Printer Friendly

Comprehensive mu-opioid-receptor genotyping by pyrosequencing.

The human [mu]-opioid receptor, encoded by the OPRM1 gene (1, 2), is the major site for the analgesic action of opioids. The OPRM1 gene is therefore a first-line candidate for evaluating the role of mutations on the clinical effects of opioids. The mutant allele of the 118A>G single-nucleotide polymorphism (SNP) in the OPRM1 gene, which codes for an Asn40Asp [mu]-opioid receptor, has been associated with decreased opioid activity in carriers of the 118G allele. Morphine 6-glucuronide (M6G) and morphine have lower potencies for pupil constriction in carriers of the mutation, who also vomit less often after treatment with M6G than noncarriers (3). Carriers of the 118G allele need more alfentanil for postoperative analgesia but have less pain relief than noncarriers (4). The 118G allele has also been associated with a greater cortisol response to opioid receptor blockade with naloxone (5).

Regarding opioid addiction, the mutant allele of the 17C>T SNP was found more frequently in drug addicts than in nonaddicts (6, 7). An association between the mutant alleles of the 118A>G (exon 1) and 691C>G (intron 2) SNPs and opioid dependence was reported for Chinese heroin addicts, although this was based on a small study group (8). The frequency of the mutated 118G allele was higher in Indian heroin addicts than in controls (9). Addicted individuals carrying both the mutated 118G allele and the mutated 31A allele in intron 2 consumed higher doses of heroin than individuals who did not carry these mutations (10). The simultaneous presence of the mutated alleles for SNPs -1793T>A, -1699-(-1698)insT, -1320A>G, -111C>T, and 17C>T is associated with substance dependence (11). In European Americans, allele -2044A and haplotypes that include -2044A were found to be associated with susceptibility for substance dependence (12).

To promote further investigation of an association of OPRM1 mutations with altered opioid effects or substance dependence, we describe a rapid screening method for several mutations in the OPRM1 gene. SNPs in the OPRM1 gene that qualify for large-scale screening in patients were selected to become part of the screening method when they met one of the following three criteria: (a) in vitro or human studies had revealed a functional consequence; (b) the mutation causes an amino acid exchange, encoding an altered opioid receptor protein; or (c) the SNP has a high reported allelic frequency, which implies that it could have immediate clinical relevance for the administration of opioids in a large part of the population. On that basis, a total of 23 SNPs in the promoter region; in exons 1, 2, and 3; and in the second intron were chosen for screening (see Table 1 for details). To this we added the SNPs -54G>T in the promoter, 24G>A in exon 1 and 942G>A in exon 3 because their close proximity to SNPs -38C>A, 17C>T and 877G>A, respectively, allowed their detection by use of the already available PCR templates with a small extension of the respective assays (see the Data Supplement that accompanies the online version of this Technical Brief at http:// www.clinchem.org/content/vol50/issue3/). Thus, our method includes a total of 26 SNPs.

To detect the 26 selected SNPs in OPRM1, we developed a set of 14 assays (Table 1) based on the real-time pyrophosphate detection method Pyrosequencing[TM] (13). DNA from 116 healthy Caucasians who had given written informed consent was used to generate OPRM1 DNA fragments. Genotyping was approved by the University of Frankfurt Medical Faculty Ethics Review Board. Primers were designed with "Oligo" primer analysis software (Molecular Biology Insight, Inc.) with use of the OPRM1 nucleotide sequences provided with Ensembl Gene ID ENS000000112038 (Table 2 in the online Data Supplement). A standard thermal cycling protocol (see Table 2 in the online Data Supplement for the number of cycles) was used. Cycling was for 30 s at 95[degrees]C, 60 s at primer-specific temperatures (Table 2 in the online Data Supplement), and 30 s at 72[degrees]C. Pyrosequencing primers (Table 2 in the online Data Supplement) were designed with use of SNP Primer Design software (Pyrosequencing AB; http: / / www.pyrosequencing.com). A series of simplex, duplex, and triplex assays were generated on a PSQ 96MA (Pyrosequencing AB; Table 1, Fig. 1, and online Data Supplement). In most cases, reverse assays were identified to be best suited for detection. A forward assay was applied in the case of the SNPs -1793T>A and -1698-(-1699)insT, and the duplex assay covering 440C>G and 454A>G (see the online Data Supplement). For each pyrosequencing assay, PCR template for each OPRM1 SNP was incubated in a shaker (10 min) with streptavidin-coated Sepharose beads (Amersham Pharmacia Biotech) and prepared with 672 mL/L 96% ethanol and denaturation buffer in a Vacuum Prep Workstation (Pyrosequencing AB) for transfer of the biotinylated templates into 55 /,L of the corresponding 0.35 /,mol/L sequencing primer (Table 2 in the online Data Supplement). Sequencing took place in a PSQ 96MA after incubation for 2 min at 80[degrees]C. For confirmation of the pyrosequencing results, a total of 48 samples [4 randomly chosen samples for each of the 12 DNA templates (Table 1), including 2 mutated DNAs where available] were sequenced by conventional methods on an ABI PRISM 310 Genetic Analyzer (PE/Applied Biosystems). For haplotype analysis, all pyrosequencing results were submitted to HAPLOTYPER computer software for Linux (Harvard University) (14). As an alternative to haplotyping by software, molecular haplotyping would be possible with pyrosequencing using allele-specific PCR templates (15) in an otherwise identical assay.

[FIGURE 1 OMITTED]

The observed pyrograms corresponded to the predicted theoretical assay outcomes, allowing clear identification of the genotypes in all SNPs. Pyrosequencing results agreed with the results obtained with conventional sequencing of random samples. A pyrogram exemplifying the assay for the 118A>G SNP is shown in Fig. 1; more examples are available in the online Data Supplement. The observed allelic frequencies of the mutations are given in Table 1. The most frequent SNP was 691C>G in intron 2 (frequency of the mutated allele, 53.4%). The 118A>G SNP in exon 1 was found at a frequency of 12.1% (mutated allele). The observed allelic frequencies corresponded to those published previously (Table 1) except for the -692C and -38A alleles, which had previously been reported to have frequencies of 4.3% and 1.4-5% (11), respectively, but which we did not find in any of the 116 participants in our study. We found fewer carriers than reported previously for the mutated allele -172T [3.4% vs 11.4% (11)], whereas we found the mutated 691G allele at a higher frequency in our study population [53.4% vs 42.9% (11,16)]. The most frequent haplotype (39%) contained an IVS2 691G>C mutation and no mutation at any of the other 25 analyzed loci. The second most frequent haplotype had no mutations in any of the 26 positions (frequency, 33%). A haplotype with a mutation at only 118A>G was found at a frequency of 10%, and a combination of IVS2 mutations 31G>A and 691G>C was found at a frequency of 7%. The 118G allele was found together with the IVS2 691G>C allele, without any other mutations, at a frequency of 1.3%.

Receptors encoded by the mutated allele of the 118A>G SNP were reported to have a threefold higher binding affinity for [beta]-endorphin compared with wild-type receptors in AV-12 cells transfected with the 118G cDNA (6). However, the binding in HEK293 cells transfected with mutated 118G cDNA was not affected (17). Clinical data have indicated decreased opioid activity in heterozygous carriers of the 118A>G SNP (3, 4,18). In a previous report, a patient not responding to morphine therapy was heterozygous for the 118G allele, whereas a patient who responded was wild type at this position (19). In another report, a 118G carrier with renal failure tolerated high plasma M6G, whereas a patient who did not have the mutation was sedated as a consequence of M6G accumulation (20). The mutated allele of SNP 802T>C SNP has been shown to produce altered receptor desensitization and receptor signaling with decreased G-protein coupling (21). The affinity of [mu]-opioid-receptor agonists such as morphine; diprenorphine; n-Ala(2),N-MePhe(4),Gly(5)-olenkephalin (DAMGO); [beta]-endorphin; metenkephalin; and dynorphine was not changed, but the potency and efficacy of DAMGO, (3-endorphin, and morphine were decreased (22). Mutated alleles containing SNPs 779A>G and 877G>A are possibly involved in altered desensitization of the [mu]-opioid receptor (23). Finally, mutated alleles carrying the -T1793A SNP and an inserted thymine at position -1699 were found to potentially influence transcriptional regulation (24).

Thus, evidence from in vitro experiments and clinical studies points to a functional importance of several OPRM1 SNPs. Research on SNPs in the OPRM1 gene is, therefore, of immediate interest for assessing the clinical effects of opioid analgesics and for studying the epidemiology of substance addiction. We provide a screening method suitable for large-scale genetic diagnosis of 26 SNPs in OPRM1. The method includes SNPs with reported high allelic frequencies as well as rare SNPs with demonstrated or potential functional relevance. The method presented could facilitate identification of OPRM1 mutations with clinical relevance and thus enable individualized opioid pharmacotherapy in the near future.

This work was supported by Dr. Robert Pfleger Stiftung, Bamberg, Germany.

References

(1.) Wang JB, Imai Y, Eppler CM, Gregor P, Spivak CE, Uhl GR. Mu opiate receptor: cDNA cloning and expression. Proc Natl Acad Sci U S A 1993;90: 10230-4.

(2.) Uhl GR, Sora I, Wang Z. The mu opiate receptor as a candidate gene for pain: polymorphisms, variations in expression, nociception, and opiate responses. Proc Natl Acad Sci U S A 1999;96:7752-5.

(3.) Skarke C, Darimont J, Schmidt H, Geisslinger G, Lbtsch J. Analgesic effects of morphine and morphine-6-glucuronide in a transcutaneous electrical pain model in healthy volunteers. Clin Pharmacol Ther 2003;73:107-21.

(4.) Caraco Y, Maroz Y, Davidson E. Variability in alfentanil analgesia maybe attributed to polymorphism in the mu-opiod receptor gene. Clin Pharmacol Ther 2001;69:63.

(5.) Wand GS, Mccaul M, Yang X, Reynolds J, Gotjen D, Lee S, et al. The mu-opioid receptor gene polymorphism (A118G) alters HPA axis activation induced by opioid receptor blockade. Neuropsychopharmacology 2002;26: 106-14.

(6.) Bond C, LaForge KS, Tian M, Melia D, Zhang S, Borg L, et al. Single-nucleotide polymorphism in the human mu opioid receptor gene alters [beta]-endorphin binding and activity: possible implications for opiate addiction. Proc Natl Acad Sci U S A 1998;95:9608-13.

(7.) Berrettini WH, Hoehe MR, Ferraro TN, Demaria PA, Gottheil E. Human mu opioid receptor gene polymorphisms and vulnerability to substance abuse. Addict Biol 1997;2:303-8.

(8.) Szeto CY, Tang NL, Lee DT, Stadlin A. Association between mu opioid receptor gene polymorphisms and Chinese heroin addicts. Neuroreport 2001;12:1103-6.

(9.) Tan EC, Tan CH, Karupathivan U, Yap EP. Mu opioid receptor gene polymorphisms and heroin dependence in Asian populations. Neuroreport 2003;14:569-72.

(10.) Shi J, Hui L, Xu Y, Wang F, Huang W, Hu G. Sequence variations in the mu-opioid receptor gene (OPRM1) associated with human addiction to heroin. Hum Mutat 2002;19:459-60.

(11.) Hoehe MR, Kopke K, Wendel B, Rohde K, Flachmeier C, Kidd KK, et al. Sequence variability and candidate gene analysis in complex disease: association of mu opioid receptor gene variation with substance dependence. Hum Mol Genet 2000;9:2895-908.

(12.) Luo X, Kranzler HR, Zhao H, Gelernter J. Haplotypes at the OPRM1 locus are associated with susceptibility to substance dependence in European-Americans. Am J Med Genet 2003;120B:97-108.

(13.) Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001;11:3-11.

(14.) Niu T, Qin ZS, Xu X, Liu JS. Bayesian haplotype inference for multiple linked single-nucleotide polymorphisms. Am J Hum Genet 2002;70:157-69.

(15.) Pettersson M, Bylund M, Alderborn A. Molecular haplotype determination using allele-specific PCR and pyrosequencing technology. Genomics 2003; 82:390-6.

(16.) Bergen AW, Kokoszka J, Peterson R, Long JC, Virkkunen M, Linnoila M, et al. Mu opioid receptor gene variants: lack of association with alcohol dependence. Mol Psychiatry 1997;2:490-4.

(17.) Beyer AKT, Hollt V. A118G polymorphism does not alter the ligand binding and activity of the human mu-opioid receptor. Naunyn Schmiedebergs Arch Pharmacol 2003;367: R17.

(18.) Lotsch J, Skarke C, Gr6sch S, Darimont J, Schmidt H, Geisslinger G. The polymorphism A118G of the human mu-opioid receptor gene decreases the clinical activity of morphine-6-glucuronide but not that of morphine. Pharmacogenetics 2002;12:3-9.

(19.) Hirota T, leiri I, Takane H, Sano H, Kawamoto K, Aono H, et al. Sequence variability and candidate gene analysis in two cancer patients with complex clinical outcomes during morphine therapy. Drug Metab Dispos 2003;31: 677-80.

(20.) Lotsch J, Zimmermann M, Darimont J, Marx C, Dudziak R, Skarke C, et al. Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity? Anesthesiology 2002;97:814-9.

(21.) Koch T, Kroslak T, Averbeck M, Mayer P, Schroder H, Raulf E, et al. Allelic variation S268P of the human mu-opioid receptor affects both desensitization and G protein coupling. Mol Pharmacol 2000;58:328-34.

(22.) Befort K, Filliol D, Decaillot FM, Gaveriaux-Ruff C, Hoehe MR, Kieffer BL. A single-nucleotide polymorphic mutation in the human mu-opioid receptor severely impairs receptor signaling. J Biol Chem 2001;276:3130-7.

(23.) Koch T, Kroslak T, Mayer P, Raulf E, Hollt V. Site mutation in the rat mu-opioid receptor demonstrates the involvement of calcium/calmodulin-dependent protein kinase II in agonist-mediated desensitization. J Neurochem 1997;69:1767-70.

(24.) Wendel B, Hoehe MR. The human mu opioid receptor gene: 5' regulatory and intronic sequences. J Mol Med 1998;76:525-32.

(25.) Gelernter J, Kranzler H, Cubells J. Genetics of two mu opioid receptor gene (OPRM1) exon I polymorphisms: population studies, and allele frequencies in alcohol- and drug-dependent subjects. Mol Psychiatry 1999;4:476-83.

(26.) Darimont J, Skarke C, Gr6sch S, Geisslinger G, Lotsch J. Einfache Detektion der A118G- and C3435T-Punktmutationen des OPRM1-bzw. MDR1-Gens and Allelfrequenzen in Frankfurter Medizinstudenten. Naunyn Schmiedebergs Arch Pharmacol 2002;365:R116.

(27.) Xin L, Wang ZJ. Bioinformatic analysis of the human mu opioid receptor (OPRM1) splice and polymorphic variants. AAPS PharmSci 2002;4:23.

(28.) Wang D, Quillan JM, Winans K, Lucas JL, Sadee W. Single nucleotide polymorphisms in the human mu opioid receptor gene alter basal G protein coupling and calmodulin binding. J Biol Chem 2001;14:34624-30.

DOI: 10.1373/clinchem.2003.027607

Carsten Skarke, * Anja Kirchhof, Gerd Geisslinger, and Jorn Lotsch (pharmazentrum frankfurt, Institute of Clinical Pharmacology, Johann Wolfgang Goethe-University, Theodor Stern Kai 7, 60590 Frankfurt, Germany; * author for correspondence: fax 49-69-6301-7636, e-mail skarke@em.uni-frankfurt.de)
Table 1. SNPs in the OPRM1 gene detected by pyrosequencing.

Assay Amino acid Exon/Intron/
 no. Mutation (a) location Promoter

 1 -2044C>A Promoter
 2 -1793T>A
 3 -1699-(-1698)insT
 4 -1320A>G
 5 -692G>C
 6 -172G>T
 -111C>T
 7 -54G>T
 -38C>A
 8 12C>G S4R Exon 1
 17C>T A6V
 24G>A T8T
 9 118A>G N40D
 10 440C>G S147C Exon 2
 454A>G N152D
 11 IVS2 31G>A Intron 2
 IVS2 106T>C
 IVS2 691C>G
 (=1031C>G)
 12 IVS2 397T>A
 IVS2 438G>A
 13 779G>A R260H Exon 3
 794G>A R265H
 802T>C S268P
 820G>A K273A
 14 877G>A 1877V
 942G>A T314T

Assay Nucleotide sequence to be
 no. analyzed, (b) 5',3' dNTP (c) dispensing order

 1 TCTT/GCTCTGAAACTA GTCTGACTC
 2 A/TTTTAAGTAATGAGAAGAC GTATACGTATG
 3 T/GACTCCAAGGTCAG CTGTACTCA
 4 CT/CCAGTTGG GCTCTAGT
 5 AC/GAAACCTGTTGGGAACAA TACGTACTG
 6 GC/ATGAGCATCTGAC CGCAGTGCAGTAGAT
 TGCTA/GTTTCTTACAG
 7 G/TCCAGGAGCACCGAGAA/ AGTGCAGAGCACGAGACGT
 CTTTTCGGGTTCCA
 8 C/TGTGGGGG/ACA ACTCGTGAGCAGCGCGT
 GCC/GCTGCTGTCCA
 9 C/TGCCATCTAAGTGGG GCTAGCATC
 10 CTC/GCATAGATTACTATA/ GCTGCGATAGATACTATGAGC
 GACATGTTC
 11 T/CTCCTTCCCTCAGGC GCTGCTCTACTG
 TGGTAACATCACTCACCTTGCC CGAGCAGCTGTGAG
 AAAATTACAG/ATGTGACTAAGAC
 ATTG/CATTTTTAGCCTTGACCA
 12 GGA/TTTGTTCAATATTCTGAT TCTATGTATACA
 ATTAGGTGTAGAAAGAT CATAGTCTAGCGAGTAT
 ACATTTGCCATGT
 T/CGGCTCCAGGTAATGGATGTTTTCACTTC
 ATTTTTTGATGG
 13 T/CCTTTTCTTTGGAGCCAGG/ GTCGTTCTGAGCAGAGAG
 AGAGCATGT/CGGACACTCTTGAGGT/ TCATGTCTGACACTCTGAGTC
 CGCAAGATCATCAGTCCATAGCACACGGT
 14 AC/TGATGAACACA GCTCGTACTCGA
 C/TGTAGTTT

 Mutated allele frequency, %
Assay Pyrosequencing
 no. assay type Reported Observed

 1 Reverse simplex 0.8 (12) 2.20
 2 Forward simplex 1.4 (11) 0.90
 3 Forward simplex 1.4 (11) 1.30
 4 Reverse simplex 1.4 (11) 0.40
 5 Reverse simplex 4.3 (11) Not found
 6 Reverse duplex 11.4 (11) 3.40
 1.4 (11) Not found
 7 Reverse simplex Not reported (27) Not found
 1.4-5 (7, 11) Not found
 8 Reverse simplex Not reported (2) Not found
 1.9 (6) 0.9
 2 (6) 0.4
 9 Reverse simplex 11.5-15.4 12.1
 (6, 16, 25, 26)
 10 Forward simplex <1 (16) Not found
 ~1.4 (11, 27) Not found
 11 Reverse triplex 4.2-14.3 (10, 11) 8.2
 1.4 (11) Not found
 42.9 (11, 16) 53.4
 12 Reverse duplex 1.4 (11) Not found
 4.3 (11) Not found
 13 Reverse simplex <1 (6) Not found
 <1 (6, 22) Not found
 <1 (22) Not found
 <1 (28) Not found
 14 Reverse duplex <1 (10) 0.40
 <1 (6) Not found

(a) SNPs are listed according to their location in the OPRM1 gene. The
allelic frequencies are indicated according to the literature and as
found in our study population.

(b) The sequence to analyze given is long enough to be accepted by the
Pyrosequencing software when entering the assay. Note that some
nucleotides entered at the end of that sequence will not be analyzed
with the dispensed deoxynucleotide triphosphates.

(c) dNTP, deoxynucleotide triphosphate.
COPYRIGHT 2004 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2004 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Technical Briefs
Author:Skarke, Carsten; Kirchhof, Anja; Geisslinger, Gerd; Lotsch, Jorn
Publication:Clinical Chemistry
Date:Mar 1, 2004
Words:2925
Previous Article:Tandem mass spectrometry for the direct assay of enzymes in dried blood spots: application to newborn screening for Krabbe disease.
Next Article:Comparison of methods for polycythemia rubra vera-1 mRNA quantification in whole-blood leukocytes and purified granulocytes.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters