacao, tais como a exposicao do alimento ao ar ambiente por tempo prolongado, condicoes de higiene de bancadas e de equipamentos inadequadas e exposicao dos alimentos a temperaturas abusivas, torna-se relevante insistir na necessidade de aprimorar os procedimentos de higienizacao ambiental, uma vez que seu papel como fonte potencial de patogenos alimentares como B. cereus, tem sido evidenciado de forma indubitavel.

AGRADECIMENTOS

A Fundacao de Amparo a Pesquisa do Estado de Sao Paulo (FAPESP), pelo apoio financeiro. Ao Prof. Dr. Tomomasa Yano do Instituto de Biologia, UNICAMP, pelo auxilio nas analises da PCR.

Recebido para publicacao 01.12.06 Aprovado em 23.05.07

REFERENCIAS

ANDERSSON, A. et al. What problems does the food industry have the spore-forming pathogens Bacillus cereus and Clostridium perfrigens? International Journal of Food Microbiology, v.28, n.2, p.145-155, 1995.

BEECHER, D.J.; MACMILLAN, J.D. Characterization of the components of hemolysin BL from Bacillus cereus. Infection and Immunity, v.59,n.5, p.1778-1784, 1991.

BEECHER, D.J. et al. Enterotoxic activity of hemolysin BL from Bacillus cereus. Infection and Immunity, v.63, n.11, p.4423-4428, 1995.

EVANCHO et al. Microbiological monitoring of the food processing environment. In: DOWNES, F.P.; ITO, K. Compendium of methods for the microbiological examination of foods. 4.ed. Washington, DC: American Public Health Association, 2001. cap.3, p.25-35.

GHELARDI, E. et al. Identification and characterization of toxigenic B. cereus isolates responsible for two food-poisoning outbreaks. FEMS Microbiology Letters, v.208, n.1, p.129-134, 2002.

GRANUM, P.E. Bacillus cereus and its toxins. Journal of Applied Bacteriology, Symposium Supplement, n.76, p.61S-66S, 1994

GRANUM, P.E. Bacillus cereus. In: DOYLE, M.P. et al. Food microbiology: fundamentals and frontiers. Washington, DC: ASM, 1997. p.327-336.

GRANUM, P.E. et al. The sequence of the non-haemolytic enterotoxin operon from Bacillus cereus. FEMS Microbiology Letters, v.177, n.2, p.225-229, 1999.

GUINEBRETIERE, M.H.; NGUYEN-THE, C. Sources of Bacillus cereus contamination in a pasteurised zucchini puree processing line, differentiated by two PCR-based methods. FEMS Microbiology Ecology, v.43, n.2, p.207-215, 2003.

HANSEN, B.M.; HENDRIKSEN, N.B. Detection of enterotoxin Bacillu cereus and Bacillus thuringiensis strains by PCR analysis. Applied and Environmental Microbiology, v.67, n.1, p.185-189, 2001.

HEINRICHS, A.H. et al. Molecular cloning and characterization of the hblA gene encoding the B component of hemolysin BL from Bacillus cereus. Journal Bacteriology, v.175, p.6760-6766, 1993.

KOTIRANTA, A. et al. Epidemiology and pathogenesis of Bacillus cereus infections. Microbes and Infection, v.2, n.2, p.189-198, 2000.

KRAMER, J.M.; GILBERT, R.J. Bacillus cereus and other Bacillus species. In: DOYLE, M.P. Food borne bacteria pathogens. New York: Marcel Dekker, 1989. p.21-69.

LUND, T.; GRANUM, P.E. Characterisation of a nonhaemolytic enterotoxin complex from Bacillus cereus isolated after a food borne outbreak. FEMS Microbiology Letters, v.141, n.2-3, p.151-156, 1996.

LUND, T.; GRANUM, P.E. Comparison of biological effect of the two different enterotoxin complexes isolated from three different strains of Bacillus cereus. Microbiology (Reading, England), v.143, pt.10, p.3329-3336, 1997.

PHELPS, R.J.; MCKILLIP, J.L. Enterotoxin production in natural isolates of Bacillaceae outside the Bacillus cereus group. Applied and Environmental Microbiology, v.68, n.6, p.3147-3151, 2002.

RHODEHAMEL, E.J.; HARMON, S.M. Bacillus cereus. In: FOOD AND DRUG ADMINISTRATION. Bacteriological analytical manual. 8.ed. Arlington: Association of Official Analytical Chemists International, 1998. cap.14, p.14.01-14.08.

RYAN, P.A. et al. Molecular cloning and characterization of the genes encoding the L1 and L2 components of hemolysin BL from Bacillus cereus. Journal Bacteriology, v.179, n.8, p.2551-2556, 1997.

SAMBROOK, J. et al. Molecular clonning: a laboratory manual. 2.ed. New York: Cold Spring Harbor Laboratory, 1989. 120p.

SHARIF, F.A.; ALAEDDINOGLU, G.A. Rapid and simple method for staining of the crystal protein of Bacillus thuringiensis. Journal of Industrial Microbiology, v.3, p.227-229, 1988.

Celina Mara Soares (I) * Georgio Freesz Valadares (II) Raquel Monteiro Cordeiro de Azeredo (III) Arnaldo Yoshiteru Kuaye (IV)

(I) Programa de Pos-graduacao, Faculdade de Engenharia de Alimentos (FEA), Universidade Estadual de Campinas (UNICAMP). Campinas, SP, Brasil. E-mail: celinamsoares@yahoo.com.br. * Autor para correspondencia.

(II) Programa de Pos-graduacao, Instituto de Biologia, UNICAMP. Campinas. SP. Brasil.

(III) Departamento de Nutricao e Saude, Universidade Federal de Vicosa (UFV). Vicosa, MG, Brasil.

(IV) Departamento de Tecnologia de Alimentos (DTA), FEA, UNICAMP. Campinas, SP, Brasil.
Tabela 1 - Genes e primers utilizados na PCR para a caracterizacao
enterotoxigenica de isolados de Bacillus cereus provenientes de
amostras ambientais.

Gene     primer            Sequencia (5'-3')

hblA     HBLA1           GTGCAGATGTTGATGCCGAT
         HBLA2           ATGCCACTGCGTGGACATAT
hblD     L1A             AATCAAGAGCTGTCACGAAT
         L1B             CACCAATTGACCATGCTAAT
hblC     L2A             AATGGTCATCGGAACTCTAT
         L2B             CTCGCTGTTCTGCTGTTAAT
nheA     nheA 344 S      TACGCTAAGGAGGGGCA
         nheA 843 A      GTTTTTATTGCTTCATCGGCT
nheB     nheB 1500 S     CTATCAGCACTTATGGCAG
         nheB 2269 A     ACTCCTAGCGGTGTTCC
nheC     nheC 2820 S     CGGTAGTGATTGCTGGG
         nheC 3401 A     CAGCATTCGTACTTGCCAA

primer              Posicao do primer

HBLA1            671-690 [flecha diestra]
HBLA2            990-971 [flecha siniestra]
L1A             2854-2873 [flecha diestra]
L1B             3283-3264 [flecha siniestra]
L2A             1448-1467 [flecha diestra]
L2B             2197-2178 [flecha siniestra]
nheA 344 S       344-360 [flecha diestra]
nheA 843 A       843-823 [flecha siniestra]
nheB 1500 S     1500-1518 [flecha diestra]
nheB 2269 A     2269-2253 [flecha siniestra]
nheC 2820 S     2820-2836 [flecha diestra]
nheC 3401 A     3401-3383[flecha siniestra]

primer                  Referencia

HBLA1           HEINRICHS et al. (1993); HANSEN &
HBLA2           HENDRIKSEN (2001)
L1A             RYAN et al. (1997); HANSEN
L1B             & HENDRIKSEN (2001)
L2A             RYAN et al. (1997); HANSEN
L2B             & HENDRIKSEN (2001)
nheA 344 S      GRANUM et al. (1999); GHELARDI et
nheA 843 A      al. (2002)
nheB 1500 S     GRANUM et al. (1999); GHELARDI et
nheB 2269 A     al. (2002)
nheC 2820 S     GRANUM et al. (1999); GHELARDI et
nheC 3401 A     al. (2002)

Tabela 2 - Bacillus cereus em amostras ambientais do restaurante
institucional 1, segundo o tipo de amostra e local de coleta.

                                                   Numero de amostras
                                                       analisadas
Tipo de amostra e local de coleta                    (no positivas)

Ar ambiente

Areas de alimentos nao-processados:
pre-preparo de vegetais; pre-preparo                     15 (12)
de carnes; antecamara; recepgao de
generos; almoxarifado.

Areas de alimentos processados:                           6 (6)
carnes preparadas; cocgao.

Areas de alimentos prontos para o
consumo: distribuicao; self-service;                     12 (12)
distribuicao de marmitas;
monta-cargas.

Outros locais: manipulacao de                             3 (2)
talheres.

Superficies de bancadas

Areas de alimentos nao-processados:
pre preparo de vegetais; pre-preparo                     12 (6)
de carnes.

Areas de alimentos processados:                          12 (6)
carnes preparadas; cocgao.

Superficies de equipamentos

Que contatam alimentos nao-processados:
multiprocessador; triturador;                             9 (7)
descascador de legumes; cortador de
legumes.

Que contatam alimentos processados:                       9 (6)
fatiadores.

Tipo de amostra e local de coleta                    Contagem (UFC) *

Ar ambiente

Areas de alimentos nao-processados:
pre-preparo de vegetais; pre-preparo                2,0-16,0/[m.sup.3]
de carnes; antecamara; recepgao de
generos; almoxarifado.

Areas de alimentos processados:                     2,0-38,4/[m.sup.3]
carnes preparadas; cocgao.

Areas de alimentos prontos para o
consumo: distribuicao; self-service;                2,0-28,0/[m.sup.3]
distribuicao de marmitas;
monta-cargas.

Outros locais: manipulacao de                       8,0-24,0/[m.sup.3]
talheres.

Superficies de bancadas

Areas de alimentos nao-processados:
pre preparo de vegetais; pre-preparo                0,07-0,72/
de carnes.                                          [cm.sup.2]

Areas de alimentos processados:                     0,07-2,20/
carnes preparadas; cocgao.                          [cm.sup.2]

Superficies de equipamentos

Que contatam alimentos nao-processados:
multiprocessador; triturador;                       NR
descascador de legumes; cortador de
legumes.

Que contatam alimentos processados:                 NR
fatiadores.

* Unidade Formadora de Colonia.

NR: nao realizada.

Tabela 3 - Bacillus cereus em amostras ambientais do restaurante
institucional 2, segundo o tipo de amostra e local de coleta.

                                                     Numero de amostras
                                                         analisadas
Tipo de de coleta amostra e local                      (no positivas)

Ar ambiente

Areas de alimentos nao-processados:
pre-preparo de vegetais; pre-preparo de                    33 (25)
carnes; antecamara; camara de resfriamento
de carnes; selegao de cereais; preparo
de sobremesas; preparo de massas; preparo
de sucos; preparo de dietas especiais;
recepcao de generos.

Areas de alimentos processados: coccao;                     6 (6)
dietetica.

Areas de alimentos prontos para o consumo:
distribuicao; self-service; distribuicao                   12 (10)
de refeicoes especiais; carros de
distribuicao de refeicoes.

Outros locais: area de entrada de                           3 (3)
funcionarios.

Superficies de bancadas

Areas de alimentos nao-processados:
pre-preparo de vegetais; pre-preparo de                    24 (8)
carnes

Areas de alimentos processados: carnes                      9 (0)
preparadas; coccao.

Superficies de equipamentos

Que contatam alimentos nao-processados:
multiprocessador; descascador de legumes;                  15 (6)
cortador de legumes.

Que contatam alimentos processados:                         6 (4)
fatiadores.

                                                          Contagem
Tipo de de coleta amostra e local                          (UFC) *

Ar ambiente

Areas de alimentos nao-processados:
pre-preparo de vegetais; pre-preparo de              2,0-20,0/[m.sup.3]
carnes; antecamara; camara de resfriamento
de carnes; selegao de cereais; preparo
de sobremesas; preparo de massas; preparo
de sucos; preparo de dietas especiais;
recepcao de generos.

Areas de alimentos processados: coccao;              2,0-6 ,0/[m.sup.3]
dietetica.

Areas de alimentos prontos para o consumo:
distribuicao; self-service; distribuicao             2,0-8,0/[m.sup.3]
de refeicoes especiais; carros de
distribuicao de refeicoes.

Outros locais: area de entrada de                    5,4-8,0/[m.sup.3]
funcionarios.

Superficies de bancadas

Areas de alimentos nao-processados:
pre-preparo de vegetais; pre-preparo de              0,07-0,56/
carnes                                               [cm.sup.2]

Areas de alimentos processados: carnes               < 0,0024/
preparadas; coccao.                                  [cm.sup.2]

Superficies de equipamentos

Que contatam alimentos nao-processados:
multiprocessador; descascador de legumes;            NR
cortador de legumes.

Que contatam alimentos processados:                  NR
fatiadores.

* Unidade Formadora de Colonia.

NR: nao realizada.

Tabela 4 - Perfil toxigenico de Bacillus cereus isolados de amostras
ambientais coletadas nos restaurantes institucionais 1 e 2.

                              Numero de isolados (no de
Perfil     Origem (a)       positivos ao teste ELISA (b))

I          SB, SE, A,                   3 (3)
II         SB, A                        2 (2)
III        SE, SB                       3 (3)
IV         A                            3 (2)
V          A                            1 (1)
VI         A                            3 (2)
VII        A                            2 (1)
VIII       A, SE                        2 (1)
IX         A                            4 (0)
X          SE                           1 (1)
XI         SB                           1 (0)
XII        SE                           1 (1)
XIII       SE                           2 (0)
XIV        A, SB, SE                    5 (1)
XV         A                            3 (3)
XVI        A                            1 (0)
XVII       A                            1 (1)
XVIII      A                            1 (1)
XIX        A                            3 (2)
XX         A                            6 (5)
XXI        SB                           2 (2)
XXII       SE                           2 (0)
XXIII      A, SB                        3 (0)
XXIV       A, SB                        3 (3)
XXV        A                            1 (0)
XXVI       SE                           1 (1)
XXVII      A                            2 (2)
XXVIII     A                            1 (1)
XXIX       A                            1 (1)
XXX        A                            1 (1)
XXXI       A                            1 (0)
XXXII      SE                           1 (1)
XXXIII     SE                           1 (0)
XXXIV      SB                           1 (0)
XXXV       SB                           1 (1)

                  HBL (c)               NHE (c)

Perfil     hblA    hblD   hblC    nheA   nheB    nheC

I            +      +       +      +       +       +
II           +      +       +      +       -       +
III          +      +       +      +       -       -
IV           +      +       +      +       +       -
V            +      +       -      +       +       +
VI           +      +       -      +       -       -
VII          +      +       -      -       +       -
VIII         +      +       -      +       +       -
IX           +      +       -      -       -       -
X            -      +       +      -       +       +
XI           -      +       +      -       -       -
XII          +      -       +      -       +       +
XIII         +      -       +      -       -       -
XIV          -      +       -      -       -       -
XV           -      +       +      +       +       +
XVI          -      +       -      +       -       -
XVII         -      +       -      +       +       +
XVIII        -      -       +      +       +       +
XIX          -      -       +      +       +       -
XX           -      -       -      +       +       -
XXI          -      -       -      +       +       +
XXII         -      -       -      -       +       +
XXIII        -      -       -      -       -       -
XXIV         -      -       -      +       -       +
XXV          +      +       +      -       -       -
XXVI         +      +       +      -       -       +
XXVII        +      +       -      -       +       +
XXVIII       -      +       -      +       +       -
XXIX         -      +       +      +       -       +
XXX          -      +       +      -       +       -
XXXI         -      -       -      +       -       -
XXXII        +      -       +      +       +       +
XXXIII       -      -       -      -       +       -
XXXIV        -      +       +      -       -       +
XXXV         -      +       +      +       -       -

(a) SB: superficie de bancada; SE: superficie de equipamento; A: ar
ambiente

(b) kit BDE (Tecra). Os resultados foram obtidos de acordo com as
instrucoes do fabricante.

(c) +: foi observado produto da PCR com peso esperado;
-: nao foi observado produto do PCR com peso esperado.
COPYRIGHT 2008 Universidade Federal de Santa Maria
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2008 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Soares, Celina Mara; Freesz Valadares, Georgio; Cordeiro de Azeredo, Raquel Monteiro; Yoshiteru Kuay
Publication:Ciencia Rural
Date:Mar 1, 2008
Words:4203
Previous Article:Caracterizacao sensorial e analise bacteriologica do peixe-sapo (Lophius gastrophysus) refrigerado e irradiado.
Next Article:Comportamento de compra dos consumidores de frutas, legumes e verduras na regiao central do Rio Grande do Sul.
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters |