Printer Friendly

Complete scanning of the hereditary hemochromatosis gene (HFE) by use of denaturing HPLC.

Hereditary hemochromatosis (HC) (1) is a common autosomal recessive disorder of iron metabolism with a prevalence of ~1 in 300 in Caucasians of Northern European descent (2, 3). HC is an adult-onset disease characterized by increased duodenal iron absorption, which leads to progressive iron loading of parenchymal cells in major organs, primarily the liver, pancreas, and heart. In the final stages, the structure and function of these organs are affected. When diagnosis is made before irreversible tissue damage occurs, regular removal of excess iron by phlebotomy usually leads to a normal life expectancy (4).

An important hurdle in diagnosis of HC and detection of asymptomatic patients was cleared in 1996, when the gene for HC (HFE gene) was cloned and two causative mutations were reported: the 845G [right arrow] A transition, which changes amino acid 282 from cysteine to tyrosine (C282Y); and the 187C [right arrow] G transversion, which changes amino acid 63 from histidine to aspartic acid (H63D) (5). Several studies of Caucasian populations have concluded that at least 80% of HC probands are homozygous for the C282Y mutation and that 4-7% are C282Y/H63D compound heterozygotes (5-9).

Numerous techniques are available to detect these two common HFE mutations (5,6,8,10-15). However, depending on the population studied, 4-35% of cases presenting with the HC phenotype are C282Y or H63D heterozygotes or lack both C282Y and H63D (5, 7-9, 16, 17). The HFE coding region from some of these HC probands has been studied, and nine novel mutations have been described: four missense mutations (S65C, I105T, G93R, and R330M) (18-20), two frameshift mutations (V68de1T and P160de1C) (21,22), two nonsense mutations (E168X and W169X) (23), and one splice site mutation (IVS3+IG [right arrow] T) (24). Six of the mutations (I105T, G93R, R330M, V68de1T, P160de1C, and IVS3+IG [right arrow] T) are private, i.e., they were observed in either individual families or in individual probands, and the three others are rare, i.e., they were found to be significantly enriched in the chromosomes of HC probands from Brittany (S65C) or from two northern Italian regions (E168X and W169X) (18, 23). Moreover, one HFE missense mutation (Q127H) has been described in a South African patient referred for molecular diagnosis of variegate porphyria (20), another (E277K) has been described in a diabetic patient of Asian origin (25), and four others (V53M, V59M, E168Q, and V272L) have been reported in individuals not referred for HC (14, 20, 26).

From these recent findings, scanning the complete HFE coding region in HC probands with at least one chromosome lacking the C282Y and H63D mutations may be of particular interest, to define whether they carry uncommon HFE mutations liable to explain iron overload and confirm the diagnosis of HC. DNA sequencing analysis remains the definitive procedure for identifying mutations, but when faced with numerous samples, even with semiautomated high-throughput sequencing systems, systematic DNA sequencing analysis is still technically demanding, costly, and time-consuming. These drawbacks have led to the development of faster and less expensive scanning methods to identify positive samples and to further carry out DNA sequencing analysis of targeted regions only.

A recent approach is denaturing HPLC (DHPLC). This is an automated technology based on the separation of heteroduplex PCR products from their corresponding homoduplexes on an ion-pair reversed-phase liquid chromatography system (27, 28). The hydrophobic stationary phase consists of alkylated nonporous poly(styrene/ divinylbenzene) particles, and the mobile phase consists of triethylammonium acetate and acetonitrile. The column is maintained at a set temperature to partially denature DNA molecules. Under these conditions, heteroduplexes attributable to mismatch pairing will form weaker interactions with the hydrophobic matrix. With a linear acetonitrile gradient, the heteroduplexes will therefore be eluted earlier than the homoduplexes. To form heteroduplexes, PCR-amplified DNA is heated to 94[degrees]C and then cooled slowly. Samples containing a heterozygous mutation form both homoduplexes and heteroduplexes, and at least two peaks are observed. Samples that give a single peak could be either wild type or could contain a homozygous mutation. The latter can be easily identified by mixing the sample with wild-type amplified DNA and repeating the analysis, searching for heteroduplex formation.

Here we define optimized analytical conditions for each exon and report the successful application of DHPLC for screening the complete HFE coding region. We demonstrate the efficiency of this new approach by detecting the 17 known HFE mutations as well as 3 HFE polymorphisms localized in regions without known mutations. We thus conclude that DHPLC can be used for rapid, efficient scanning of the HFE gene in HC probands in whom at least one chromosome lacks an assigned mutation.

Materials and Methods

PATIENTS AND DNA SPECIMENS

DNA samples harboring the C282Y, H63D, or S65C mutations, identified by PCR and restriction enzyme assays as described previously (9,18), were collected from local hospital patients for whom a molecular diagnosis of HC was requested. Written informed consent to use the DNA for future research was obtained at the time of initial testing. Genomic DNA was extracted from 1.5 mL of EDTA-anticoagulated blood. DNA isolation was carried out using the GFX[TM] Genomic Blood DNA Purification Kit (Pharmacia). DNA was eluted from the glass fiber matrix by 100 [micro]L of Tris-EDTA buffer (10 mmol/L Tris-HCl, 1 mmol/L EDTA, pH 8.0) at 70[degrees]C.

PCR PRIMERS AND DNA AMPLIFICATION FOR DHPLC ANALYSIS

Six pairs of primers were designed to amplify the whole HFE coding region (including intron/exon junctions), based on the National Center for Biotechnology Information GenBank HFE gene sequence (Accession No. Z92910; Table 1). Amplified fragments were 168-377 by in length. The regions amplified included 44-80 by of intron sequence on the 5' side of the exon and 27-54 by of intron sequence on the 3' side. PCR was performed in 50 [micro]L containing the following: 25 pmol of each primer, 1.0-2.0 mM Mg[Cl.sub.2], 1 x PCR buffer II (Applied Biosystems), 200 [micro]M each dNTP (Amersham-Pharmacia Biotech), 1 U of AmpliTaq DNA polymerase (Applied Biosystems), and 100-240 ng of DNA. We chose a Touchdown PCR protocol (29) to minimize PCR optimization and to reduce the number of thermocycler programs; in fact, one protocol was enough to amplify all six coding exons. Cycling conditions were as follows: a denaturation step at 94[degrees]C for 3 min; 14 touchdown cycles with annealing temperature decreasing 0.5[degrees]C per cycle from 63 to 56.5[degrees]C (denaturation at 94[degrees]C for 30 s, annealing for 30 s, primer extension at 72[degrees]C for 45 s); 25 cycles with a 56[degrees]C annealing temperature; and a final elongation step at 72[degrees]C for 5 min. All PCR reactions were carried out using the GeneAmp PCR system 9700 (Applied Biosystems). Specific sizes and quantities of amplicons were checked by electrophoresis on 2% agarose gels. Amplicons were stored at 4[degrees]C until DHPLC analysis.

SITE-DIRECTED MUTAGENESIS

Genomic DNA from a healthy subject was extracted, and all six coding HFE gene fragments were amplified as described above. PCR products were purified on a Microcon 100 centrifugal filter (Millipore) and sequenced using the fluorescent-tagged dideoxy chain termination method with an ABI automated sequencer (Applied Biosystems) to check absence of DNA variations. These wild-type HFE sequences were then cloned into pGEM-T-easy (Promega) and used to recreate 18 HFE point mutations with the QuickChange[TM] Site-Directed Mutagenesis Kit (Stratagene). The mutagenic oligonucleotide primers were designed individually, based on the GenBank HFE gene sequence, according to the desired mutation and following the manufacturer's recommendations. PCR amplifications were carried out using the GeneAmp PCR system 9700 (Applied Biosystems), following the manufacturer's protocols depending on the nature of the mutation (substitution or deletion). All new HFE sequences were checked by sequencing.

DHPLC ANALYSIS

Heteroduplexes were formed by heat denaturation of PCR products at 94[degrees]C for 3 min and cooling to 68[degrees]C for 15 min. For homozygous samples obtained from site-directed mutagenesis or for samples shown by DHPLC to contain one uniform sequence, equal amounts of the sample and wild-type PCR products were mixed (typically 10 [micro]L of each). DHPLC analysis was carried out using the WAVE[TM] DNA Fragment Analysis System (Transgenomic). The PCR mixture (5-10 [micro]L; homoduplexes and heteroduplexes) was loaded on a preheated [C.sub.18] reversed-phase column based on nonporous poly(styrene/divinylbenzene) particles (DNASepTM column; Transgenomic). Hetero- and homoduplexes were then eluted with a linear acetonitrile gradient formed by mixing buffer A (0.1 mol/L triethylamine acetate, pH 7.0; Transgenomic) and buffer B (0.1 mol/L triethylamine acetate, pH 7.0, containing 250 mL/L acetonitrile; Sigma) at a constant flow rate of 0.9 mL/min. DNA was detected at 260 nm. The analytical gradient was 3.5 min long, and buffer B was increased at 2%/min. For each fragment, the initial and final concentrations of buffer B were adjusted to obtain a retention time between 3 and 5 min. Running temperatures and gradient ranges are listed in Table 3. Between samples, the column was cleaned with 100% buffer B for 30 s and equilibrated at starting conditions for 2 min.

Results

PCR PRIMERS AND THEORETICAL MELTING CHARACTERISTICS OF THE HFE CODING REGION

For DNA scanning methods based on temperature denaturing conditions, such as denaturing gradient gel electrophoresis or DHPLC, detection of all mutations is most reliable when, in each amplified fragment, little difference exists between melting domains. PCR primers were thus designed in two ways: (a) to include each HFE coding fragment and its exon-intron junctions; and (b) to give the smallest differences possible between the melting domains in the fragment. The melting characteristics of each HFE DNA coding fragment were predicted using Wavemaker[TM] software. This allowed us to design primers that produce fragments with uniform melting characteristics for exons 1, 2, 5, and 6. Despite the use of different primer combinations, distinct melting domains were found in exons 3 and 4 (data not shown). The sequence in the region containing by 170-300 of exon 3 melts at 64[degrees]C, whereas its 5' and 3' domains melt at lower temperatures (60 and 62[degrees]C, respectively). Exon 4 exhibits two distinct melting domains: a 3' GC-rich domain that melts at 63[degrees]C, and a 5' domain that melts at 61[degrees]C. In these conditions, all melting domains must be tested with at least one DNA variant to ensure that the entire DNA fragment is completely studied. This may involve performing DHPLC at two or more temperatures.

[FIGURE 1 OMITTED]

HFE MUTATIONS AND POLYMORPHISMS

The Wavemaker software gives a computer-assisted determination of melting profile and analytical conditions for each DNA fragment. Nevertheless, to achieve the maximum probability for detection of all mutations, DHPLC analytical conditions need to be optimized experimentally using positive controls. In this study, we tested the 17 known HFE mutations and 2 HFE polymorphisms, ATG -7T [right arrow] C and 636G [right arrow] C (V212V). The first polymorphism is located close to a coding sequence without mutations (exon 1), and the second is in the 5' melting domain of exon 4. The HFE mutations and polymorphisms are listed in Table 2. No mutations or polymorphisms have been reported in the short coding region of exon 6. For reference, we arbitrarily chose to create a guanine-to-adenine transition 18 nucleotides upstream of the translation stop codon (1236G [right arrow] A).

DHPLC ANALYSIS

The analytical conditions for each HFE coding fragment were established separately, based on its experimentally determined melting curve. The temperature giving 75% denaturation of wild-type DNA was first defined. We then performed a temperature titration in 1[degrees]C increments to screen 2[degrees]C above and below this point for detection of mutations. All HFE nucleotide substitutions and deletions, depending on their respective melting domain locations, were tested to find optimized running conditions (see Table 3). As predicted by its uniform computed melting characteristics, one temperature was sufficient to detect the seven mutations in exon 2. Testing for the 683G [right arrow] C transversion (V212V) showed that one temperature was enough to explore the 5' melting domain of exon 4, where the 683G [right arrow] C transversion is localized, as well as its 3' GC-rich melting domain, where the 814G [right arrow] T (V272L), the 829G [right arrow] A (E277K), and the 845G [right arrow] A (C282Y) nucleotide substitutions are localized. In contrast, as predicted by the existence of distinct melting domains in exon 3, two temperatures were necessary to detect the six mutations efficiently. In fact, for exon 3, all mutations could be detected at 63[degrees]C, but resolution of heteroduplexes from homoduplexes was better at 62 and 64[degrees]C. Fig. 1A displays the detection, at 62[degrees]C and 63[degrees]C, of the IVS3+IG [right arrow] T nucleotide substitution localized in the lower melting domain of exon 3, and Fig. 1B shows detection, at 63 and 64[degrees]C, of the 506G [right arrow] A (W169X) nucleotide substitution contained in its higher melting domain.

ACCURACY OF DHPLC FOR SCANNING THE HFE GENE FOR MUTATIONS

Analysis of 20 different PCR products, each containing known HFE sequences variations, consistently revealed an additional peak attributable to the reduced retention time of heteroduplex DNAs. As shown in Fig. 2, because of their differences in retention times, the H63D/wt, S65C/wt, H63D/S65C, and wt/wt genotypes could be identified unequivocally. To validate the DHPLC method with a large set of unknown samples, we blindly analyzed 100 DNA samples that we had previously genotyped for the C282Y (exon 4), H63D, and 565C (exon 2) mutations by PCR with restriction fragment length polymorphism analysis. Comparisons of the results demonstrated 100% concordance between the methods. We detected 15 C282Y homozygotes, 18 C282Y heterozygotes, 18 H63D heterozygotes, 6 565C heterozygotes, 25 wild-type homozygotes, and 12 C282Y/H63D, 5 C282Y/S65C, and 1 H63D/ 565C compound heterozygotes.

Discussion

Numerous techniques are now available for detecting the common C282Y and H63D HFE mutations. These include PCR with restriction fragment length polymorphism, PCR with sequence-specific primers, oligonucleotide ligation assay, allele-specific oligonucleotide hybridization, single-strand conformation polymorphism, heteroduplex analysis, DHPLC, and real-time fluorescence PCR (5,6,8,10-15). However, depending on the population studied, 4-35% of the cases presenting with the HC phenotype have at least one chromosome without these two common HFE mutations. The cause of HC in this group of probands could be explained by the allelic heterogeneity and the genetic heterogeneity of the disease. The recent identification of two mutations (Y250X and E60X) in the TFR2 gene of Italian hemochromatosis probands lacking HFE mutations (30) and the mapping of the juvenile hemochromatosis gene on 1821 (31) argue for the heterogeneity of the disease and indicate that mutations in genes other than HFE can be associated with hemochromatosis. In other respects, the recent description of nine novel HFE mutations in patients with a classic HC phenotype has demonstrated that the search for rare or private mutations in the whole HFE coding region may help explain the iron overload phenotype and confirm the diagnosis of HC. Moreover, once identified in HC probands, new HFE mutations can lead to the identification of related patients at risk to develop iron overload.

Disregarding systematic sequencing of PCR products, several techniques are currently available for gene mutation scanning (32, 33). The most frequently used are single-strand conformation polymorphism analysis (34) and denaturing gradient gel electrophoresis (35). Each has advantages and disadvantages. Single-strand conformation polymorphism analysis is relatively easy to perform but tends to lack sensitivity, especially with PCR products up to 200 bp. Denaturing gradient gel electrophoresis is highly reliable once the appropriate PCR primers and denaturing conditions have been developed, but it is labor-intensive and time-consuming. In this study, we evaluated DHPLC, a novel technique of mutation scanning based on the separation of heteroduplex PCR products from their corresponding homoduplexes, by reversed-phase liquid chromatography under partially denaturing conditions (27, 28). The major advantages of this method include the use of automated instrumentation, rapid analysis (~6 min per sample), low cost, and according to recent investigations, a high accuracy with 92.5-100% mutation detection (36-41).

[FIGURE 2 OMITTED]

The analytical conditions for each of the HFE DNA coding fragments were carefully determined through the combination of computer prediction of melting profiles and empirical data that used available or artificially created sequence variants. PCR primers were designed to amplify each HFE coding fragment with the smallest differences possible between predicted melting domains within the fragment. Using this strategy, we were able to find uniform melting characteristics for exons 1, 2, 5, and 6. This approach was facilitated by the amplification of small coding fragments (168-377 by in length), and therefore, the melting profiles were relatively simple. Its reliability was demonstrated by the detection of seven mutations in exon 2 using a single analysis temperature. When the melting profile for a specific sequence was more complex and two or more distinct melting domains remained, the choice of operating temperature was more critical. In exon 3, a 1[degrees]C change above and below the initial analysis temperature (63[degrees]C) had a dramatic effect on the separation of hetero- and homoduplexes for mutations localized in the domains with the higher and lower melting temperatures, respectively. These data confirm that to ensure that the entire DNA fragment is studied, each melting domain must be tested with at least one DNA sequence variant to find its optimized running conditions. One of the major advantages of DHPLC is that it is easy to test the same PCR product under several different running conditions.

DHPLC is a rapid and rather inexpensive method. The instrument is still costly, and the method requires optimization, which might be time-consuming and costly. On the other hand, if the method is performed daily to analyze several disease genes and once the DHPLC analytical conditions are defined, labor is limited and the cost per sample is low. Thus, the complete HFE coding sequence (six coding fragments) for 16 DNA samples (96 wells) can be studied in 1 day at a cost of US $10/sample (excluding labor costs). In comparison, systematic sequencing analysis of the six HFE coding exons for 16 DNA samples (96 reactions), using an ABI 310 automated sequencer, should require 3 days at a cost of US $95/ sample. Moreover, although DHPLC analysis reveals an additional peak in each of the 16 DNA samples, only one sequencing analysis would allow identification of the sequence variant in the targeted exon, which would add an extra cost of US $16/sample. Once the DHPLC analytical conditions are established, identification of samples with polymorphisms or mutations is straightforward. Our study demonstrates the high accuracy of DHPLC for scanning the HFE gene for the known mutations and polymorphisms. Because all predicted melting domains of the HFE coding region are investigated with at least one DNA sequence variant as reference, DHPLC also provides a high probability of detecting untested or unknown HFE mutations.

In conclusion, DHPLC is a rapid, economic, and accurate method for efficient scanning of the HFE gene in HC probands with at least one chromosome without an assigned mutation. The use of this method in other genetic disorders of iron metabolism, such as porphyria cutanea tarda, for which HFE mutations have been reported (20, 42,43) may also be envisaged. Once detected by DHPLC, the role of uncommon FIFE mutations in clinical interpretation may be complex. The nonsense, frameshift, and splice-site mutations that have a clear incidence on the FIFE protein amino acids sequence, and consequently on its structure and function, can be unequivocally associated with disease. On the other hand, missense mutations must be considered with more caution. To evaluate the implications of this type of mutation, sequence alignment can be carried out to determine whether the amino acid is preserved among different species. For a missense mutation found in several subjects, a simple way involves comparing its frequency in chromosomes of HC patients and control subjects. In a previous study, we reported that the S65C mutation was significantly enriched in HC chromosomes that carried neither the C282Y nor the H63D mutation and that, as with the H63D mutation, the 565C mutation could be another variant contributing to iron overload in mildly affected hemochromatosis subjects (18). To confirm the association of an interesting missense mutation, a functional assay should be performed as described previously for the C282Y and H63D mutations (44).

This work was supported financially by the Conseil Regional de Bretagne, by the Association Hemochromatose France, and by INSERM (CRI 96-07). We thank Prof. A. Piperno (Clinica Medica, Universita degli Studi di Milano-Biocca Gerardo, Monza, Italy) for provision of DNA samples.

References

(1.) Pietrangelo A. EASL International Consensus Conference on Haemochromatosis. J Hepatol 2000;33:485-504.

(2.) Worwood M. Genetics of haemochromatosis. Clin Haematol 1994;7:903-18.

(3.) Edwards CQ, Griffen LM, Goldgar D, Drummond C, Skolnick MH, Kushner JP. Prevalence of hemochromatosis among 11,065 presumably healthy blood donors. N Engl J Med 1988;318:1355-62.

(4.) Niederau C, Fisher R, Puerschel A, Stremmel W, Haeussinger D, Strohmeyer G. Long-term survival in patients with hereditary hemochromatosis. Gastroenterology 1996;110:1107-19.

(5.) Feder JN, Gnirke A, Thomas W, Tsuchihasdi Z, Ruddy DA, Basava A, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399-408.

(6.) Jaswinska EC, Cullen LM, Busfield F, Pyper WR, Webb SI, Powell LW. Haemochromatosis and HLA-H. Nat Genet 1996;14:249-51.

(7.) Jouanolle AM, Gandon G, Jezequel P, Blayau M, Campion ML, Yaouanq J. Haemochromatosis and HLA-H. Nat Genet 1996;14: 251-2.

(8.) Beutler E, Gelbart T, West C, Lee P, Adams M, Blackstone R, et al. Mutation analysis in hereditary hemochromatosis. Blood Cells Mol Dis 1996;31:187-94.

(9.) Mura C, Nousbaum JB, Verger P, Moalic MT, Raguenes 0, Mercier AY, Ferec C. Phenotype-genotype correlation in haemochromatosis subjects. Hum Genet 1997;101:271-6.

(10.) Guttridge MG, Carter K, Worwood M, Darke C. Population screening for hemochromatosis by PCR using sequence-specific primers. Genet Test 2000;4:111-4.

(11.) Simonsen K, Dissing J, Rudbeck L, Schwatz M. Rapid and simple determination of hereditary hemochromatosis mutations by multiplex PCR-SSCP: detection of a new polymorphic mutation. Ann Hum Genet 1999;63:193-7.

(12.) Park YW, Tan SL, Katze MG. Rapid genetic screening for hemochromatosis using automated SSCP-based capillary electrophoresis (SSCP-CE). Biotechniques 1999;26:1106-9.

(13.) Mangasser-Stephan K, Tag C, Reiser A, Gressner AM. Rapid genotyping of hemochromatosis gene mutations on the Light-Cycler with fluorescent hybridization probes. Clin Chem 1999;45: 1875-8.

(14.) Worwood M, Jackson HA, Feeney GP, Edwards C, Bowen DJ. A single tube heteroduplex PCR for the common HFE genotypes. Blood 1999;94:A405.

(15.) Kaler SG, Devaney JM, Pettit EL, Kirshman R, Marino MA. Novel method for molecular detection of the two common hereditary hemochromatosis mutations. Genet Test 2000;4:125-9.

(16.) Barton JC, Shich WWH, Sawada-Hirai R, Acton RT, Harmon L, Rivers C, Rothenberg BE. Genetic and clinical description of hemochromatosis probands and heterozygotes: evidence that multiple genes linked to the major histocompatibility complex are responsible for hemochromatosis. Blood Cells Mol Dis 1997;23: 135-45.

(17.) Carella M, D'Ambrossio L, Totaro A, Grifa A, Valentino MA, Piperno A, et al. Mutation analysis of the HLA-H gene in Italian hemochromatosis patients. Am J Hum Genet 1997;60:828-32.

(18.) Mura C, Raguenes 0, Ferec C. HFE mutation analysis in 711 hemochromatosis probands: evidence for S65C implication in mild form of hemochromatosis. Blood 1999;8:2502-5.

(19.) Barton JC, Sawada-Hirai R, Rothenberg BE, Ronald TA. Two novel missense mutations of the HFE gene (1105T and G93R) and identification of the S65C mutation in Alabama hemochromatosis probands. Blood Cells Mol Dis 1999;25:147-55.

(20.) de Villiers JNP, Hillermann R, Loubser L, Kotze MJ. Spectrum of mutations in the HFE gene implicated in haemochromatosis and porphyria. Hum Mol Genet 1999;8:1517-22.

(21.) Liechti-Gallati S, Varga D, Reichen J. Screening for hemochromatosis in Switzerland: detection of a new pathogenic mutation and two additional variants in exon 2 of the HFE gene. European Society of Human Genetics Meeting, May 29-June 1, 1999, Geneva, Switzerland. London: European Journal of Human Genetics, 1999:122.

(22.) Pointon JJ, Shearman JD, Merryweather-Clarke AT, Robson KJH. A single nucleotide deletion in the putative haemochromatosis gene in a patient who is negative for the C282Y and H63D mutations. International Symposium on Iron in Biology and Medicine, June 16-20, 1997, Saint-Malo, France. Oxford: Institute of Molecular Medicine, 1997:268.

(23.) Piperno A, Arosio C, Fossati L, Vigano M, Trombini P, Vergani A, Mancia G. Two novel missense mutations of the HFEgene in five unrelated Italian patients with hemochromatosis. Gastroenterology 2000;119:441-5.

(24.) Wallace DF, Dooley JS, Walker AP. A novel mutation of HFE explains the classical phenotype of genetic hemochromatosis in a C282Y heterozygote. Gastroenterology 1999;116:1409-12.

(25.) Bradbury R, Fagan E, Goodson S, Steer K, Payne SJ. New mutations in the HFEgene for haemochromatosis. J Med Genet 1999;36:S96.

(26.) Oberkanins C, Moritz A, de Villiers JNP, Kotze MJ, Kury F. A reverse-hybridization assay for the rapid and simultaneous detection of nine HFEgene mutations. Genet Test 2000;4:121-4.

(27.) Oefner PJ, Underhill PA. Comparative DNA sequencing by denaturing high-performance liquid chromatography (DHPLC). Am J Hum Genet 1995;Suppl 57:A266.

(28.) Oefner PJ, Underhill PA. DNA mutation detection using denaturing high-performance liquid chromatography (DHPLC). In: Boyle AL, ed. Current protocols in human genetics. New York: Wiley & Sons, 1998:7.10.1-7.

(29.) Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS. Touchdown PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res 1991;19:4008.

(30.) Roetto A, Camashella C, Cali A, De Gobbi M, Carella M, Majorano N, Totaro A. Mutations in transferrin receptor-2 in hemochromatosis type 3. Am J Hum Genet 2000;67(Suppl 2):A2159.

(31.) Roetto A, Alberti F, Daraio F, Cali A, Cazzola M, Totaro A, et al. Exclusion of ZIRTL as candidate gene of juvenile hemochromatosis and refinement of the critical interval on 1821. Blood Cells Mol Dis 2000;26:205-10.

(32.) Grompe M. The rapid detection of unknown mutations in nucleic acids. Nat Genet 1993;5:111-7.

(33.) Nolleau P, Wagener C. Methods for detection of point mutations: performance and quality assessment. Clin Chem 1997;43:111428.

(34.) Orita M, Iwahana H, Kanazama H, Hayashi K, Sekiya T. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A 1989;86:2766-70.

(35.) Myers RM, Maniatis T, Lerman LS. Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol 1987;155:501-27.

(36.) Gross E, Arnold N, Goette J, Schwarz-Boeger U, Kiechle M. A comparison of BRCA1 mutation analysis by direct sequencing, SSCP and DHPLC. Hum Genet 1999;105:72-8.

(37.) Arnold N, Gross E, Schwarz-Boeger U, Pfisterer J, Kiechle M. A highly sensitive, fast, and economical technique for mutation analysis in hereditary breast and ovarian cancers. Hum Mutat 1999;14:333-9.

(38.) Buyse IM, Fang P, Hoon KT, Amir RE, Zoghbi HY, Roa BB. Diagnostic testing for Rett syndrome by DHPLC and direct sequencing analysis of the MECP2 gene: identification of several novel mutations and polymorphisms. Am J Hum Genet 2000;67: 1428-36.

(39.) Liu W, Smith DI, Rechtzigel KJ, Thibodeau SN, James D. Denaturating high performance liquid chromatography (DHPLC) used in the detection of germline and somatic mutations. Nucleic Acids Res 1998;26:1396-400.

(40.) Dobson-Stone C, Cox RD, Lonie L, Southam L, Fraser M, Wise C, et al. Comparison of fluorescent single-strand conformation polymorphism analysis and denaturing high-performance liquid chro matography for detection of EXT1 and EXT2 mutations in hereditary multiple exostoses. Eur J Hum Genet 2000;8:24-32.

(41.) Benit P, Kara-Mostefa A, Berthelon M, Sengmany K, Munnich A, Bonnefont JP. Mutation analysis of the hamartin gene using denaturing high performance liquid chromatography. Hum Mutat 2000;16:417-21.

(42.) Bulaj ZJ, Phillips JD, Ajioka RS, Franklin MR, Griffen LM, Guinee DJ, et al. Hemochromatosis genes and other factors contributing to the pathogenesis of porphyria cutanea tarda. Blood 2000;95: 1565-71.

(43.) Santos M, Clevers HC, Marx JJM. Mutations of the hereditary hemochromatosis candidate gene HLA-H in porphyria cutanea tarda. N Engl J Med 1997;336:1327-8.

(44.) Feder JN, Penny DM, Irrinki A, Lee VK, Lebron JA, Watson N, et al. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Biochemistry 1998;95:1472-7.

(45.) Douabin V, Moirand R, Jouanolle A, Brissot P, Le Gall J, Deugnier Y, David V. Polymorphisms in the HFE gene. Hum Hered 1999; 49:21-6.

(46.) Henz S, Reichen J, Liechti-Gallati S. HLA-H gene mutations and haemochromatosis: the likely association of H63D with mild phenotype and the detection of S65C, a novel variant in exon 2 [Abstract]. J Hepatol 1997;26(Suppl 1):57.

GERALD LE GAC, [1,3] * CATHERINE MURA, [2,3] and CLAUDE FERECIC [1,3]

[1] Establissement Francais du Sang-Bretagne, [2] Universite de Bretagne Occidentale, and [3] Laboratoire de Genetique Moleculaire, INSERM (EMI-01 15), 46 Rue Felix Le Dantec, 29200 Brest, France.

* Address correspondence to this author at: EFS-Bretagne, 46 Rue Felix Le Dantec, 29200 Brest, France. E-mail gerald.legac@univ-brest.rr.

Received February 14, 2001; accepted June 21, 2001.
Table 1. Primer sequences, Mg[Cl.sub.2] concentrations,
and PCR product lengths for amplified HFE coding fragments
used in this study.

Exon Mg[Cl.sub.2], mm Product length, by

 1 1 168
 2 2 377
 3 1 371
 4 2 368
 5 2 234
 6 2 186

Exon 5' primer 3' primer

 1 cggagatttaacggggacgt tcgatttttccacccccgcc
 2 ggtgtgtggagcctcaacat agctctgacaacctcaggaa
 3 ggacctattcctttggttgca tccactctgccactagagta
 4 agttccagtcttcctggcaa agctcctggctctcatcagt
 5 gtgagatgaggatctgctct ggcagaggtactaagagact
 6 cctaggtttgtgatgcctct taggttcaactctctcctga

Table 2. HFE gene mutations and polymorphisms tested by DHPLC.

 Mutation Location Reference

-7T [right arrow] C 5' UTR (a) Douabin et al. (45)
157A [right arrow] G (V53M) Exon 2 de Villiers et al. (20)
175G [right arrow] A (V59M) Exon 2 de Villiers et al. (20)
187C [right arrow] G (H63D) Exon 2 Feder et al. (5)
193A [right arrow] T (S65C) Exon 2 Henz et al. (46)
203delT (V68delT) Exon 2 Liechti-Gallati et al. (21)
277G [right arrow] C (G93R) Exon 2 Barton et al. (19)
314T [right arrow] C (1105T) Exon 2 Barton et al. (19)
381A [right arrow] C (Q127H) Exon 3 de Villiers et al. (20)
478delC (P160delC) Exon 3 Pointon et al. (22)
502G [right arrow] C (E168Q) Exon 3 Oberkanins et al. (26)
502G [right arrow] T (E168X) Exon 3 Piperno et al. (23)
506G [right arrow] A (W169X) Exon 3 Piperno et al. (23)
IVS3+IG [right arrow] T Intron 3 Wallace et al. (24)
636G [right arrow] C (V212V) Exon 4 Bradbury et al. (25)
814G [right arrow] T (V272L) Exon 4 Worwood et al. (14)
829G [right arrow] A (E277K) Exon 4 Bradbury et al. (25)
845G [right arrow] A (C282Y) Exon 4 Feder et al. (5)
989G [right arrow] T (R330M) Exon 5 de Villiers et al. (20)
1027G [right arrow] A (b) Exon 6

(a) UTR, untranslated region.

(b) The 1027G [right arrow] A is an artificial sequence variant
created specifically for this study.

Table 3. DHPLC temperature and gradient conditions for
HFE coding fragments, with a flow rate of 0.9 mL/min and
buffer B increased at 2% per min.

 Acetonitrile
 gradient, % Retention
Exon T, [degrees]C buffer B time, min

 1 67 50-57 4.0
 2 61 58-65 4.0
 3 62 56-63 4.0
 3 64 55-62 4.0
 4 61 58-65 3.5
 5 59 53-60 4.0
 6 61 51-58 4.0
COPYRIGHT 2001 American Association for Clinical Chemistry, Inc.
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2001 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Molecular Diagnostics and Genetics
Author:Le Gac, Gerald; Mura, Catherine; Ferec, Claude
Publication:Clinical Chemistry
Date:Sep 1, 2001
Words:5273
Previous Article:Quantitative measurement of porphobilinogen in urine by stable-isotope dilution liquid chromatography-tandem mass spectrometry.
Next Article:Mitochondrial gene mutations in the [tRNA.sup.Leu(UUR)] region and diabetes: prevalence and clinical phenotypes in Japan.
Topics:


Related Articles
C282Y Mutation and Hepatic Iron Status in Hepatitis C and Cryptogenic Cirrhosis.
Hereditary hemochromatosis: genetic complexity and new diagnostic approaches.
Linked linear amplification for simultaneous analysis of the two most common hemochromatosis mutations.
Hereditary hemochromatosis since discovery of the HFE gene.
Identification of new mutations of the HFE, hepcidin, and transferrin receptor 2 genes by denaturing HPLC analysis of individuals with biochemical...
Improved molecular diagnosis of hereditary hemochromatosis using a DNA enzyme immunoassay.
Use of denaturing HPLC and a heteroduplex generator to detect the HFE C282Y mutation associated with genetic hemochromatosis.
LightCycler PCR assay for simultaneous detection of the H63D and S65C mutations in the HFE hemochromatosis gene based on opposite melting temperature...
Rapid genotyping of hemochromatosis gene mutations on the LightCycler with fluorescent hybridization probes.
Simple multiplex PCR for the simultaneous detection of the C282Y and H63D hemochromatosis (HFE) gene mutations.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters