Printer Friendly

Construccion de mutantes de Salmonella enterica por inactivacion de los genes invG/invE y ssaJ/ssaK de las islas de patogenicidad 1 y 2.

Constructing Salmonella enterica mutants for inactivating invG/invE y ssaJ/ssaK genes from pathogenicity islands 1 and 2

Introduccion

Diversos factores de virulencia de Salmonella estan codificados por genes que se encuentran agrupados en las islas de patogenicidad SPI (del ingles: Salmonella Pathogenicity Islands). En la actualidad se han descrito 17 SPI diferentes, de las cuales se han caracterizado 14. Sin embargo, las SPI1 y SPI2 son las que codifican los determinantes que median la invasion y la supervivencia intracelular (Darwin y Miller, 1999; Hensel, 2004; Vernikos y Parkhill, 2006; Morgan, 2007).

Para la comprension de las bases geneticas de los mecanismos de patogenicidad de Salmonella se han descrito diversas metodologias para manipular el ADN genomico y generar mutantes con caracteristicas particulares. Estos metodos comprenden varios procesos de recombinacion, uso de enzimas de restriccion y vectores suicidas (Collazo et al., 1995; Boyd et al., 1997; Beuzon et al., 2000). No obstante, el sistema de recombinasa Red del Bacteriofago [lambda], propuesto por Datsenko y Wanner (2000), es un metodo simple y altamente eficiente para inducir mutaciones o inactivar genes en el genoma de E. coli y en otras bacterias Gram-negativas, a traves de recombinaciones homologas utilizando productos de PCR. Este sistema tiene la ventaja de utilizar pequenas regiones homologas (< 50 pb), lo que permite generar mutaciones en cualquier zona del genoma bacteriano (figura 1). Ademas, comparado con las tecnicas clasicas de ingenieria genetica no utiliza enzimas de restriccion ni ADN ligasas (Santoyo, 2008).

En este trabajo se reporta la construccion de mutantes a partir de varios serotipos de S. enterica, por sustitucion e inactivacion de los genes invG/invE en SPI-1 y de los genes ssaJ/ssaK en SPI-2 mediante la tecnica de recombinasa Red del fago [lambda] (figura 2). Los genes delecionados en las SPI-1 y SPI-2 codifican proteinas que participan en la formacion de los sistemas de secrecion tipo III (SSTIII), responsables de la invasion y sobrevivencia intracelular de S. enterica en las celulas hospedadoras. Los resultados de este trabajo permitiran estudios futuros in vivo para evaluar la posible atenuacion de la virulencia de las cepas mutantes, asi como aportar nuevos conocimientos sobre los mecanismos geneticos involucrados en la fisiopatogenia de las enfermedades producidas por estas bacterias.

Materiales y metodos

Cepas bacterianas, plasmidos y condiciones de cultivo

Las cepas bacterianas y plasmidos utilizados en este estudio se muestran en la tabla 1. Todas las cepas fueron cultivadas en caldo y agar Luria Bertani (LB). En algunos casos los medios de cultivo fueron suplementados con 30 [micron]g/ml de kanamicina (Km) o 100 [micron]g/ml de ampicilina (Amp) segun corresponda al mutante ensayado. Los cultivos fueron incubados durante toda la noche a 37[grados]C en bano de agua con agitacion.

[FIGURA 1 OMITIR]

Construccion de mutantes de Salmonella enterica por delecion de los genes invG/invE y ssaJ/ssaK en las SPI-1 y SPI-2, respectivamente

Los mutantes de S. enterica en invG/invE y ssaJ/ssaK fueron construidos utilizando el sistema Red del fago k, de acuerdo con lo descrito por Datsenko y Wanner (2000). Los iniciadores utilizados para inducir la mutagenesis de los genes invG/invE (SPI-1) y ssaJ/ ssaK (SPI-2) y amplificar el gen de resistencia a la kanamicina del plasmido pKD4, se muestran en la tabla 2; estos se disenaron con secuencias homologas (36 nucleotidos) a la region del cromosoma adyacente a los genes objeto de delecion [H1 (invF) y H2 (invA) de SPI1 y H1 (ssal) y H2 (ssaL) de SPI2], de las SPI1 y SPI2 (numero de acceso GenBank para SPI1 U08280 y para SPI2 ssaL Y09357, ssaI AJ224892) mas la secuencia correspondiente a P1 y P2 del plasmido PKD4 (20 nucleotidos). Las mezclas para la amplificacion se prepararon a un volumen final de 25 fil, conteniendo 1 ng de ADN (pKD4), 1,5 U de Taq polimerasa (Biotools[R]), 0,2 mM de cada dNTP (Invitrogen[R]), 4 mM de MgCl2 (Biotools[R]), 1 fiM de cada oligonucleotido y 1X de buffer (Biotools[R]). Las condiciones de amplificacion fueron: inicialmente 3 min a 96[grados]C y luego 30 ciclos: 1,30 min a 94[grados]C, 2 min 60[grados]C y 3 min a 72 [grados]C, con un paso de extension final de 10 min a 72[grados]C. Los productos amplificados fueron purificados (Wizard[R] SV Gel and Clean-Up System, Promega[R]), digeridos con DpnI (New England Biolabs[R]), nuevamente purificados y resuspendidos en agua libre de DNAsa. Estos productos fueron observados en corridas electroforeticas en geles de agarosa 0,8% (Promega[R]), tenidos con bromuro de etidio (Sigma[R]), visualizados bajo LUV y fotografiados. Como marcador de peso molecular se utilizo el fago [FI] digerido con HindIII (Promega[R]).

Electrotransformacion de cepas de S. enterica

Las cepas de S. enterica fueron preparadas para los ensayos de transformacion de acuerdo con lo descrito por Vega y Ayala (2006) y transformadas por electroporacion con el plasmido pKD46. Las celulas fueron pulsadas con 2500 kV y 5 ms e incubadas en medio SOC durante 1 a 2 horas a 30[grados]C. Las celulas transformadas fueron seleccionadas en agar LB suplementado con Amp e incubadas a 30[grados]C. Posteriormente, estas cepas que portaban el plasmido pKD46 se cultivaron en caldo 2YT a 30[grados]C suplementado con Amp y L-arabinosa (1mM) hasta una [DO.sub.600nm] de 0,6. Estas celulas fueron preparadas para una transformacion adicional con el producto de PCR repurificado inicialmente, bajo las mismas condiciones anteriormente senaladas. Las nuevas celulas transformadas fueron seleccionadas en agar LB con Km e incubadas a 37[grados]C. Una vez obtenidas las celulas mutantes, el plasmido pKD46 se elimino mediante cultivo en agar LB sin Amp a 43[grados]C.

Comprobacion de la obtencion de cepas de S. enterica mutantes

La mutagenesis fue confirmada por PCR utilizando el ADN cromosomico de las celulas transformadas y los iniciadores que flanquean la secuencia invG/invE y ssaJ/ssaK (tabla 3).

Eliminacion del gen [Km.sup.R] de las cepas [DELTA]invGE::Km y [DELTA]ssaJK::Km S. enterica

Una vez verificada la obtencion de mutantes de S. enterica, estas celulas fueron sometidas a una nueva transformacion con el plasmido pCP20, bajo las condiciones senaladas. Las celulas transformadas fueron seleccionadas en agar LB con Amp a 30[grados]C. Luego, varias colonias fueron aisladas y subcultivadas sucesivamente en medio no selectivo a 43[grados]C, de manera de favorecer la perdida del plasmido. Finalmente, por ensayos de PCR se comprobo que el gen de resistencia [Km.sup.R] del pKD4 habia sido eliminado y los genes originales estaban delecionados en las cepas mutadas. En estas pruebas se utilizo el ADN cromosomico de las celulas transformantes y los iniciadores descritos en la tabla 3, con las mismas caracteristicas de la mezcla de amplificacion antes mencionada. El programa aplicado fue el siguiente: 2 min a 93[grados]C y 25 ciclos: 1 min a 93[grados]C, 1 min a 60[grados]C y 1 min a 72[grados]C, con un paso de extension final de 10 min a 72[grados]C.

[FIGURA 1 OMITIR]

Resultados

Obtencion de cepas de S. enterica mutantes (genes delecionados invG/ invE y ssaJ/ssaK en las SPI-1 y SPI-2, respectivamente)

Como paso preliminar para la realizacion de la mutagenesis, los 12 serotipos de S. enterica de origen clinico y la cepa de referencia (S. Typhimurium SL-1344) fueron inicialmente transformadas con el plasmido pKD46, que porta la recombinasa Red del bacteriofago [lambda]. Posteriormente, todas las cepas fueron sometidas a otro proceso de transformacion, con los productos amplificados con los iniciadores disenados para la mutagenesis: SPI1/invF-H1P1 y SPI1/invA-H2P2, SPI2/ssaI-H1P1 y SPI2/ ssaL-H2P2, los cuales amplifican el gen de resistencia a la Km del pKD4 y reconocen las secuencias externas flanqueantes de la region genica, invF - invA y ssaH/ssaI - ssaL, de los genes invG/invE de la SPI-1 y los genes ssaJ/ ssaK de la SPI-2, respectivamente. La eficiencia de transformacion fue en promedio de 5-10 UFC/ml por cada serotipo de S. enterica. De estas celulas transformantes se seleccionaron dos clones representativos de cada serotipo de Salmonella, con el objeto de comprobar la correcta sustitucion de los genes mencionados, empleando los iniciadores de la tabla 3.

En las figuras 3 y 4, se muestran los productos amplificados que permitieron verificar la correcta sustitucion de los genes objeto de mutacion en las cepas estudiadas. Dependiendo del juego de iniciadores utilizados, el tamano de los amplificados vario y coincidio con el valor esperado, en el caso de la mutacion en la SPI1 fue de 1780 pb cuando se usaron los iniciadores (invF/ForA+invA/RevC) que reconocen las regiones genicas que flanquean los genes invG/ invE (figura 3: A; 1.1 y 1.2). Productos de PCR mas pequenos se obtuvieron cuando se emplearon los iniciadores que identifican los genes adyacentes al sitio de mutacion (invA-invF) y el gen de KmR: 1213 pb (invF/ForA+pKD4Kt) y 1047 pb (invA/RevC+pKD4-K2) (figura 3: canales B y C; 1.1 y 1.2). Resultados similares se observaron en la mutagenesis realizada en la SPI2. Se generaron amplicones de 1827 pb con los iniciadores externos (ssaHI/ForA+ssaL/ ForB) que reconocen las regiones genicas que flanquean los genes ssaJ--ssaK (figura 4: A; 1.1 y 1.2), mientras que se obtuvieron productos de 1153 pb y 1144 pb con los iniciadores especificos que amplifican los genes adyacentes a ssaJ-ssaK y el gen KmR (figura 4: B y C, canales: 1.1 y 1.2).

[FIGURA 3 OMITIR]

[FIGURA 4 OMITIR]

Eliminacion del gen [Km.sup.R] de las cepas [DELTA]invGE::Km y [DELTA]ssaJK::Km S. enterica

Una vez confirmada la correcta sustitucion de los genes que se van a delecionar por el gen de resistencia a Km, estos transformantes fueron sometidos a un ultimo proceso de transformacion con el plasmido auxiliar pCP20, que expresa la recombinasa FLP que reconoce los sitios FRT adyacentes al gen de [Km.sup.R]. Para ello se selecciono un clon por cada serotipo de Salmonella. La seleccion de las mutantes se realizo en agar LB suplementado con Amp a 30[grados]C. La eficiencia de transformacion fue similar a la obtenida anteriormente (5-10 UFC/ml). Las mutantes fueron sometidas a subcultivos a 43 [grados]C para favorecer perdida del plasmido, y seleccionadas en agar LB --el mismo numero de clones que en el ensayo de sustitucion--, y se verifico la correcta perdida del gen de resisten cia que reemplazaba a los genes invG/invE de la SPI-1 y los genes ssaJ/ssaK de la SPI-2, empleando para ello los iniciadores mencionados en la tabla 3. Dependiendo de las parejas de iniciadores utilizados se generaron fragmentos de diferentes tamanos de acuerdo con lo esperado, 194 pb (invF/ForA+invA/RevC) y 675 pb (invF/For B+ invA/Rev C) en los transformantes con delecion de los genes invG/invE de la SPI-1 como se puede apreciar en la figura 5; 227 pb (ssaHI/ForA+ ssaL/RevC) y 327 pb (ssaG/ForB+ssaL/RevC), en los mutantes con eliminacion de los genes ssaJ/ssaK de la SPI-2 como se observa en la figura 6.

[FIGURA 5 OMITIR]

[FIGURA 6 OMITIR]

Cada serotipo o subespecie de Salmonella fue sometida en forma independiente al proceso de sustitucion y delecion de los genes invG/ invE en la SPI-1 y ssaJ/ssaK en la SPI-2. En la tabla 4 se muestra la distribucion de las cepas de acuerdo con la mutacion realizada.

Discusion

La disposicion de tecnicas efectivas para realizar mutaciones puntuales en el cromosoma bacteriano contribuye de manera significativa en la comprension de las implicaciones de diversos genes en la patogenia de un microorganismo (Murphy y Campellone, 2003). Al respecto, el sistema de la recombinasa Red del bacteriofago [lambda], propuesto por Datsenko y Wanner (2000), ofrece una alternativa rapida y eficiente para realizar mutaciones dirigidas e inactivar genes en el genoma de bacterias Gram- negativas, por medio de recombinaciones homologas, en un solo paso, utilizando productos de PCR. Los resultados obtenidos en este estudio asi lo demuestran; 13 cepas de diversos serotipos de S. enterica fueron delecionadas en forma independiente en los genes invG/ invE de SPI-1 y ssaJ/ssaK de SPI-2. Para ello se utilizaron amplicones obtenidos a partir de dos juegos de iniciadores especificamente disenados para una mutagenesis puntual (SPI1/invF-H1P1 y SPI1/invA-H2P2, SPI2/ssaI-H1P1 y SPI2/ssaL-H2P2).

Los genes deleteados en las cepas estudiadas son considerados no esenciales, debido a que no afectan el desarrollo o la viabilidad de la bacteria. Sin embargo, son genes que se encuentran en las dos principales islas de patogenicidad (SPI1 y SPI2) de Salmonella, y son fundamentales para la virulencia de esta bacteria. Estos genes invG/invE y ssaJ/ssaK codifican para proteinas que participan en la formacion de los sistemas de secrecion tipo III (SSTIII) en Salmonella y median la invasion y supervivencia intracelular de la bacteria en la celula hospedera. Estudios similares fueron reportados por Murphy y Campellone (2003), quienes con una metodologia similar a la descrita en este trabajo, lograron delecionar con precision genes (eae,tir y el operon eae-cesT-tir) en islas de patogenicidad (U-islands) de Escherichia coli enterohemorragica (ECEH) y enteropatogena (ECEP). Por otra parte, Klumpp y Fuchs (2007), utilizando el sistema de la recombinasa Red del fago k, identificaron genes nuevos en la isla genomica SPI-6 de S. Typhimurium, la cual contribuye en la multiplicacion de esta bacteria en los macrofagos.

Aunque el sistema de la recombinasa Red del fago [lambda], permite inactivar por lo menos un gen de interes, como el descrito en este trabajo, la eficiencia de este metodo ha permitido la delecion hasta de una isla de patogenicidad completa como lo reportan Dieye et al. (2009), quienes lograron obtener mutantes de S. Typhimurium en SPI1 y SPI2. Ademas, la versatilidad de este sistema ha sido comprobada en este estudio al producir mutaciones sitio-especificas en serotipos de Salmonella de origen clinico diferentes al Typhimurium, Enteritidis o Cholerasuis (Cox et al., 2007; Dominguez-Bernal et al., 2008; Dieye et al., 2009). En este contexto, el sistema de la recombinasa Red ha extendido su utilidad en bacterias diferentes a las de la familia Enterobacteriaceae, tal es el caso de la inactivacion del gen aroA en Pasteurella multocida (Zare et al., 2008) y en la modificacion y delecion de genes en Vibrio cholerae (Yamamoto et al., 2009).

Conclusiones

La metodologia descrita por Datsenko y Wanner (2000), es aplicable para la realizacion de una mutagenesis dirigida por reemplazo y delecion de genes de virulencia en las SPI1 y SPI2 de diferentes serotipos de S. enterica de origen clinico. Este es el primer reporte del empleo exitoso de esta tecnica en serotipos diferentes a S. Typhimurium, Enteritidis y Cholerasuis.

Los resultados obtenidos en este trabajo permitiran estudios futuros in vivo para evaluar la posible atenuacion de la virulencia en mutantes de S. enterica, asi como aportar nuevos conocimientos sobre los mecanismos geneticos involucrados en la fisiopatogenia de las enfermedades producidas por los serovares estudiados y la posible construccion de cepas para el desarrollo de vacunas.

Agradecimientos

Los autores desean expresar su agradecimiento al doctor Francisco Garcia del Portillo del Centro Nacional de Biotecnologia (CNB) Madrid, Espana, por facilitar parte del material biologico utilizado en este estudio, y al doctor Daniel Vega por su asesoramiento en el desarrollo de la metodologia.

Este estudio fue financiado por el proyecto ALFA Bacterialnet (Contrato II-531-FCFA-FCD-FI), Fundacion para el Desarrollo de la Ciencia y la Tecnologia (Fundacite) Merida, Venezuela (Contrato CF-07-10 y CF-09-04); el Consejo de Desarrollo Cientifico, Humanistico y Tecnologico (CDCHT) de la Universidad de los Andes, Merida, Venezuela (Codigos FA419 - 07 - 07 - B y CVI-ADG-FA-02-97) y el Ministerio de Ciencia e Innovacion (Micinn), Espana (proyecto BFU2006-04574/BMC).

Recibido: mayo 25 de 2010

Aprobado: octubre 7 de 2010

Referencias bibliograficas

Beuzon, C. R., Meresse, S., Unsworth, K., Ruiz-Albert, J., Garvis, S., Waterman et al. 2000. Salmonella maintains the integrity of its intracellular vacuole through the action of SifA. The EMBO Journal 19 (13): 3235-3249.

Boyd, F., Li, J., Ochman, H., Selander, R. 1997. Comparative Genetics of the inv-spa Invasion Gene Complex of Salmonella enterica. Journal of Bacteriology 19 (6): 1985-1991.

Collazo, C., Zierier, M., Galan, J. 1995. Functional analysis of the Salmonella typhimurium invasion genes invl and invJ and identification of a target of the protein secretion apparatus encoded in the inv locus Molecular Microbiology 15 (1): 25-38.

Cox, M., Layton, S., Jiang, T., Cole, K., Hargis, B., Berghman, L., Bottje, W., Kwon, Y. 2007. Scarless and site-directed mutagenesis in Salmonella enteritidis chromosome BMC Biotechnology. 7: 59. Disponible en: http://www. biomedcentral.com/1472-6750/7/59

Darwin, K., Miller, V. 1999. Molecular Basis of the Interaction of Salmonella with the Intestinal Mucosa. Clinical Microbiology Reviews 12 (3): 405-428.

Datsenko, K. A., Wanner, B. L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America (PNAS). 97: 6640-6645

Dieye, Y., Ameiss, K., Mellata, M., Curtiss, R. 2009. The Salmonella Pathogenicity Island (SPI) 1 contributes more than SPI2 to the colonization of the chicken by Salmonella enterica serovar Typhimurium BMC Microbiology 9:3 Disponible en: http://www biomed central com/1471-2180/9/3

Dominguez-Bernal, G., Tierrez, A., Bartolome, A., Martinez-Pulgarin, S., Salguero, F. J., Orden, J. A., De la Fuente, R. 2008 Salmonella enterica serovar Choleraesuis derivatives harbouring deletions in rpoS and phoP regulatory genes are attenuated in pigs, and survive and multiply in porcine intestinal macrophages and fibroblasts, respectively. Veterinary Microbiology 130 (3-4): 298-311.

Doublet, B., Douard, G., Targant, H., Meunier, D., Madec, J., Cloeckaert, A. 2008. Antibiotic marker modifications of [lambda] Red and FLP helper plasmids, pKD46 and pCP20, for inactivation of chromosomal genes using PCR products in multidrug-resistant strains Journal of Microbiological Methods, 75: 359-361.

Hensel, M. 2004. Evolution of pathogenicity islands of Salmonella enterica International Journal of Medical Microbiology 294: 95-102

Klumpp, J., Fuchs, T. 2007. Identification of novel genes in genomic islands that contribute to Salmonella typhimurium replication in macrophages Microbiology 153, 1207-1220. Disponible en: http://mic.sgmjournals .org/cgi/reprint/153/4/1207

Morgan, E. 2007 Salmonella pathogenicity islands En: Rhen, M, Maskell, D, Mastroeni, P, Threlfall, J. Salmonella molecular biology and pathogenesis Horizon Bioscience, UK

Murphy, K. C., Campellone, K. G. 2003 Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic E. coli. BMC

Molecular Biology 4: 11 Disponible en: http://www biomedcentral.com/1471-2199/4/11.

Santoyo, G. 2008 Recombineria en bacterias: ingenieria del ADN usando recombinacion homologa. Revista Latinoamericana de Microbiologia 50 (1-2): 38-47.

Vega, D., Ayala, J. 2006. The DD-carboxypeptidase activity encoded by pbp4B is not essential for the cell growth of Escherichia coli. Archives of Microbiology 185: 23-27.

Vernikos, G., Parkhill, J. 2006. Interpolated variable order motifs for identification of horizontally acquired DNA: revisiting the Salmonella pathogenicity islands Bioinformatics 22 (18): 2196-2203.

Zare, P., Tabatabaei, M., Yousefbeygi, G., Jabbari, A. 2008. Using Red Recombinase and PCR Product for One-Step-in-Frame Inactivation of aroA Gene in Pateurella multocida A: 1 and Evaluation of Pathogenicity and Immonogecity. Journal of Animal and Veterinary Advances 7(9): 1155-1159.

Yamamoto, S., Izumiya, H., Masatomo, M., Arakawa, E., Watanabe, H. 2009. Application of [lambda] Red recombination system to Vibrio cholerae genetics: Simple methods for inactivation and modification of chromosomal genes. Gene 438: 57-64.

Judith Velasco (1), Maria Araque (2), Juan A. Ayala (3)

(1) Licenciada en Bioanalisis, Especialista en Microbiologia, Departamento de Microbiologia y Parasitologia, Facultad de Farmacia y Bioanalisis, Universidad de los Andes, Merida, Venezuela. judithvelasco2005@yahoo.es

(2) Medico cirujano, Doctora en Ciencias Medicas Fundamentales, Departamento de Microbiologia y Parasitologia, Facultad de Farmacia y Bioanalisis, Universidad de los Andes, Merida, Venezuela. araquemc@ula.ve

(3) Licenciado en Ciencias Quimicas (Bioquimica), Doctor en Ciencias Quimicas (Bioquimica), Centro de Biologia Molecular "Severo Ochoa" CSIC-UAM, Campus de Cantoblanco, Madrid, Espana. jayala@cbm.uam.es
Tabla 1. Cepas bacterianas y plasmidos empleados en este estudio

 Bacterias y                                             Origen o
  plasmidos                 Caracteristicas             referencia

Salmonella

Typhimurium          hisG; Sm (R); cepa de referencia   Co. CBMSO
SL-1344              (control de calidad)

Pullorum             Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     Amc (R), Te (R)

Subespecie salamae   Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     Sm (R), Te (R)

Enteritidis          Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK

Saintpaul            Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     Sm (R), Te (R), Tic (R)

Subespecie           Cepa clinica, sipA, invJ, invI,    Co. ULAMM
arizonae             invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     An (R), Amc (R), Caz (R),
                     Cxm (R), C (R), Sm (R), Te (R)

London               Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK

Infantis             Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK

Montevideo           Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     Sm (R)

Dublin               Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     Sm (R)

Havana               Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK

Typhimurium          Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK

Java                 Cepa clinica, sipA, invJ, invI,    Co. ULAMM
                     invH, hilA, ssaU, ssaD,
                     ssrA/ssrB, sseB/sscA, ssaJ/ssaK,
                     An (R), Te (R)

Plasmidos

pKD4                 1,6 Kb. Derivado de                Datsenko y
                     pANT-S[gamma] contiene regiones    Wanner (2000)
                     flanqueantes FRT del gen Km (R);
                     Amp (R)

pKD46                6,3 Kb. Derivado de pINT-ts        Datsenko y
                     contiene araC-[P.sub.araB] y       Wanner (2000)
                     fragmentos de ADN [gamma] [beta]
                     exo; Amp (R)

pCP20                9,4 Kb. Termosensible, expresa     Datsenko y
                     la recombinasa FLP; AmpR; CR       Wanner (2000)

Co. CBMSO: Coleccion Centro de Biologia Molecular "Severo Ochoa",
Universidad Autonoma de Madrid, Espana; Co. ULAMM: Coleccion
Universidad de los Andes, Laboratorio de Microbiologia Molecular,
Merida, Venezuela; (R): resistente, Km: kanamicina, C:
cloramfenicol, Sm: estreptomicina, Tic: ticarcilina, Amc:
amoxacilina/acido clavulanico, An: acido nalidixico, Cxm:
cefuroxima, Caz: ceftazidima, Te: tetraciclina.

Tabla 2. Iniciadores usados en la inactivacion de los genes en las
SPI-1 y SPI-2

 Iniciadores                           Secuencia

SPI1/invF-H1P1   GAAATTATCAAATATTATTCAATTGGCAGACAAATGGTGTAGGCTGGAGCTG-
                   CTTC
SPI1/invA-H2P2   GATCATCACCATTAGTACCAGAATCAGTAATTCAGGCATATGAATATCCTCC-
                   TTAG
SPI2/ssaI-H1P1   GTAAGCACTCAATC7TATGTAAAGTCCTCTGCAGAAGTGTAGGCTGGAGCTG-
                   CTTC
SPI2/ssaL-H2P2   A7TCTGTAAATCAGGATCACTA7TCTC7TCGGTAAGCATATGAATATCCTCC-
                   TTAG

Los iniciadores inv y ssa, se refieren a los genes utilizados a
partir del genoma de Salmonella. La region denominada H1 y H2
(cursiva), permite la insercion del gen de resistencia en sentido
forward o reverse por recombinacion homologa, que reconoce
secuencias adyacentes a los genes por inactivar, y las regiones
denominadas P1 y P2 (negrita), reconoceran secuencias en el
plasmido que contiene el gen de resistencia.

Tabla 3. Iniciadores usados para verificar la inactivacion
de los genes en las SPI-1 y SPI-2

   Iniciadores            Secuencia

SPI1/invF/ForA      GCAATCGCTGCTGAATAGTG
SPI1/invF/ForB      CTGAAAGCCGACACAATGAA
SPI1/invA/RevC      CAGTGCGATCAGGAAATCAA
SPI2/ ssaHI/ForA    CGCTGCGTCTGTTATTTCCT

SPI2/ssaG /ForB     CGCAATTTGCCTTACAGCAG
SPI2/ssaL/RevC      TATCCACTTCGCCAAGTTCC
pKD4-K2             CGGTGCCCTGAATGAACTGC
pKD4-Kt             CGGCCACAGTCGATGAATCC

Las secuencias fueron obtenidas de las regiones flanqueantes de
los genes invF, invA, ssaH, ssaI, ssaG y ssaL en sentido forward
o reverse (figura 2), pKD4-K2 y pKD4-Kt corresponden a la region
codificante para el gen kanamicina del plasmido pKD4 en sentido
forward K2 y reverse Kt.

Tabla 4. Serotipos de Salmonella enterica mutadas en SPI-1 y SPI-2

    Cepas de origen
        clinico            Mutantes en SPI-1      Mutantes en SPI-2

Salmonella Pullorum       [DELTA]invGE S.        [DELTA]ssaJK S.
                          Pullorum               Pullorum

S. subespecie salamae     [DELTA]invGE S.        [DELTA]ssaJK S.
                          subespecie salamae     subespecie salamae

S. Enteritidis            [DELTA]invGE S.        [DELTA]ssaJK S.
                          Enteritidis            Enteritidis

S. Saintpaul              [DELTA]invGE S.        [DELTA]ssaJK S.
                          Saintpaul              Saintpaul

S. subespecie arizonae    [DELTA]invGE S.        [DELTA]ssaJK S.
                          subespecie arizonae    subespecie arizonae

S. London                 [DELTA]invGE S.        [DELTA]ssaJK S.
                          London                 London

S. Infantis               [DELTA]invGE S.        [DELTA]ssaJK S.
                          Infantis               Infantis

S. Montevideo             [DELTA]invGE S.        [DELTA]ssaJK S.
                          Montevideo             Montevideo

S. Dublin                 [DELTA]invGE S.        [DELTA]ssaJK S.
                          Dublin                 Dublin

S. Havana                 [DELTA]invGE S.        [DELTA]ssaJK S.
                          Havana                 Havana

S. Typhimurium            [DELTA]invGE S.        [DELTA]ssaJK S.
                          Typhimurium            Typhimurium

S. Java                   [DELTA]invGE S. Java   [DELTA]ssaJK S. Java

Cepa de referencia

S. Typhimurium SL-1344    [DELTA]invGE S.        [DELTA]ssaJK S.
                          Typhimurium SL-1344    Typhimurium SL-1344
COPYRIGHT 2010 Universidad Nacional de Colombia, Instituto de Biotecnologia
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Velasco, Judith; Araque, Maria; Ayala, Juan A.
Publication:Revista Colombiana de Biotecnologia
Date:Dec 1, 2010
Words:4319
Previous Article:Aclimatizacion de Phalaenopsis y Cattleya obtenidas por micropropagacion.
Next Article:Analisis experimental del desgaste entre UHMWPE y acero inoxidable 316L empleados en la manufactura de protesis coxofemorales.
Topics:

Terms of use | Privacy policy | Copyright © 2022 Farlex, Inc. | Feedback | For webmasters |