Printer Friendly

Complete conservation of an immunogenic gene (lcr1) in Leishmania infantum and Leishmania chagasi isolated from Iran, Spain and Brazil.

Introduction

The leishmaniasis is a spectrum of diseases of humans and other mammals. The disease is caused by kinetoplastid flagellates of genus Leishmania (L.). Kala-azar is the visceral and most severe form of these diseases that leads to death if untreated. The yearly incidence of visceral leishmaniasis (VL) is 0.5 million cases (1,2). VL is currently sporadic in all 30 provinces of Iran and endemic in at least threee provinces of the country (3,4). In a year prospective survey in north-west Iran, the average incidence rate of infection was 2.8% per year with all ages equally at risk. One in 13 infections in children led to VL, and this ratio decreased significantly with age (5). The causative agents of VL are members of L. donovani complex, classified into four species: L. archibaldi, L. chagasi, L. donovani and L. infantum, distinguished by the vectors, reservoir host and in pathology (6). Leishmania strains isolated from kala-azar patients in Iran have been identified as L. infantum (3,7) which is the principal agent of the disease in animal reservoir hosts in different parts of Iran (8). L. chagasi is the usual causative agent of kala-azar in the Americas (9,10). The New World species Leishmania chagasi is now widely accepted to be a synonym of L. infantum; however, in recent work Latin American authors still consider these species to be distinct (11). Definitive proof that L. chagasi and L. infantum are synonymous is not yet established (12,13).

There is need for development of effective tools for detection, prevention and treatment of kala-azar (14). An important feature of a vaccine candidate, or component of a subunit vaccine against leishmaniasis is conservation of the molecule throughout different species and strains of the parasites. A molecule used as a diagnostic criterion either by serology or PCR, would have the same requirement. Thus, the question of whether L. infantum and L. chagasi are identical or distinct, and the degree of conservation of antigenic proteins across species and strains, has important implications for development of a new diagnostic test or vaccine. An important implication would be use of the results obtained from studies on one species to the other, if these two Leishmania species are identical. An example would be the possible use of LCR1 of L. chagasi as part of a protective vaccine against both L. chagasi and L. infantum. LCR1 was discovered from L. chagasi and has been shown to confer partial protection against L. chagasi in a mouse model15. An lcr1 homologue sequence has been reported from one strain of L. infantum (MCAN/ES/98/LLM-877), (GenBank Accession number: AM502245.1) from Spain. Whether LCR1 molecule is conserved in other strains of L. infantum remains to be studied. The aim of our study was to compare the sequence of /crl between an Iranian isolate of L. infantum and L. chagasi. For this purpose we determined lcr1 sequence in an Iranian isolate of L. infantum and compared it with homologous sequences from L. chagasi and L. infantum reported in GenBank.

Material & Methods

Parasite: Leishmania infantum MHOM/04/IR/IPI UN10 was isolated from a 1.5 yr old boy from Imam Khomeini Hospital in Tehran, Iran in 2004. Diagnosis of kala-azar was confirmed in this child by isolation of the parasite from bone marrow culture in NNN media. The isolate was stored in liquid nitrogen soon after isolation. The parasite was recovered from liquid nitrogen by thawing and culturing it in NNN media (16). Logarithmically growing parasites were harvested and washed by centrifugation in phosphate buffer saline (PBS) twice and were stored in aliquots of 100 x [10.sup.8] parasites (for DNA extraction) and 1 x [10.sup.9] parasites (for isoenzyme electrophoresis) in -70[degrees]C. The following reference strains were used in isoenzyme electrophoresis studies: L. major strain MRHO/IR/75/ER, L. tropica strain MHOM/SU/74/ K27, and L. infantum strain MHOM/TN/80/IPT1.

Isoenzyme e/ectrophoresis: Discontinuous vertical polyacrylamide gel electrophoresis (PAGE) and cellulose acetate were used for isoenzyme analysis of the isolate. About 1 x [10.sup.9] parasites were mixed with equal volumes of a hypotonic aqueous solution of enzyme stabilizer (1 mM EDTA, 1 mM [epsilon]-aminoncaproic acid, 1 mM dithiothreitol), frozen and thawed thrice. Soluble extract of lysed promastigotes was prepared by centrifugation at 30,000> g at 4[degrees]C for 30 min, and stored at -70[degrees]C until use. Four enzymes were used for analysis of isolates: malate dehydrogenase (MDH), malic enzyme (ME), glucose phosphate isomerase (GPI), superoxide dismutase (SOD) (17,18).

ITS1 sequencing: Genomic DNA was extracted by LiC1 extraction (19). The internal transcribed spacer 1 (ITS1) region was amplified using DNA extracted from parasite and ITS1 specific primers LITSR and L5.8S and analyzed by restriction fragment length polymorphism (RFLP) analysis using the restriction endonuclease HaeIII (20). PCR amplification of genomic DNA of L. infantum by ITS1 specific primers resulted in a sharp single band on agarose gel electrophoresis. The PCR product was directly sent for sequencing (Macrogene Company, Korea). Each PCR product was sequenced at least twice by ITS1 specific primers: once by forward primer (LITSR) and once by reverse primer (L5.8S). Nucleotide in each position was considered correct if two sequencing results (which were sequenced in opposite directions) confirmed each other.

Amplification of lcr1: Polymerase chain reaction (PCR) was performed in 200 [micro]1 thin wall tubes. Each reaction consists of 3 [micro]l genomic DNA (containing 6-8 ng DNA), 0.4 [micro]1 Taq DNA polymerase (5 units) (GenetBio Co., Korea), 1.5 [micro]1 of [MgCl.sub.2] (25 mM), 0.5 [micro]1 of dNTPs (10 mM) and 2.5 [micro]1 10 x PCR buffer (GenetBio Co., Korea), 0.125 [micro]1 of each forward and reverse primers (100 pmol/[micro]1). The primers flanked the reported antigenic fragment of lcr1 (21).

The sequences and names of forward and reverse primers were: 5'-TAGGGATCCCATGAGCTG GCCAAA-3' (named LCR1-F1) and 5' GTCGACAAGCTTACTCGAGGTCCT CGATGG 3' (named LCR1-R1), respectively. The primers included restriction sites (underlined) for BamHI (in lcr1-F1) and HindIII (in lcr1-R1). PCR was performed in thermocycler (Mastercycler gradient, Eppendorf Co., Hamburg, Germany) under the following program: 95[degrees]C for 2 min, 35 cycles of 95[degrees]C for 20 sec, 65.1[degrees]C for 30 sec, and 72[degrees]C for 1 min, and 72[degrees]C for 25 min. Great cares were taken to prevent contamination including using disposable tips and tubes and performance of the procedure under laminar air flow. Template negative tube was included in all runs and results were disregarded if template negative control showed any band (even faint) in agarose gel electrophoresis. All the PCR products were electrophoresed in 1% agarose gel.

Restriction fragment length polymorphism (RFLP): PCR product obtained by using primers specific for lcr1 was digested by restriction enzyme HaeIII (BsuRI) (Fermentas Co., Ontario, Canada) at concentration of10 unit/[micro]1 for 4 h at 37[degrees]C. The reaction was terminated on dry plate at 80[degrees]C for 20 min. The digested and undigested PCR products were electrophoresed in 1% agarose gel and their molecular weight were approximately determined using 1 Kb molecular weight marker (Fermentas Co., Ontario, Canada).

Sequencing of lcr1 through T/A cloning: Amplification of the lcr1 gene from L. infantum genomic DNA by lcr1 specific primers resulted in a major band of the expected molecular size (785 bp). The band was extracted from agarose gel using Silica Bead DNA Gel Extraction kit (Fermentas Co., Ontario, Canada). The gel extracted DNA fragments were cloned using the InsTA cloning kit (Fermentas Co., Ontario, Canada) according to the manufacturer's instructions. Briefly, gel extracted DNA fragment was ligated into pTZ57R plasmid and transformed into DH5[alpha] strain of Escherichia coli. Plasmids were prepared using the Accu Prep Plasmid Mini Extraction plasmid purification kit (Bioneer Co., Korea) according to the manufacturer's instructions. The DNA inserts were sequenced (Macrogene Company, Korea) at least twice using the forward and reverse plasmid specific primers. Nucleotide in each position was considered correct if the two sequencing results confirmed each other.

Cloning and sequencing of lcr1 by Pfu DNA polymerase: To determine whether the sequence variants were created during PCR due to Taq polymerase error, lcr1 was amplified from the parasite genomic DNA by Pfu DNA polymerase (Fermentas Co., Ontario, Canada) which exhibits 3'[right arrow]5' exonuclease (proof reading) activity according to manufacturer's instructions. PCR product of lcr1 was extracted from gel as mentioned above for T/A cloning. The PCR product was inserted into pRSET A plasmid (Invitrogen Co., Carlsbad, USA) by double digestion of both lcr1 PCR product and the plasmid, extraction of digested products from gel, and ligation of lcr1 into the plasmid by ligase (Fermentas Co., Ontario, Canada) according to manufacturer's instructions. The insert containing plasmid was transformed into TOP10F' E. coli (Invitrogen Co. Carlsbad, USA). The plasmid was purified from transformed bacteria, screened by colony PCR method (22) followed by digestion by HaeIII (Fermentas Co., Ontario, Canada) for finding plasmids with correct insert. Two plasmids containing lcr1 were sequenced by plasmid specific primers (Macrogen Company, Korea).

Results

Species identification by isoenzyme electrophoresis: The Leishmania isolate studied in the present report (MHOM/04/IR/IPI-UN10) was identified as L. infantum by isoenzyme electrophoresis. The isoenzyme profiles of this isolate were consistent with the profile of L. infantum strain MHOM/TN/80/IPT1. This conclusion was based on the isoenzyme profiles of four enzymes: malate dehydrogenase (MDH) (Fig. 1), malic enzyme (ME), glucose phosphate isomerase (GPI), and superoxide dismutase (SOD).

Species identification by ITS1 sequencing: The ITS1 of the Leishmania isolate studied in the present report was sequenced and submitted to GenBank (accession number GQ444144) (Fig. 2). The species of this isolate was confirmed to be L. infantum as its ITS1 is completely identical to ITS1 sequence located in chromosome 27 of L. infantum strain MCAN/ES/98/LLM-877 reported in GenBank (Accession No. AM502245.1). The ITS1 sequence of L. infantum MHOM/04/IR/IPI-UN10 (studied in the present study) was completely identical to ITS1 sequence of many L. chagasi strains, e.g. strain MHOM/BR/85/M9702 (Accession No. AJ000306).

RFLP of lcr1 sequence: PCR amplification of lcr1 fragment from L. infantum MHOM/04/IR/IPI-UN10 resulted in an amplicon with size of the expected 785 bp (Fig. 3). Digestion of lcr1 with HaeIII resulted in two bands of 631 and 142 bp long (and a 12 bp band that cannot be seen, due to its too short length in agarose gel) (Fig. 3). This restriction digestion pattern is consistent with the published lcr1 sequence of L. chagasi (23).

[FIGURE 1 OMITTED]

Lcr1 sequence: Plasmids containing lcr1 sequence obtained by T/A cloning method (PCR amplification was performed by taq DNA polymerase) were extracted from three different clones of the recombinant bacteria and sequenced using plasmid specific primers. These three lcr1 sequences were compared with the published sequence from lcr1 of L. chagasi (Fig. 4). Each of these three lcr1 sequences had 1-2 different nucleotides in comparison to lcr1 of L. chagasi. The difference in the nucleotides present in these clones was attributed to lack of proof reading of Taq DNA polymerase used for amplification. This conclusion is valid because each discordant nucleotide is only present in one clone and is absent in the other two clones. This is true for all nucleotide discrepancies observed between the three clones. In addition, sequences of two clones obtained by Pfu DNA polymerase confirmed the sequence concluded from the Taq-amplified sequences (Fig. 4). These data show that the sequence of lcr1 of the Iranian L. infantum is completely identical to lcr1 sequences of L. chagasi. The concluded sequence of lcr1 from L. infantum MHOM/04/IR/UN-10 was submitted to GenBank (Accession No. GQ850521.1) (Fig. 5), and was compared with lcr1 reported for L. chagasi and L. infantum in GenBank. Lcr1 sequence of our Iranian isolate is identical to lcr1 sequence ofL. chagasi and lcr1 sequence of L. infantum (Accession Nos. U23437.1 and AM502245.1 respectively).

[FIGURE 3 OMITTED]

Discussion

Sequence analysis of the Leishmania spp. genomes is leading to the conclusion that two Leishmania species causing visceral leishmaniasis, L. chagasi isolated from subjects in the New World and L. infantum derived from patient in the Old World, may be one and the same13. This implies that new diagnostic assays or vaccine candidates may exhibit identical efficacy for each of these species. Nonetheless, in advance of full agreement that these are indeed identical species, it is important to compare the nucleotide and protein sequences of genes and gene products chosen for clinical assay development. The purpose of this study was to assess the potential utility of the LCR1 protein for diagnosis of or immunization against visceral leishmaniasis caused by L. infantum in Iran. We, therefore, compared the sequence of lcr1 fragment in an Iranian isolate of L. infantum with the homologous regions from a Brazilian L. chagasi isolate (strain MHOM/BR/00/1669) and a Spanish L. infantum (MCAN/ES/98/LLM-877).

The data presented in this paper are novel; the first report about lcr1 from an Iranian L. infantum isolate. Our results showed that the ITS1 and the lcr1 sequences were identical among all three genomes (Iranian L. infantum, Spanish L. infantum, and Brazilian L. chagasi). This finding is in agreement with reports that L. infantum and L. chagasi are synonymous (12, 24-27).

Complete identity of the antigenic region of the LCR1 protein in isolates of L. infantum from different regions of the Old World (Iran and Spain) and with that of L. chagasi from Brazil (New World) is an important step in evaluation of this molecule for potential clinical use. The complete conservation of LCR1 indicates that LCR1 could be evaluated as a potential component of a subunit vaccine against VL. The next step will be to study immune response to LCR1 protein in human individuals exposed to L. infantum or L. chagasi in different countries. We propose that similar sequence evaluation in strains from diverse geographic regions be performed prior to testing antigenic peptides for their potential as protective vaccines.

References

(1.) Desjeux P. The increase in risk factors for leishmaniasis worldwide. Trans R Soc Trop Med Hyg 2001; 95: 239-43.

(2.) First WHO report on neglected tropical diseases: working to overcome the global impact of neglected tropical diseases. In: Crompton DWT, editor. Geneva, Switzerland: World Health Organization 2010; p. 91-6. Available from: http://www.who.int/neglected_diseases/ 2010report/en/.

(3.) Edrissian GhH, Nadim A, Alborzi AV, Ardehali S. Visceral leishmaniasis, the Iranian experience. Arch Iran Med 1998; 1: 22-6.

(4.) Mohebali M, Hajjaran H, Hamzavi Y, Mobedi I, Arshi S, Zarei Z, Akhoundi B, Naeini KM, Avizeh R, Fakhar M. Epidemiological aspects of canine visceral leishmaniasis in the Islamic Republic of Iran. Vet Parasitol 2005; 129: 243-51.

(5.) Davies CR, Mazloumi Gavgani AS. Age, acquired immunity and the risk of visceral leishmaniasis: a prospective study in Iran. Parasitology 1999; 119: 247-57.

(6.) Lainson R, Shaw JJ. Evolution, classification and geographical distribution. In: Peters W, Killick-Kendrick P, editors. The leishmaniasis in biology and medicine, v. I: Biology and epidemiology. London, UK: Academic Press 1987; p. 1-120.

(7.) Kazemi-Rad E, Mohebali M, Hajjaran H, Rezaei S, Mamishi S. Diagnosis and characterization of Leishmania species in giemsa-stained slides by PCR-RFLP. Iran J Public Health 2008; 41: 54-60.

(8.) Mohebali M, Edrissian GhH, Nadim A, Hajjaran H, Akhoundi B, Hooshmand B, et al. Application of direct agglutination test (DAT) for the diagnosis and seroepidemiological studies of visceral leishmaniasis in Iran. Iran J Parasitol 2006; 1: 15-25.

(9.) Grimaldi G, Tesh RB. Leishmaniases of the New World: current concepts and implications for future research. Clin Microbiol Rev 1993; 6: 230-50.

(10.) Berman J. Visceral leishmaniasis in the New World and Africa. Indian J Med Res 2006; 123: 289-94.

(11.) Gramiccia M, Gradoni L. The current status of zoonotic leishmaniases and approaches to disease control. Int J Parasitol 2005; 35: 1169-80.

(12.) Kuhls K, Mauricio IL, Pratlong F, Presber W, Schonian G. Analysis of ribosomal DNA internal transcribed spacer sequences of Leishmania donovani complex. Microbes Infect 2005; 7: 1224-34.

(13.) Shaw JJ. Further thoughts on the use of the name Leishmania (Leishmania) infantum chagasi for the aetiological agent of American visceral leishmaniasis. Mem Inst Oswaldo Cruz 2006; 101: 577-9.

(14.) Roberts MT. Current understandings on the immunology of leishmaniasis and recent developments in prevention and treatment. British Med Bull 2006; 75-76: 115-30.

(15.) Streit JA, Recker TJ, Donelson JE, Wilson ME. BCG expressing LCR1 of Leishmania chagasi induces protective immunity in susceptible mice. Exp Parasitol 2000; 94: 33-41.

(16.) Mahmoudzadeh-Niknam H. Induction of partial protection against Leishmania major in BALB/c mice by Leishmania tropica. Scand J Lab Anim Sci 2004; 31: 201-7.

(17.) Tashakori M, Ajdary S, Kariminia A, Mahboudi F, Alimohammadian MH. Characterization of Leishmania species and L. major strains in different endemic areas of cutaneous leishmaniasis in Iran. Iran Biomed J 2003; 7: 43-50.

(18.) Hatam GR, Hosseini SMH, Ardehali S. Isoenzyme studies in characterization of Leishmania isolated in Iran. Iran J Med Sci 1999; 24: 8-13.

(19.) Medina-Acosta E, Cross GA. Rapid isolation of DNA from trypanosomatid protozoa using a simple 'mini-prep' procedure. Mol Biochem Parasitol 1993; 59: 327-9.

(20.) el Tai NO, Osman OF, el Fari M, Presber W, Schonian G. Genetic heterogeneity of ribosomal internal transcribed spacer in clinical samples of Leishmania donovani spotted on filter paper as revealed by single-strand conformation polymorphisms and sequencing. Trans R Soc Trop Med Hyg 2000; 94: 575-9.

(21.) Wilson ME, Young BM, Andersen KP, Weinstock JV, Metwali A, Ali KM, et al. A recombinant Leishmania chagasi antigen that stimulates cellular immune responses in infected mice. Infect Immun 1995; 63: 2062-9.

(22.) Sambrook J, Russell D. Molecular cloning: a laboratory manual, III edn. New York: Cold Spring Harbor Laboratory 2001; p. 8.72-8.76.

(23.) Rioux JA, Lanotte G, Serres E, Pratlong F, Bastien P, Perieres J. Taxonomy of Leishmania. Use of isoenzyme. suggestions for a new classification. Ann Parasitol Hum Comp 1990; 65: 111-25.

(24.) Cupolillo E, Grimaldi G Jr, Momen H. A general classification of New World Leishmani using numerical zymotaxonomy. Am J Trop Med Hyg 1994; 50: 296-311.

(25.) Mauricio IL, Stothard JL, Miles MA. The strange case of Leishmania chagasi. Parasitol Today 2000; 16: 188-9.

(26.) Mauricio IL, Howard MK, Stothard JR, Miles MA. Genetic diversity in the Leishmania donovani complex. Parasitol 1999; 119: 237-46.

(27.) Mauricio IL, Gaunt MW, Stothard JR, Miles MA. Genetic typing and phylogeny of the Leishmania donovani complex by restriction analysis of PCR amplified gp63 intergenic regions. Parasitol 2001; 122: 393-403.

H. Mahmoudzadeh-Niknam [a], F. Abrishami [a], M. Doroudian [a], M. Moradi [a], M.H. Alimohammadian [a] & P. Parvizi [b]

[a] Department of Immunology; [b] Department of Parasitology, Pasteur Institute of Iran, Tehran, Iran

Corresponding author: Dr Hamid Mahmoudzadeh-Niknam, Department of Immunology, Pasteur Institute of Iran, Tehran 13164, Iran.

E-mail: mahmoudzadehh@yahoo.com; mahmoudh@pasteur.ac.ir

Received: 30 May 2010

Accepted in revised form : 23 October 2010
Fig. 2: ITS1 containing sequences in L. infantum isolate
MHOM/IR/04/IPI-UN10 (GenBank Accession: GQ444144.1). Genomic DNA
of L. infantum was amplified by ITS1 specific primers and the PCR
product was directly sequenced. Each PCR product was sequenced at
least twice (from opposite directions).

  1     ctggatcatt     ttccgatgat     tacacccaaa
 61     tatatatgta     ggcctttccc     acatacacag
121     aaaaaggccg     atcgacgtta     taacgcaccg
181     caaaaaatat     acggcgtttc     ggtttttggc
241     cataacgtgt     cgcgatggat     gacttggctt
301     gataagtggt     atca

  1     aaacatatac     aactcgggga     gacctatgta
 61     caaagttttg     tactcaaaat     ttgcagtaaa
121     cctatacaaa     agcaaaaatg     tccgtttata
181     ggggtgggtg     cgtgtgtgga     taacggctca
241     cctatttcgt     tgaagaacgc     agtaaagtgc
301

Fig. 4: Lcr1 nucleotide differences between 5 clones obtained from
the Iranian L. infantum and the reported L. chagasi in GenBank. PCR
amplification was performed by Taq or Pfu DNA polymerases for the
indicated clones. The rest of nucleotides in the 785 nucleotide span
of lcr1 were identical in all five clones of the Iranian L. infantum
and L. chagasi.

                                Enzyme used for         Position
Sequence origin                  amplification            254

Clone No. 4                    Taq DNA polymerase          A
Clone No. 6                    Taq DNA polymerase          G
Clone No. 3                    Taq DNA polymerase          G
Clone No. 2                    Pfu DNA polymerase          G
Clone No. 16                   Pfu DNA polymerase          G
L. chagasi (GenBank
  Accession No. U23437.1)             --                   G

                              Position     Position     Position
Sequence origin                 312          396          691

Clone No. 4                      G            A            C
Clone No. 6                      A            A            T
Clone No. 3                      G            G            T
Clone No. 2                      G            A            T
Clone No. 16                     G            A            T
L. chagasi (GenBank
  Accession No. U23437.1)        G            A            T

Fig. 5: Lcr1 sequence of L. infantum isolate MHOM/IR/04/IPI-UN10
(GenBank Accession: GQ850521.1).

  1     cccatgagct     ggccaaagtc     gaactggcga
 61     agggcgtgcc     actggcggac     ctcccgctca
121     agcagcgtca     ggcgctgaag     aacaccagga
181     aggagaggat     gaacgaccgt     gtccacgaca
241     gctacctgaa     cccggagccg     cagaatgtac
301     cgatcttccg     cgaaatggag     aacgagctgt
361     cgggcaagat     tgcagagctg     caggacgacc
421     acctacggcg     caaggagctt     gctaatcagg
481     agctgccact     caactacgac     ccgatcctca
541     agaaaaaccc     gaagcggaat     gccgatgtgc
601     gcatcgatga     catcgcgcgc     gactttctgg
661     cggagggggt     gcaattggag     cgcctgccgc
721     agagggacct     gcgcgcgctg     aagaagcaac
781     tcgag

  1     aggaccgtgc     cttcctcgac     cctgagccgg
 61     gcgacgaccc     ggagttcaac     gtactggcga
121     ggggccgcga     ccccgaaatg     aaggacctgg
181     tcgcaaggga     gttcctcagc     aagcaccgcg
241     ccattgccga     catccccctc     aaccgcgacc
301     tgaaggctat     gaaggacccc     cgcagcaatg
361     tcaacaaccg     cgcagacgac     ctcgcgaagg
421     agcaggagcc     tctcggcgtg     ccgctggaag
481     atccactgga     acgcaagcgc     cgcgacatca
541     tgcgcaacct     cgagcgggag     atcgccgcgc
601     cgaaggagcg     tgctttcctg     gaccaggaac
661     tgtcagatga     cagggagttt     cacgaaatgg
721     cagcaaagaa     cagggacgcc     atcgaggacc
781
COPYRIGHT 2010 Indian Council of Medical Research
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2010 Gale, Cengage Learning. All rights reserved.

 
Article Details
Printer friendly Cite/link Email Feedback
Author:Mahmoudzadeh-Niknam, H.; Abrishami, F.; Doroudian, M.; Moradi, M.; Alimohammadian, M.H.; Parvizi, P.
Publication:Journal of Vector Borne Diseases
Article Type:Report
Geographic Code:1CANA
Date:Dec 1, 2010
Words:3549
Previous Article:Climate indices, rainfall onset and retreat, and malaria in Nigeria.
Next Article:Molecular epidemiology of Crimean-Congo hemorrhagic fever virus genome isolated from ticks of Hamadan province of Iran.
Topics:

Terms of use | Privacy policy | Copyright © 2018 Farlex, Inc. | Feedback | For webmasters