Printer Friendly

Comparison of methods for the extraction of genomic DNA from aerobic digest.

ABSTRACT

Aerobic digest represents a complex microbial community generated by the wastewater treatment process. The development of culture-independent based methods, such as PCR, for detecting microbial pathogens, population monitoring, and tracking of problematic species is dependent upon the isolation of genomic DNA that contains target sequences of sufficient quality and quantity and is free from organic contaminants. Aerobic digest, like soil, contains a concentrated amount of microbial cells in addition to organic pollutants. This study examined several genomic DNA extraction methods to determine which will provide a DNA product free from humic acid contamination and of sufficient quantity to be detected by gel electrophoresis and ethidium bromide staining. Seven genomic DNA extraction methods were tested with four methods (Wizard[R] Genomic DNA purification, UltraClean[TM] Microbial DNA Isolation, UltraClean[TM] Fecal DNA, and UltraClean[TM] Mega Soil kits) yielding genomic DNA detectable by ethidium bromide gel electrophoresis. 16S rDNA was amplified using the UltraClean[TM] Fecal DNA samples. The successful PCR reaction used GoTaq[R] Green polymerase and 45 rounds of amplification. The development of a successful PCR reaction now allows for specific organisms of interest (e.g., pathogens or known sludge bulking species) to be detected early and monitored throughout the aerobic digestion process.

INTRODUCTION

Aerobic digest represents a complex microbial community collected from domestic, industrial and municipal waste streams and generated by the wastewater treatment process itself. A first step to studying this complex community is genomic DNA isolation. However, the majority of microbial species cannot be grown according to current cultivation practices (Kepner, 1994). Once genomic DNA has been isolated, then specific organisms, families, phyla, or domains may be monitored for changes throughout the aerobic digestion process.

Because greater than 90% of bacterial species within a natural sample are noncultival, the only means of studying these organisms and their community interactions is through their genetic or protein material (Atlas and Bartha, 1997). Genetic probes and microarrays can be developed to determine the presence, absence, or activation of particular genes within a community at either the community level, family level, genus level, or species level (Spano et al., 2005; Siripong et al., 2006). Probes or polymerase chain reaction (PCR) primers can be developed to determine the presence and abundance of species of interest (Dar et al., 2005). However, before the development of probes and tests for the rapid detection of species of concern can be developed, genetic material must be isolated. While there are many protocols that describe DNA isolation from water, soil (Tsai and Olson, 1991), and wastewater (Dar et al., 2005; Spano et al., 2005; Park et al., 2006; Siripong et al., 2006; Lachmayr et al., 2009), most of these protocols fail to isolate a usable DNA product from aerobic digest. During recent years, several groups have investigated the microbial community of activated sludge, an upstream process in wastewater treatment, by using molecular methods such as ribosomal RNA (rRNA) combined with fluorescent in situ hybridization (FISH) (Wagner et al., 1993; 1994a; 1994b; 1995), 16S ribosomal DNA (rDNA) extraction followed by cloning (Snaidr et al., 1997; Layton et al., 2000), or gradient gel electrophoresis. The common attribute of each of these studies was that they involved the successful manipulation of genetic material.

There are several barriers to the manipulation of genetic material including, lack of DNA or RNA isolation or poor yield from isolation protocols, degraded genomic material, and the contamination of genetic samples with enzyme inhibitors (McPherson et al., 1995). Genetic material is usually extracted from bacterial cells either by chemical lysis (Symonds et al., 2009), physical disruption (Layton et al., 2000; Dar et al., 2005; Spano et al., 2005; Park et al., 2006; Siripong et al., 2006) of the cell wall, or a combination of chemical lysis and physical disruption of the cell wall (Lachmayr et al., 2009). Depending on cell wall composition and structure, chemical lysis of bacterial cells may produce a lower DNA or RNA yield. Isolation protocols that use high-speed centrifugation or excessive vortexing may sheer DNA, thus disrupting potential PCR amplification targets. Extraction protocols that do not use filters may allow the coprecipitation of humic compounds along with DNA or RNA. Humic compounds often act as inhibitory compounds to enzymatic processes such as PCR (Atlas and Bartha, 1997).

The purpose of this study was to test seven commercially available genomic DNA isolation kits and methods to determine which would yield genomic DNA that could be easily detected by ethidium bromide gel electrophoresis and amplified by 16S rDNA PCR. The isolation of a genomic DNA product free from humic substances is a likely candidate for PCR amplification. Development or selection of a protocol that provides genomic DNA of sufficient quantity to detect by ethidium bromide staining and gel electrophoresis and is usable for downstream applications such as PCR will allow for the tracking and enumerating of species of interest within the aerobic digest community.

MATERIALS AND METHODS

Cultures

Escherichia coli and Serratia marcescens were used as pure culture controls for each isolation protocol. Each culture was grown overnight at 37 [degrees]C in nutrient broth (8.0 g nutrient broth [Difco] per 1000 ml distilled water). Aerobic digest influent and effluent samples were collected from the Five Mile Creek Wastewater treatment facility in Birmingham, AL. These were maintained at -20 [degrees]C until 24 h prior to use; then samples were transferred to 4 [degrees]C to thaw completely before use.

Modified Wizard Kit

Genomic DNA was isolated using the Wizard[R] Genomic DNA Purification kit [Promega]. One ml of each sample was transferred to a sterile 1.5 ml microcentrifuge tube [Fisher] and mixed with 600 [micro]l of Lysis Solution (120 [micro]l 0.5 M EDTA [Promega] and 500 [micro]l Nuclei Lysis Solution [Promega]) and 200 [micro]1 Proteinase K (20 mg ml-1 [Fisher]). Samples were incubated at room temperature (21 [degrees]C) for 96 h with continuous agitation. After incubation, 3 [micro]l RNase Solution [Promega] was added to each sample and incubated for 1 hr at 37 [degrees]C in a dry bath incubator. Samples were cooled to room temperature for 5 min before 200 [micro]l Protein Precipitation Solution [Promega] was added; samples were then mixed by inversion and incubated for 5 min at 4 [degrees]C. Proteins were cleared from each sample by centrifugation (4 min at 10 000 rpm [Eppendorf model 5424]). The supernatant was transferred to a sterile microcentrifuge tube, and 600 [micro]l isopropanol [Fisher] was added to each sample. The samples were inverted to mix, and DNA was precipitated overnight at -20 [degrees]C. Each sample was split into aliquots of 450 [micro]l sample, and 600 [micro]l isopropanol was again added to samples. The samples were incubated overnight at -20 [degrees]C to precipitate DNA. The samples were centrifuged at 12 000 rpm for 2 min at room temperature to collect genomic DNA. The isopropanol supernatant was decanted and discarded, and the DNA pellet was washed in 200 [micro]l 80 % ethanol (80 ml ethanol [Fisher], 200 ml distilled water). The samples were centrifuged at room temperature at 12 000 rpm for 2 min to collect genomic DNA. The supernatant was decanted and discarded, and the genomic DNA pellet was allowed to air dry overnight at room temperature before resuspending in 25 [micro]l DNA rehydration solution (10 mM Tris, 1 mM EDTA [Promega]). Like samples were pooled and stored at -20 [degrees]C until used.

Modified Activated Sludge Genomic DNA Extraction Protocol

Genomic DNA was extracted from each sample using the protocol described by Watanabe et al. (1998). One ml of each culture was mixed with 100 [micro]l cell dispersion solution (18.40 g sodium tripolyphosphate [Fisher] per liter DDI H20) and mixed by vortexing at maximum speed using a Vortex Genie 2 [Fisher]. Dispersed cells were centrifuged for 6 min at 6000 rpm [Eppendorf model 5424] to collect cells. Supernatant solution was carefully decanted and discarded, and the cell pellet was resuspended in 250 [micro]l cell suspending buffer (10 mM Tris HC1 pH 8.0 [Fisher], 1 mM EDTA pH 8.0 [Fisher], 0.35 M sucrose [Fisher] per liter DDI H20) and 250 [micro]l lysozyme (20 mg ml-1 [Fisher]) and incubated at 37 [degrees]C for 10 min. To each sample, 375 [micro]l cell lysis solution [Promega] was added and mixed by inversion before incubating for 30 min at 55 [degrees]C. Four rounds of phenol-chloroform (24:25 v / v [Fisher, Fisher]) extraction were carried out with the phenol layer being transferred to a clean 1.5 ml microcentrifuge tube [Fisher] with each extraction. After the fourth round of phenol-chloroform extraction, 500 [micro]l isopropanol [Fisher] was added to each tube and incubated overnight at -20 [degrees]C. Nucleic acids were collected by centrifugation at 12 000 rpm for 5 min at room temperature. The supernatant was decanted and discarded, and the nucleic acid pellet was washed in 500 [micro]l 80 % ethanol (80 ml ethanol [Fisher], 20 ml distilled water). The samples were mixed by inversion, incubated for 5 min at room temperature and centrifuged at 12 000 rpm for 2 min at room temperature. The supernatant was decanted and discarded, and the nucleic acid pellet was air dried overnight at room temperature to evaporate any remaining ethanol from the samples. The nucleic acid pellet was resuspended in 250 [micro]l TE buffer (80 mL 100 mM Tris-HCl [Fisher], 8 ml 100 mM EDTA [Fisher] per liter H20) and incubated at 37 [degrees]C for 1 hr before adding 10 [micro]l RNase solution [Promega] to each sample and incubating overnight at 30 [degrees]C to degrade RNA. Like samples were pooled and stored at -20 [degrees]C until used.

PowerSoil[TM] DNA Isolation kit (MO BIO Laboratories, Inc.)

One ml of each culture was used to obtain genomic DNA according to the protocol prescribed by the manufacturer. Cultures were added to a Power Bead tube containing 60 [micro]l Solution CI [MO BIO] and mixed for 10 min using a vortex machine set to high (level 10 on Vortex Genie [Fisher]). The samples were centrifuged for 30 sec at room temperature at 10 000 rpm [Eppendorf model 5424] to collect beads. The supernatant (500 [micro]l) from each sample was transferred to a clean 2 ml microcentrifuge tube [MO BIO], mixed with 250 [micro]l Solution C2 [MO BIO] by vortex for 5 sec at room temperature and incubated 5 min at 4 [degrees]C. The samples were centrifuged for 1 min at room temperature at 10 000 rpm. The supernatant (600 [micro]l) was transferred to a clean 2 ml centrifuge tube, and 200 [micro]l Solution C3 [MO BIO] was added to each sample. The samples were mixed by vortex and incubated for 5 min at 4 [degrees]C to precipitate proteins. Each sample was centrifuged for 1 min at room temperature at 10 000 rpm to clear the supernatant. For each sample, 700 [micro]l of cleared supernatant was transferred to a new microcentrifuge tube and mixed with 1200 [micro]l Solution C4 [MO BIO] by vortex for 5 sec at room temperature. In aliquots of 675 [micro]l, samples were added to a spin filter and centrifuged at 10 000 rpm for 1 min at room temperature. After centrifugation, the spin filter flow through was discarded. After all samples had been processed, 500 [micro]l Solution C5 [MO BIO] was added to each spin filter and centrifuged for 30 sec at 10 000 rpm. Spin filters were dried by centrifugation for 1 min at 10 000 rpm at room temperature. Spin columns were transferred to a clean 2 ml microcentrifuge tube, and 100 [micro]l Solution C6 [MO BIO] was added to each spin column before centrifuging for 30 sec at 10 000 rpm at room temperature to elute DNA. Like samples were pooled and stored at -20 [degrees]C until used.

UltraClean[TM] Microbial DNA Isolation Kit (MO BIO Laboratories, Inc.)

Each culture (1.8 ml) was added to a 2 ml collection tube and centrifuged [Eppendorf model 5424] at 12 000 rpm for 30 sec at room temperature to collect bacterial cells or biosolids. The supernatant was decanted and discarded, and the cell pellet was resuspended in 300 [micro]l of MicroBead Solution [MO BIO] before transferring to a MicroBead tube [MO BIO]. Solution MD1 (50 [micro]l [MO BIO]) was added to each sample, and samples were incubated at 70 [degrees]C for 10 min to facilitate cell lysis. The samples were vortexed for 10 min at room temperature at high speed (level 10 on Vortex Genie) [Fisher] to physically lyse cells. MicroBeads were collected by centrifugation at room temperature for 30 sec at 12 000 rpm. The supernatant was transferred to a clean 2 ml collection tube, and 100 [micro]l Solution MD2 [MO BIO] was added to each sample and mixed by vortexing for 5 sec at room temperature. Samples were incubated for 5 min at 4 [degrees]C to precipitate proteins and centrifuged at 12 000 rpm at room temperature for 1 min to clear proteins. Cleared supernatant (approximately 450 [micro]l) was transferred to a new 2 ml microcentrifuge tube and mixed with 900 [micro]l Solution MD3. Samples were mixed by vortex for 5 sec at room temperature before loading in aliquots of 700 [micro]l onto a spin filter [MO BIO]. Each sample was processed by centrifuging for 30 sec at room temperature at 12 000 rpm with the sample flow through being discarded after each round of centrifugation. After the entire sample had been processed, 300 [micro]l Solution MD4 [MO BIO] was added to each spin filter and centrifuged for 30 see at 12 000 rpm at room temperature. The flow through was discarded, and the spin filter was dried by centrifugation for 1 min at 12 000 rpm at room temperature. Spin filters were transferred to new 2 ml microcentrifuge tubes, and DNA was eluted from each spin filter using 50 [micro]l Solution MD5 [MO BIO] and centrifuged at 30 sec at 12 000 rpm at room temperature. Like samples of genomic DNA were pooled and stored at -20 [degrees]C until used.

UltraClean[TM] Fecal DNA Kit (MO BIO Laboratories, Inc.)

The samples were processed according to manufacturer's directions. Two hundred-fifty [micro]l (approximately 0.25 g) of each sample was added to a clean 2 ml Fecal Dry Bead tube [MO BIO] and mixed with 550 [micro]l Fecal Bead Solution [MO BIO]. The samples were mixed by gently vortexing at room temperature for 5 sec using a Vortex Genie [Fisher]. Solution S1 (60 [micro]l [MO BIO]) was added to each solution and mixed by inversion. To degrade humic substances, 200 [micro]l Solution IRS was added to each sample, as genomic DNA would be used in PCR. The samples were vortex ted at maximum speed (level 10) for 10 min at room temperature to physically disrupt cell walls. Beads were collected after vortexing by centrifuging [Eppendorf model 5424] samples at 12 000 rpm for 30 sec at room temperature. The supernatant was transferred to a clean microcentrifuge tube [MO BIO] and mixed with 250 [micro]l Solution S2 by vortexing for 5 sec at room temperature. The samples were incubated for 5 min at 4 [degrees]C to precipitate proteins. Proteins were cleared by centrifugation for 1 min at 12 000 rpm at room temperature. For each sample, 450 [micro]l of cleared supernatant were transferred to a clean microcentrifuge tube and mixed with 900 [micro]l Solution S3 [MO BIO] by vortex for 5 sec at room temperature. Samples were processed in aliquots of 700 [micro]l by loading samples onto spin filters [MO BIO] and centrifuging for 1 min at room temperature at 12 000 rpm. The flow through was discarded. After the final aliquots of samples were processed, 300 [micro]l Solution S4 [MO BIO] was added to each sample and centrifuged for 30 sec at 12 000 rpm at room temperature. The flow through was discarded, and the spin filters were dried by centrifugation for 1 min at 12 000 rpm at room temperature. The spin filters were transferred to a new 2 ml microcentrifuge tube, and DNA was eluted by adding 50 [micro]l Solution S5 [MO BIO] to each spin filter and centrifuging for 30 sec at room temperature at 12 000 rpm. Like samples of genomic DNA were pooled and stored at -20 [degrees]C until used.

UltraClean[TM] Mega Soil DNA Kit (MO BIO Laboratories, Inc.)

The manufacturer's protocol was modified to process a smaller sample as described below. For each sample, 500 [micro]l culture was added to approximately 500 [micro]l dry beads [MO BIO] and 800 [micro]l Bead Solution [MO BIO]. The samples were vigorously mixed for 1 min using a Vortex Genie [Fisher]. To each sample, 200 [micro]l Solution S1 [MO BIO] was added and mixed by vigorous vortexing for 30 sec at room temperature. Solution IRS (300 [micro]l [MO BIO]) was added to each sample as isolated genomic DNA would be used in PCR amplification. The samples were vortexed on high speed (level 10) at room temperature for 10 min before beads were collected by centrifugation [Eppendorf model 5424] at 12 000 rpm for 30 sec at room temperature. Supernatant was transferred to a clean microcentrifuge tube [MO BIO] and mixed by inversion with 100 [micro]l Solution S2 [MO BIO]. The samples were incubated at 4 [degrees]C for 5 min to precipitate proteins. Proteins were cleared by centrifugation for 1 min at 12 000 rpm at room temperature. Cleared supernatant (approximately 500 [micro]l) was transferred to a clean microcentrifuge tube and mixed with 900 [micro]l Solution S3 [MO BIO]. The samples were processed onto a minicolumn [Promega Wizard SV[TM]] in aliquots of 700[micro]l by centrifugation at 12 000 rpm at room temperature for 30 sec. The minicolumn flow through was discarded. After all aliquots had been processed, 300 [micro]l Solution S4 [MO BIO] was added to each minicolumn and centrifuged at room temperature for 30 sec at 12 000 rpm. The flow though was discarded, and the minicolumn was dried by centrifugation at 12 000 rpm for 1 min at room temperature. The minicolumn was transferred to a clean 1.5 ml microcentrifuge tube [Fisher], and 50 [micro]l Solution S5 [MO BIO] was added to each column to elute genomic DNA by centrifugation at 12 000 rpm for 30 sec at room temperature. Like samples of genomic DNA were pooled and stored at -20 [degrees]C until used.

PowerMax[TM] Soil DNA Isolation Kit (MO BIO Laboratories, Inc.)

The manufacturer's protocol was modified to process a smaller sample as described below. For each sample 500 [micro]l culture, 500 [micro]l dry Power Beads [MO BIO] and 800 [micro]l Power Bead Solution [MO BIO] were added to a 2 ml microcentrifuge tube [Fisher]. The samples were gently vortexed using a Vortex Genie [Fisher] for 1 min at a low setting to thoroughly mix samples. Solution C1 (200 [micro]l, [MO BIO]) was added to samples, and samples were vortexed at the highest level (level 10) for 10 min at room temperature to physically lyse cells. Power Beads were collected by centrifugation [Eppendorf model 5424] at 12 000 rpm for 30 sec at room temperature. The supernatant (approximately 450 [micro]l) was transferred to a clean 1.5 ml microcentrifuge tube [Fisher] and mixed by inversion with 100 [micro]l Solution C2 [MO BIO]. The samples were incubated for 5 min at 4 [degrees]C to precipitate proteins before clearing proteins by centrifugation for 1 min at 12 000 rpm at room temperature. The supernatant (400 [micro]l) was transferred to a clean 1.5 ml microcentrifuge tube and mixed by inversion with 300 [micro]l Solution C4 [MO BIO]. The samples were processed onto a minicolumn [Promega Wizard SV[TM]] in aliquots of 700 [micro]l and centrifuged at 12 000 rpm for 30 sec at room temperature. The minicolumn flow through was discarded after each round of centrifugation. After the last aliquot was processed for each sample, 100 [micro]l Solution C5 [MO BIO] was added to minicolumns and centrifuged at 12 000 rpm for 30 sec at room temperature. The minicolumns were dried by centrifugation at 12 000 rpm for 1 min at room temperature. The minicolumns were transferred to a clean 1.5 ml microcentrifuge tube. To elute genomic DNA, 50 [micro]l Solution C6 [MO BIO] was added to each minicolumn and centrifuged at 12 000 rpm for 30 sec at room temperature. Like samples were pooled and stored at -20 [degrees]C until used.

Detection of Genomic DNA

To determine the presence of genomic DNA from each extraction method, 15 [micro]l of genomic DNA was mixed with 3 [micro]l 6 X loading dye solution (10 mM Tris-HC1 pH 7.6, 10 mM EDTA, 0.005 % bromophenol blue, 0.005 % xylene cyanol FF, and 10 % glycerol [Fermentas]). Eighteen [micro]l of each sample was run on a 0.8 % agarose [Fisher] gel in 1 X TAE buffer (40 mM Tris-acetate, 1 mM EDTA pH 8.3 [Sigma]) for 45 min at 120 V in an electrophoresis chamber [Fisher] at room temperature. Gels were stained in 0.5 [micro]g ml-1 ethidium bromide [MO BIO] staining solution (ethidium bromide in distilled water) for 30 min at room temperature. Gels were visualized using a UV light box [Fisher]. The presence of bands indicated that genomic DNA was of sufficient concentration to be detected by gel electrophoresis and ethidium bromide staining.

Amplification of Genomic DNA

A primer pair specific to the 16S rDNA region of domain bacteria was used to amplify a 1.5 Kb band for aerobic digest influent, aerobic digest effluent, and E. coli genomic DNA samples. Amplification was carried out according to the following reaction: 12.5 [micro]l 2 X GoTaq[R] Green Master Mix (GoTaq[R] DNA Polymerase, 2X Green GoTaq[R] Reaction Buffer pH 8.5, 400 [micro]M dATP, 400 [micro]M dGTP, 400 [micro]M dCTP, 400 [micro]M dTTP, 3 mM MgCl2 [Promega]), 0.625 [micro]l E8F (Baker et al., 2003) forward primer (sequence: 5' AGAGTTTGATCATGGCTCAG 3', 5 pmol [Integrated DNA Technologies]), 0.625 [micro]l 1492R reverse primer (sequence: 5'GGTTACCTTGTTACGACTT 3', 5 pmol [Integrated DNA Technologies]), 11.0 [micro]l nuclease free H2O [Promega], and 0.25 [micro]l template DNA (diluted 1:5 with nuclease free H2O or undiluted) to make a final volume of 25.0 [micro]l. A water negative and Pseudomonas aeruginosa genomic DNA sample were amplified to ensure that reagents were not contaminated and that PCR was successful. The P. aeruginosa reaction used the same reaction and primer pair as reported for the aerobic digest influent, aerobic digest effluent, and E. coli samples. The PCR reaction was amplified in an Eppendorf Mastercycler gradient thermocycler at 94 [degrees]C for 5 min to allow for initial denaturation of genomic DNA; then, 45 cycles were performed at 94 [degrees]C for 1 min, 55 [degrees]C for 1 min, 72 [degrees]C for 1.5 min, followed by a final extension time of 8 min at 72 [degrees]C. Samples (20 [micro]l) were viewed on a 0.8 % agarose gel in 1X TAE buffer containing ethidium bromide as previously described.

RESULTS

Genomic DNA was isolated from influent and effluent aerobic digester samples using Promega's Wizard[R] Genomic DNA Purification kit, MO BIO Laboratories' UltraClean[TM] Microbial DNA Isolation kit, UltraClean[TM] Fecal DNA kit, and UltraClean[TM] Mega Soil DNA kit and detected by gel electrophoresis and ethidium bromide staining (Table 1). Genomic DNA was also successfully isolated from E. coli with each of these kits. However, due to low cell density of the overnight culture, genomic DNA isolated from S. marcescens was of insufficient yield to be detected by gel electrophoresis and ethidium bromide staining. The UltraClean[TM] Mega Soil kit gave the sharpest genomic band with the least amount of shearing as determined by visual analysis of all protocols tested.
Table 1. Summary of genomic DNA extraction protocols as determined by
gel electrophoresis of genomic DNA samples and stained with ethidium
bromide (EtBr).

Extraction        Shearing       Band         Pigmentation  Detected
Method                           Sharpness                  By EtBr

Wizard kit        None observed  Smear        Yes-sludge    Yes
                                              samples only

Activated         None observed  None         None          Not
Sludge                           observed     observed      detected

PowerSoil         None observed  None         None          Not
Isolation kit                    observed     observed      detected

UltraClean        Yes            Yes, with    None          Yes
Microbial kit                    smear        observed

UltraClean Fecal  Yes            Yes, little  None          Yes
kit                              smearing     observed

UltraClean Mega   None observed  Yes          None          Yes
Soil kit                                      observed

PowerMax Soil     None observed  None         None          Not
kit                              observed     observed      detected

Extraction Method     Cost    Ease of Use      PCR        Overall
                       per                 Amplification  Rating
                      Prep

Wizard kit             $1.35  Moderate     No                4

Activated Sludge       NA     Difficult    Not tested        5

PowerSoil Isolation    $4.16  Easy         Not tested        5
kit

UltraClean Microbial   $2.00  Easy         No                3
kit

UltraClean Fecal kit   $3.88  Easy         Yes               1

UltraClean Mega Soil  S17.80  Easy         Not tested        2
kit

PowerMax Soil kit     $18.90  Easy         Not tested        5


Genomic DNA was not detectable by gel electrophoresis and ethidium bromide staining in either aerobic digest samples or pure culture samples when extractions were performed using a modified version of the activated sludge genomic DNA extraction protocol (Watanabe et al., 1998), MO BIO Laboratories' PowerSoil[TM] DNA Isolation kit, or MO BIO Laboratories' PowerMax[TM] Soil DNA Isolation kit (Table 1). It is unclear if this is due to poor bacterial cell lysis or low DNA recovery.

Promega's Wizard[R] Genomic DNA Purification kit produced a DNA product from the aerobic digest samples that was amber in color (Table 1). The amber pigmentation of these samples suggests that a humic acid is present. Extraction procedures that used a spin filter or minicolumn successfully removed the amber co-precipitate from the genomic DNA samples. No amber pigment was observed with pure culture samples (e.g., E. coli).

A 1.5 Kb band was successfully amplified using genomic DNA samples isolated with the UltraClean[TM] Fecal DNA kit and GoTaq[R] Green DNA polymerase (Figure 1). Genomic DNA was amplified using 1:5 dilution of aerobic digest influent (lane 2), 1:5 dilution of aerobic digest effluent (lane 3), 1:5 dilution of E. coli (lane 4), undiluted aerobic digest effluent (lane 6), undiluted E. coli (lane 7), and P. aeruginosa (lane 8). No amplification was observed in the negative (H2O) control or the undiluted aerobic digest influent (lane 5). Due to the small amount of template DNA used (0.25 [micro]l) in the Go Taq[R] Green amplification protocol, it is possible that no DNA or insufficient DNA was transferred to the undiluted aerobic digest influent sample, thus resulting in no amplification. Unsuccessful amplification reactions used exACTGene Taq polymerase [Fisher] and amplification cycles of 30 or 40 under the same PCR parameters as described above (data not shown). Genomic DNA isolated with the Wizard[R] Genomic DNA Purification kit, the UltraClean[TM] Microbial kit, and the UltraClean[TM] Mega Soil kit did not produce a PCR product when amplified using the Go Taq[R] Green amplification protocol (data not shown).

[FIGURE 1 OMITTED]

DISCUSSION

Several genomic DNA extraction methods were compared to determine which gave a genomic DNA product that was detectable by gel electrophoresis and ethidium bromide staining and was free from humic contaminants. Four commercially available kits successfully extracted genomic DNA that was detectable and contained prominent genomic DNA bands. Three of these kits, the UltraClean[TM] Microbial DNA Isolation kit, the UltraClean[TM] Fecal DNA kit, and the UltraClean[TM] Mega Soil DNA kit yielded a genomic DNA product that was free from amber pigmentation. One kit, Promega's Wizard[R] Genomic DNA Purification kit, yielded genomic DNA containing an amber pigment in aerobic digest samples. The amber pigmentation suggests the presence of a humic substance, a known inhibitor to downstream applications such as PCR (Atlas and Bartha, 1997). Preliminary experiments using amber pigmented genomic DNA extracted from aerobic digest samples have not been successful in PCR amplification of 16S rDNA (data not shown).

Seven genomic DNA kits and methods were tested; the UltraClean[TM] Mega Soil DNA kit gave the sharpest genomic DNA band with the least amount of shearing. However, the UltraClean[TM] Mega Soil DNA kit is designed to process large soil samples, and the kit must be modified to use with smaller sample volumes. This kit is rather expensive per prep compared with the UltraClean[TM] Fecal DNA kit, which also yields a genomic DNA product within a short amount of time and has little shearing of the genomic DNA. Samples extracted with the. UltraClean[TM] Fecal DNA kit are capable of being amplified by PCR. The UltraClean[TM] Microbial DNA kit is also cost effective and yields DNA within a short amount of time, but genomic DNA is greatly sheared and could not be amplified by PCR. Promega's Wizard[R] Genomic DNA Purification kit requires several days to extract genomic DNA, and the DNA is contaminated with humic acid. The UltraClean[TM] Mega Soil DNA kit, Fecal DNA kit, and Microbial DNA kit are all suitable for rapid extraction of genomic DNA from complex samples. All are easy to use, therefore making them suitable for routine use in the research laboratory as well as the teaching laboratory. As no genomic DNA was isolated with the modified activated sludge genomic DNA extraction protocol suggested by Watanabe et al. (1998), the PowerSoil[TM] DNA Isolation kit, or the PowerMax[TM] Soil DNA Isolation kit, these methods are not recommended for isolation of genomic DNA from complex microbial communities

Both aerobic digest influent and effluent samples extracted by the UltraClean[TM] Fecal DNA kit produced a 1.5 Kb band by PCR amplification with universal primers E8F and 1492R. E. coli samples were included as an extraction controls. Pure cultures are expected to be free from organic contaminants such as humic acids that inhibit PCR. E. coli is often used to test for fecal contamination of water and is known to be present in aerobic digest samples collected at the Five Mile Creek Wastewater Treatment facility (data not shown). The detection of E. coli shows that further amplification reactions can be developed to detect pathogens or specific organisms of interest in wastewater.

Obtaining a genomic DNA product that can be successfully amplified using PCR or other molecular methods will allow for a more in-depth study of the microbial community of aerobic digest. Understanding this community offers several benefits: pathogens may be monitored for long-term survival, problematic species that cause poor dewatering of sludge or sludge bulking and foaming may be detected earlier thus avoiding treatment problems, and the effect of treatment plant operations can more rapidly be determined and modified. Through the use of culture independent methods, monitoring of species of interest is no longer limited to organisms that can be cultured using traditional agars, nor will species that have long generation times be problematic as molecular methods provide results within hours of sample collection and processing.

Techniques used with genomic DNA isolation from aerobic digest may also be applied to other complex microbial communities such as soils and sediments that may generate samples contaminated with humic acids.

ACKNOWLEDGMENTS

Dr. Robert Thacker of the University of Alabama at Birmingham, Drs. Christi Magrath and Michael Stewart of Troy University, and Dr. Mark Liles and Ms. Larissa Parsley of Auburn University are gratefully acknowledged for their advice on and assistance with extraction and PCR protocols and preparation of this manuscript. This research was funded in part by a faculty development grant from Troy University.

REFERENCES

Atlas, R. M. and R. Bartha. 1997. Microbial Ecology: fundamentals and applications. New York: Benjamin Cummings.

Baker, G. C, J. J. Smith, and D. A. Cowan. 2003. Review and re-analysis of domain specific 16S primers. Journal of Microbiological Methods 55, 541-555.

Dar, S. A., J. G. Kuenen, and G. Muyzer. 2005. Nested PCR--denaturing gradient gel electrophoresis approach to determine the diversity of sulfate--reducing bacteria in complex microbial communities. Applied and Environmental Microbiology 71, 2325-2330.

Kepner, R. L. J. 1994. Use of Fluorochromes for direct enumeration of Total Bacteria in Environmental Sample: Past and Present. Microbiological Reviews 58, 603-615.

Lachmayr, K., L. J. Kerkhof, A. G. DiRienzo, C. M. Cavanaugh, and T. E. Ford. 2009. Quantifying nonspecific TEM [??]-lactamase (blaTEM) genes in a wastewater stream. Applied and Environmental Microbiology 75, 203-211.

Layton, A. C, P. N. Karanth, C. A. Lajoie, A. J. Meyers, I. R. Gregory, R. D. Stapleton, D. E. Taylor, and G. S. Sayler. 2000. Quantification of Hyphomicrobium populations in activated sludge from an industrial wastewater treatment system as determined by 16S rRNA analysis. Applied and Environmental Microbiology 66, 1167-1174.

McPherson, M. J., B. D. Hames, and G. R. Taylor. 1995. PCR 2: a practical approach. New York: IRL Press.

Park, H. D., G. F. Wells, H. Bae, C. S. Criddle and C. A. Francis. 2006. Occurrence of ammonia-oxidizing archaea in wastewater treatment plant bioreacters. Applied and Environmental Microbiology 72, 5643-5647.

Siripong, S., J. J. Kelly, D. A. Stahl and B. E. Rittmann. 2006. Impact of prehybridization PCR amplification on microarray detection of nitrifying bacteria in wastewater treatment plant samples. Environmental Microbiology 8, 1564-1574.

Snaidr, J., R. Amann, I. Huber, W. Ludwig, and K.-H. Schleifer. 1997. Phylogenetic analysis and in situ identification of bacteria in activated sludge. Applied and Environmental Microbiology 63, 2884-2896.

Spano, G., L. Beneduce, V. Terzi, A. M. Stanca, and S. Massa. 2005. Real-time PCR for the detection of Escherichia coli O157:H7 in dairy and cattle wastewater. Letters in Applied Microbiology 40, 164-171.

Symonds, E. M., D. W. Griffin, and M. Breitbart. 2009. Eukaryotic viruses in wastewater samples from the United States. Applied and Environmental Microbiology 75, 1402-1409.

Tsai, Y. L. and B. H. Olson. 1991. Rapid method for direct extraction of DNA from soil and sediments. Applied and Environmental Microbiology 57, 1070-1074.

Wagner, M., G. Rath, R. Amann, H.-P. Koops, and K.-H. Schleifer. 1995. In situ identification of ammonia-oxidizing bacteria. Systematic applied microbiology 18, 251-264.

Wagner, M., R. Amann, H. Lemmer, and K.-H. Schleifer. 1993. Probing activated sludge with oligonucleotides specific for Proteobacteria: Inadequacy of culture-dependent methods for describing microbial community structure. Applied and Environmental Microbiology 59, 1520-1525.

Wagner, M., R. Amann, P. Kampfer, B. Assmus, A. Hartmann, P. Hutzler, N. Springer, and K.-H. Schleifer. 1994a. Identification and in situ detection of gram-negative filamentous bacteria in activated sludge. Systematic applied microbiology 17, 405-417.

Wagner, M., R. Erhart, W, Manz, R. Amann, H. Lemmer, D. Wedi, and K.-H. Schleifer. 1994b. Development of an rRNA-targeted oligonucleotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge. Applied and Environmental Microbiology 60, 792-800.

Watanabe, K., S. Yamamoto, S. Hino, and S. Harayama. 1998. Population Dynamics of Phenol- Degrading Bacteria in Activated Sludge determined by gyrB- Targeted Quantitative PCR. Applied and Environmental Microbiology 64, 1203-1209.

Lisa Ann Blankinship

Department of Biological and Environmental Sciences

Troy University

321 D McCall Hall

Troy, AL 36082

Correspondence: L. A. Blankinship (lblankinship@troy.edu)
COPYRIGHT 2009 Alabama Academy of Science
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2009 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Blankinship, Lisa Ann
Publication:Journal of the Alabama Academy of Science
Article Type:Report
Geographic Code:1USA
Date:Jul 1, 2009
Words:5881
Previous Article:Lead levels in drinking water.
Next Article:Movement of mercury from a contaminated city park in Oxford into the Coosa River, Alabama.
Topics:


Related Articles
Restriction site-specific methylation studies of imprinted genes with quantitative real-time PCR.
A simple method for DNA isolation from clotted blood extricated rapidly from serum separator tubes.
Use of magnetic beads for plasma cell-free DNA extraction: toward automation of plasma DNA analysis for molecular diagnostics.
Use of an automated method improves the yield and quality of cell-free fetal DNA extracted from maternal plasma.
DNA sequencing by indexer walking.
Quantitative analysis of circulating plasma DNA as a tumor marker in thoracic malignancies.
Size separation of circulatory DNA in maternal plasma permits ready detection of fetal DNA polymorphisms.
PCR on cell lysates obtained from whole blood circumvents DNA isolation.
Comparison of the different methods of DNA extraction from snap--frozen tumor tissues: our experience.
Isolation and purification of genomic DNA from withania somnifera for analytical applications.

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters