Printer Friendly

Comparison between allicin and fluconazole in Candida albicans biofilm inhibition and in suppression of HWP1 gene expression.

ABSTRACT

Candida albicans is an opportunistic human pathogen with the ability to differentiate and grow in filamentous forms and exist as biofilms. The taiofilms are a barrier to treatment as they are often resistant to the antifungal drugs. In this study, we investigated the antifungal activity of allicin, an active compound of garlic on various isolates of C albicans. The effect of allicin on biofilm production in C. albicans as compared to fluconazole, an antifungal drug, was investigated using the tetrazolium (XTT) reduction-dependent growth and crystal violet assays as well as scanning electron microscopy (SEM). Allicm-treated cells exhibited significant reduction in biofilm growth (p < 0.05) compared to fluconazole-treated and also growth control cells. Moreover, observation by SEM of allicin and fluconazole-treated cells confirmed a dose-dependent membrane disruption and decreased production of organisms. Finally, the expression of selected genes involved in biofilm formation such as HWP1 was evaluated by semi-quantitative RT-PCR and relative real time RT-PCR. Allicin was shown to down-regulate the expression of HWP1.

[c] 2011 Elsevier GmbH. All rights reserved.

ARTICLE INFO

Keywords: Allicin HWP1 Gene expression Biofilm Candida albicans

Introduction

Biofilms are characteristically composed of genetically and phenotypically diverse microbial populations inhabiting surfaces of tissues, catheters or surgically implanted prosthetic devices: although intensively investigated the clinical relevance of fungal biofilms is often uncertain. Attachment of Candida albicans to host cells of mucosal surfaces is sometimes followed by biofilm growth on catheter walls and heart valves (Chandra et al. 2001). It has been shown that the initial step of candidal infection is adherence of Candida to host cells surfaces. Some important genes in Candida interfere with formation of biofilm such as agglutinin like sequence (ALS) family and hyphal cell wall protein (HWP1). Germ tubes also are the first step indicated in conversion of planktonic form to hyphal growth of C. albicans which can form stable complexes with human buccal epithelial cells (HBEC). It is also demonstrated that the HBEC is one of the major targets of Hwpl for formation of the stable complexes (Yan-Liang 2003; Nobile et al. 2006). HWP1 is also shown to encode a surface mannoprotein contributing to development of biofilm characterized by antifungal resistance of C albicans (Staab et al. 1999; Bruzual et al. 2007). Clearly, Hwpl is expressed during the early stages (after adherence step or yeast-form cells adhere) of biofilm formation on surfaces of germ tubes (Nobile and Mitchell 2006; Finkel and Mitchell 2010; Bujdakova et al. 2010). Indeed, Hwpl has a complementary role in biofilm formation; through a physical interaction with Alsl and 3 in the initiation stage of biofilm formation (Nobile et al. 2008; Klis et al. 2009). INTl has a significant role in morphogenesis, adhesion, and filamentous growth. In fact, interruption in the INTl gene could decrease adhesion of C albicans to epithelial cells (Kinncberg et al. 1999).

Most recently antifungal drugs such as azoles have been found to display side effects and also lead to emergence and distribution of resistance (Ankri and Mirelman 1999; Bruzual et al. 2007). Therefore, new therapeutic strategies using antifungal agents that originated from natural substances and also understanding the mechanisms of action of these drugs may be one way to develop more effective anticandicial agents.

Garlic and sulphur-containing derivatives have been defined as medications for many infectious diseases. It is demonstrated that the main bioactive components that originated from garlic is allicin showing antifungal activities (Yamada and Azuma 1977; Adetumbi et al. 1986; Ghannoum 1988, 1990; Ankri and Mirelman 1999; Harris et al. 2001; Low et al. 2008; Khodavandi et al. 2010, 2011). It is mentioned that after damage of garlic cells, allin (precursor of allicin) could convert to allicin by allinase activity. Although the mechanisms of action of garlic and allicin are not well understood, some investigators mentioned that blockage of lipid synthesis affecting the lipid compositions of the cell surface and suppression of hyphae development might be the suggested targets of garlic in C albicans (Adetumbi et al. 1986; Ghannoum 1990; Davis 2005; Low et al. 2008). It has been shown that garlic and some derivatives could destroy the Candida cell membrane integrity. On the other hand, its ceil wall also has a high ratio of carbohydrates, which might be the other probable target of allicin against C albicans (Lemar et al. 2002). A previous study has reported that garlic extract and some products such as allyl alcohol and DADS (diallyl disulfide) could to increase oxidative stress and reduced glutathione in C albicans. On the other hand, it is indicated that mitochondria might be a target for allyl alcohol (Lemar et al. 2005, 2007). Moreover, it is demonstrated that garlic could significantly inhibit candidal adhesion to HBEC (Ghannoum 1990) and reduce biofilm formation in C albicans (Shuford et al. 2005).

In the present study, significant reduction in the expression of HWP1 in C. albicans treated with allicin demonstrated that inhibition of biofilm formation and development could be one of the significant mechanisms of anticandidal activity of allicin.

Materials and methods

Fungi and antifungal agents

C. albicans ATCC 14053 was acquired according to the procedure of our previous studies (Khodavandi et at. 2010, 2011).

Allicin was obtained from Alexis Biochemicals Co. (purity [greater than or equal to] 98%, Batch No. ALX-350-329, San Diego, USA) and dispersed at 1 mg/ml in methanol/water/formic acid (60:40:0.1), then stored at -20 to -80 [degrees] C until use. Fluconazole was purchased from Sigma Chemicals Co. (St. Louis, MO, USA).The stock solution was prepared by dissolving in dimethyl sulfoxide (DMSO) at 5 mg/ml and stored frozen at -70 [degrees] C until use. The MICs of C albicans treated with allicin and fluconazole were determined using NCCLS M27 A2 as described in our previous reports (Khodavandi et al. 2010, 2011).

Biofilm formation and quantification

Formation of biofilm

C. albicans ATCC 14053 was induced to form biofilm according to the protocol by Braga et al. (2008) with slight modifications. In summary, a suspension of yeast containing 1 x [10.sup.6] cells/ml of Candida [in standard RPMI 1640 medium (with 0.2% glucose and buffered to pH 7.0) with MOPS (0.165 M)] was added to 100 [micro]l of antifungal agents in different concentrations based on MIC (1/4 x MIC,1/2 x MIC, l x MIC and 2 x MIC) using 96-well microplate (Brand 781660, Wertheim, Germany) and incubated at 35 [degrees] C for at least 90min (with no shaking) to complete the adhesion of yeast cells (beginning phase of biofilm formation). Subsequently, the mixture was incubated at 35 C for 24 h (growth phase) with gentle shaking (Chandra et al. 2008; Pierce et al. 2008). The effect of antifungal agents on biofilm of C. albicans was quantified using 2, 3-bis (2-methoxy-4-nitro-5 sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide (XTT) colorimetric and also crystal violet (CV) assays.

XTT assay

In the biofilm quantification protocol using XTY assay, 4mg XTT (Sigma, USA) in 10 ml prewarmed phosphate buffered saline (PBS) was dissolved and supplemented by 100 [micro]l menadione stock solution, which contained 55 mg menadione (Sigma, USA) in 100 ml acetone. One hundred [micro]l of the XTT/menadione solution was added to all wells and incubated in the dark at 37 [degrees] C for 5h. The contents of the wells were transferred to eppendorf tubes and centrifuged at 13,000 rpm for 4min. One hundred [mu]l of supernatant from each well was transferred to a new microplate and the colorimetric changes was measured at 490 nm using EM ax[R] microplate reader (Peeters et al. 2008) and then oneway ANOVA was carried out to show significant reduction of biofilm at different concentrations of antifungals to untreated-control.

CV assay

One hundred [mu]l of 99% methanol was added to each well for 15 min to fix the biofilm and then the supernatants were ejected. Microplates were air-dried and then l00 [micro]l of CV solution (1:50 from stock solution, Sigma) were added to wells and incubated at room temperature for 20 min. The extra CV was washed away with tap water and then approximately 150 [micro]l of acetic acid 33% (Sigma, USA) was added to the wells. The absorbance was measured at 590 nm using EMax[R] microplate reader (Peeters et al. 2008). Oneway ANOVA was performed using a previously described to find significant reduction of biofilm.

Investigation of the effect ofallicin on biofilm ofC. albicans via scanning electron microscopy (SEM)

The protocol of biofilm formation for SEM analysis by Braga et al. (2008) was adopted with some slight modifications. A suspension of C. albicans ATCC 14053 containing 1 x [10.sup.6] cells/ml in RPMI 1640 (4 ml) (supplemented by L-glutamine) was added into 6-well cell culture plates [ThermanoxTM plastic coverslips (Nunc, Denmark)] containing 4 ml of different concentrations of antifungals based on MIC (dissolved in RPMI 1640) and incubated at 35 [degrees] C for 90 min (with no shaking) as described earlier and incubated again at 35 [degrees] C for 24 h with gentle shaking. Following that, the biofilms were washed with PBS alone and fixed in 2% (v/v) glutaraldehyde in PBS (PH 7.2) and washed again with sodium cacodylate buffer. For post-fixation, samples were rinsed in 1% osmium tetroxide for 2 h at 4 [degrees] C, washed again with sodium cacodylate buffer and then dehydrated with ascending ethanol series. Following that, samples on cover slips were put into critical point dryer and then stuck onto the stub. The specimens were coated with gold and observed through a Philips XL30 (ESEM, UK) scanning electron microscope. For the number of Candida in different concentrations of antifungal agents scoring, cells were counted and compared to untreated control in the pictures using the UTHSCSA ImageTool version 3.0 (http://ddsdx.uthscsa.edu/dig/itdesc.html).

RNA extraction and cDNA synthesis

A suspension containing different concentrations of antifungal agents and 1 x [10.sup.6] cells/ml of C. albicans ATCC 14053 were prepared as in the sample preparation for SEM as explained above. Subsequently, the mixture was centrifuged at 3000 rpm for 10 min and the supernatant was removed. The cells were washed using PBS by resuspending the cells with approximately 2 ml of PBS and centrifuged at 3000 rpm for 10 min and removing the supernatant. The washing process was repeated at least three times. According to manufacturer's operating instructions for yeast cells in the RNeasy RNA extraction kit, 2 ml of sorbitol lysis buffer (1 M sorbitol and 0.1 M EDTA pH 7.4), 50U lyticase/zymolyase (ICN Chemicals, USA) and 10 [micro]l of [beta]-mercaptoethanol were added to the prewashed cells and incubated at 37 [degrees] C (100 rpm) for 30 min until spheroplast was formed. The mixture was centrifuged at 1500 rpm for 5 min and the supernatant was discarded. Subsequently, total RNA was extracted using RNeasy mini kit (Qiagen, Germany) for yeast and treated with 1U DNase I (Promega, UK). RNA quality was checked by formaldehyde-denaturing agarose gel electrophoresis at 70 V for 45 min and also the concentration and absorption ratio of RNA was measured for purity estimation using the Nanodrop ND-1000 spectrophotometer. According to manufacturer's protocol, single-stranded cDNA was synthesized approximately 0.5-1 [micro]g from RNA using Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase and random hexamer oligonucleotides (Fermentas, USA). The reverse transcription reactions were performed at least in triplicates.

Reverse transcription polymerase chain reaction (RT-PCR)

Semi-quantitative RT-PCR

Candida albicans HWP1 gene was amplified from the synthesized cDNA. In this study, the primers used were established by other investigators except for HWPI gene which we designed via Primer 3 and Primer Premier 5 software (Table 1). Moreover, [beta]-actin was established as a house-keeping gene and internal control to normalize the dissimilar RNA concentrations during RNA extraction. Furthermore, for each sample an internal negative control (without M-MuLV reverse transcriptase) was performed to ensure that the PCR products were not originated from genomic DNA. The amplification condition contained 26 cycles and PCR products were performed by gel electrophoresis and visualized via the Alphalmager HP imaging system. The PCR products were quantitated in terms of intensity of bands by comparing to known molecular weight DNA markers (Fermentas, USA) using Alphalmager software. The mathematical calculation method of relative quantification was determined as follows:
Table 1
Oligonucleotide primers used for PCR.

Gene  Primer   Sequence                     Product  Reference
                                              size
                                              (bp)

HWP1  Forward  5' GGTAGACGCTCAAGGTGAAACA        283        This
(d)            3'                                         study
      Reverse  5' AGGTGCATTGTCGCAAGGTT 3'

HWPl  Forward  5' TCAGTTCCACTCATGCAACCA 3'       99    Uppuluri
(b)                                                      et al.
                                                         (2009)
      Reverse  5' AGCACCGAAACTCAATCTCATGT
               3'

IMT   Forward  5' AAGCTCTGATACCTACACTAGCGA      239  Lim and Li
(a)            3                                         (2002)
      Reverse  5' TTAGGTCTAAAGTCGAACTCATC
               3'
      Forward  5'                               516   Lowet al.
               ACCGAAGCTCCAATGAATCCAAAATCC               (2008)
               3'
      Reverse  5'
               GTTTGGTCAATACCAGCACCTTCCAAA
               3'

ACT   Forward  5' GAGTTGCTCCAGAAGAACATCCAG      199  Lim et al.
(b)            3'                                        (2009)
      Reverse  5' TGAGTAACACCATCACCAGAATCC
               T

A Primer used in semi-quantitative RT-PCR. Primer used in relative real
time RT-PCR.


Fold change in target gene expression = Ratio of target gene expression(experiment/untreated control) / Ratio of reference gene expression(experiment/untreated control)

Relative real time RT-PCR

Relative real time RT-PCR reactions to confirm the significant gene expression results obtained via semi-quantitative RT-PCR were carried out using [TM] SYBR Green qPCR Master Mix (Fermentas, EU) via Bio-Rad MiniOpticon [TM] system (USA). The cycling conditions included an initial step at 50 [degrees] C for 2min; holding at 95 [degrees] C for l0 min, 40 cycles of denaturation at 95 [degrees] C for 15 s and subsequently annealing at 60 [degrees] C for 1 min. Finally, the melting reaction was 72-99 [degrees] C (Uppuluri et al. 2009). Relative gene expression was quantified by the Pfaffl method (Pfaffl 2001) as follows:

Fold change in target gene expression = ([E.sub.target] [DELTA] Ct) target ( control-treated) / ([E.sub.target] [DELTA] Ct) reference (control-treared)

Statistical analysis

With regards to quantification of biofilm formation via XTT and CV assays and picture scoring the reduction of cells in biofilm by SEM, as well as relative quantification of gene expression, all data was collected and examined in terms of normality and then one way analysis of variance (ANOVA) was carried out. On the other hand, independent T-test was used to compare two biofilm-associated antifungal-treated groups, p Values of < 0.05 were considered significant. Statistical analysis was performed using SPSS version 17 software (SPSS Inc., Chicago, IL). All experiments were carried out in at least triplicates.

Results

The inhibitory effect of the tested antifungal agents on growth of C albicans has been indicated to decrease the number of cells during a range of time.

Table 2 shows the significant results for reduction of biofilm after treatment with antifungal agents using XTT (p < 0.001) and CV (p < 0.005) assays. Quantification of biofilms also indicated that C. albicans ATCC 14053 biofilm treated with allicin was almost as good as fluconazole-treated in terms of biofilm reduction in XTT and CV assays (p > 0.05).
Table 2

X1T and CV assays results for biofilm-associated C albicans ATCC
14053 treated with antifungal agents in different concentration based
on MIC (fig/ml).

Concentration        Means                             Means
of antifungal   absorbance                        absorbance
agents         at 490nm [+                         at 590 nm
                  or -] SD                       [+ or -] SD
                 using XTT                          using CV
                     assay                             assay

                   Allicin          Fluconazole      Allicin

2 x MIC        0.208 [+ or          0.147 [+ or  1.523 [+ or
                  -] 0.050             -] 0.006     -] 0.151
                   (a) (b)                  (a)          (a)

1 x MIC        0.248 [+ or          0.163 [+ or  1.581 [+ or
                  -] 0.020             -] 0.033     -] 0.548
                   (b) (c)                  (a)          (a)

1/2 x  MIC     0.288 [+ or          0.171 [+ or  1.640 [+ or
                  -] 0.037             -] 0.025     -] 0.190
                   (c) (d)                  (a)          (a)

1/4 x MIC      0.323 [+ or          0.200 [+ or  1.691 [+ or
                  -] 0.028         -] 0.004 (a)    -] 0.086
                       (d)                  (b)          (a)

Untreated                   0.484                             2.306
control                     [+ or                             [+ or
                               -]                                -]
                            0.102                             0.054
                              (e)                               (b)

Concentration
of antifungal
agents

               fluconazole

2 x MIC        1.340 [+ or
                  -] 0.131
                       (d)

1 x MIC        1.345 [+ or
                  -] 0.086
                       (a)

1/2 x  MIC     1.432 [+ or
                  -] 0.076
                       (d)

1/4 x MIC      1.515 [+ or
                  -] 0.076
                       (d)

Untreated
control

(d) (e) Means [+ or -] SD in a column with different superscript
differ significantly (p < 0.005) using Duncan test. The results were
performed in four independent experiments.


[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Our favorable findings were visually verified by SEM. Fig. 1 shows that the growing biofilms consisting of compact multilayered structures including cells and hyphae in untreated control group while the majority of matrix was lost during dehydration stage in SEM procedures (Lopez-Ribot 2005). Although it is not clear to observe, the allicin-treated biofilm was reduced in number and density of cells and also hyphae depending on concentration of allicin and fluconazole. Regarding the SEM pictures from biofilm of Candida-treated with antifungals at different concentrations based on MIC, Fig. 2 shows the distribution of C. albicans-biofilm-associated that is treated with antifungals indicating significant reduction in the number of cells compared to untreated control f with increasing concentration of the antifungal agents (p < 0.001). On the other hand, it was indicated that treatment with allicin in different concentrations of 1/4 x MIC, 1/2 MIC and 1 x MIC were almost as good as fluconazole at levels p = 0.182, p = 0.061 and p = 0.062 respectively. While, based on results in high concentration (2 x MIC), differences between allicin-treated and fluconazole-treated groups were significant at level p < 0.001 (Fig. 2).

[FIGURE 3 OMITTED]

In the present study, C. albicans ATCC 14053 (1 x 106 cells/ml) was treated with different concentrations of allicin and fluconazole based on two-fold concentrations of MiC ([mu]g/ml) as explained previously. All experiments were performed at least from three independent biological samples in duplicates. The representative gel electrophoresis RT-PCR products are exhibited in Figs. 3 and 4 for HWP1 and INT1 respectively. Furthermore, our finding showed that the relative quantification of HWP1 expression displayed significant down-regulation (p < 0,0001) compared to untreated control after treatment of C albicans with antifungal drugs in different concentrations based on MIC. Moreover, the fold changes in untreated control in terms of HWP1 expression for 2 x MIC, l x MIC, 1/2 x MIC and 1/4 x MIC of allicin were 0.125 [+ or -] 0.005, 0.136 [+ or -] 0.006, 0.139 [+ or -] 0.0003 and 0.189 [+ or -] 0.005 respectively. Meanwhile, the fold changes to untreated control regarding to HWP1 expression for 2 x MIC, l x MIC, 1/2 x MIC and 1/4 x MIC of fluconazole were 0.335 [+ or -] 0.044, 0.407 [+ or -] 0.002, 0.420 [+ or -] 0.039 and 0.650 [+ or -] 0.020 respectively (Figs. 3 and 5). However, INT1 mRNA was not significantly down-regulated for antifungal agents-treated samples at levels p = 0.334 and p = 0.428 for allicin and fluconazole respectively (Figs. 4 and 5). The reliability of PCR products was confirmed by DNA sequencing method using an outsourcing sequencing service (1st BASE, Malaysia). The sequences displayed high similarity analyzed via nucleotide Blast in Gene Bank and confirmed in terms of homology to the related genes (data not shown).

The significant decrease of HWP1 expression was confirmed using relative real time RT-PCR as previously explained. Findings showed more significant down-regulation of HWP1 expression than semi-quantitative RT-PCR method (p < 0.00001). Fig. 6 shows the relative quantification of HWP1 treated with antifungal agents using real time RT-PCR displayed based on [Log.sub.2]. The fold changes in terms of HWP1 expression to untreated control for 1 x MIC and 1/2 x MIC of allicin were 0.0072 [+ or -] 0.003 and 0.195 [+ or -] 0.087 respectively. While, the fold changes regarding to HWP1 expression for 1 x MIC and 1/2 x MIC of fluconazole were 0.077 [+ or -] 0.020 and 0.085 [+ or -] 0.017 respectively.

Discussion

Some of the important virulence attributes in Candida species include hyphae production, adhesion, phenotypic switching and formation of some extracellular hydroiytic enzymes such as proteinases (Calderone and Fonzi 2001). Colonization of Candida on the surface of tissue is a primary step to infection. On the other hand, biofilm is a natural obstacle to treatment with some antifungal agents which may result in drug resistance. It is demonstrated that the ability to form biofilms and degree of pathogenicity could be collaborative (Calderone and Fonzi 2001; Yan-Liang 2003). It has also been suggested that biofilms of C albicans usually could be composed of a complicated structure including yeast cells, hyphae, and pscudohyphae. Mostly, an extra cellular matrix surrounding the complex could be observed with development of biofilms (Al-Fattani and Douglas 2004). It is demonstrated that growth of biofilms in a dynamic environment can increase biofilms formed with more matrix material (Al-Fattani and Douglas 2006; Thein et al. 2007) as we have chosen this method for biofilm formation. Importantly, Candida biofilm formation is described in several overlapping stages including early (0-11 h), intermediate (12-30 h), and maturation (38-72 h) phases. The early stages include adhesion of yeast cells to a solid-surface, individual colonization of cells and organization of yeast cells with hyphae production (Seneviratne et al. 2008). Previous investigations demonstrated that some important genes in C. albicans could contribute to biofilm formation. ALS family is included of several glycosylated proteins required for cell-cell recognition during mating (Caldcrone and Fonzi 2001; Yan-Liang 2003).

[FIGURE 4 OMITTED]

[FIGURE 5 OMITTED]

[FIGURE 6 OMITTED]

The silent information regulatory gene (SIR2) is indicated as one of the significant genes which might interfere with hyphae formation. Fresh garlic extract has the potential to suppress hyphae formation with concomitant down-regulated SIR2 expression in C. albicans (Low et al. 2008). Our finding here has confirmed the significant inhibition of biofilm in terms of its formation and development in C. albicans treated with allicin. Nonetheless, little is known about the main targets and probable molecular mechanisms of allicin against C. albicans.

A previous report has shown a high efficacy of fluconazole to inhibit biofilm formation at 8 [micro]g/ml which was linked to down-regulated HWP1 gene-expression in C. albicans (Bruzual et al. 2007). Meanwhile, our findings have demonstrated that allicin could also significantly reduce the expression of HWPI in all concentrations tested (0.025-02 [micro]g/ml) as well as fluconazole (0.25-4 [micro]g/ml) in C. albicans using semi-quantitative RT-PCR (Fig. 5). As a matter of fact, the HWP1 expression decreased 7.990, 7.378, 7.194 and 5.314 folds at allicin concentrations of 2 x MIC, l x MIC, 1/2 x MIC and 1/4 x MIC, respectively. Similarly, the down-regulated mRNA levels of HWP1 were at 2.963, 2.455, 2.370 and 1.541 fold reduction at fluconazole concentrations of 2 x MIC, 1 x MiC, 1/2 x MIC and 1/4 x MIC, respectively. On the other hand, our RT-PCR results did not demonstrate any significant decrease in INT1 expression whether clue to allicin or fluconazole (Fig. 5). Moreover, the results of relative real time RT-PCR which were more accurate than semi-quantitative RT-PCR also concurred with the findings of the semi-quantitative RT-PCR. These favorable results obtained via relative real time RT-PCR indicated that the down-regulated mRNA expression of HWP1 decreased 138.889 and 5.132 folds at allicin concentrations of l x MIC and 1/2 x MIC respectively, compared to 13.005 and 11.763 folds at fluconazole concentrations of 1 x MIC and 1/2 x MIC, respectively (Fig. 6). Interestingly, the relative real time RT-PCR results revealed a remarkable suppression of HWP1-expression at 1 x MIC concentration of allicin, at a much higher magnitude than 1 x MIC concentration of fluconazole. In fact, allicin in this concentration appeared to suppress HWP1 -expression almost to the base-line level (fold change of expression relative to control = 0.0072). In contrast, the phenotypic observation of the biofilm disruption through SEM, XTT and CV assays showed that both ailicin and fluconazole were approximately similar in their efficacy to reduce biofilm formation. A possible explanation is that as HWP1 is only one of the significant genes that contribute towards biofilm formation and the molecular mechanism of inhibition of biofilm formation by fluconazole involves not only HWP1 but also other yet uncharacterized genes.

As for the SEM results, it has been shown that there is no significant difference between allicin and fluconazole in terms of cells-biofilm-associated reduction at l/4 x MIC, 1/2 x MIC and 1 x MIC (Fig. 2) while fluconazole was more significant than allicin at 2 x MIC (p < 0.0001). Therefore, it is probable that in lower concentrations, allicin could inhibit biofilms of C albicans almost as well as fluconazole as a standard anticandidal drug. Most of these abilities of allicin may be clue to SH-modifying potential because the activated disulfide bond of allicin could affect thiol-containing cellular components such as some proteins, for example glutathione which is an essential metabolite in C. albicans (Ankri and Mi re I man 1999; Miron et al. 2004) or in our findings Hwpl as a hyphae-specific protein.

In conclusion, our results demonstrated that allicin could display the potential to inhibit Candida biofilms and also suppress the expression of HWP1 as a probable target gene. These encouraging results demonstrated that garlic and its related bioactive compounds such as allicin could be further developed into an alternative or supplementary therapeutic arsenal against Candida infections in humans.

Acknowledgments

We thank Dr Mohammad Ali Farbodniay Jahromi, senior researcher of Fars Technological and Environmental Research Center, Shiraz-Iran, for helpful guidance and collaboration. Funding was partially provided by Science Fund (02-01-04-SF0761) from the Ministry of Science, Technology and Innovation of Malaysia.

0944-7113/$ - see front matter [c] 2011 Elsevier GmbH. All rights reserved, doi:10.1016/j.phymed.2011.08.060

doi:10.1016/j.phymed.2011.08.060

References

Adetumbi, M.Javor. G.T., Lau, B.H., 1986. Allium sativum (garlic) inhibits lipid synthesis by Candida albicans, Antimicrob. Agents Chemother. 30. 499-501.

Al Tattani, M.A., Douglas, LJ., 2004. Penetration of Candida biofilms by antifungal agents. Antimicrob. Agents Chemother. 48, 3291-3297.

Al-Fattani, MA, Douglas, L.J., 2006. Biofilm matrix of Candida albicans and Candida tropicalis: chemical composition and role in drug resistance. J. Med. Microbiol. 55, 999-1008.

Ankri, S., Mirelman, D., 1999. Antimicrobial properties of allicin from garlic. Microb. Infect 2, 125-129.

Braga, P.C., Culici, M., Alfieri. M., Dal Sasso. M., 2008. Thymol inhibits Candida albicans biofilm formation and mature biofilm. Int. J. Aniimicrob. Agents 31, 472-477.

Bruzual, 1., Riggle. P., Iladley, S., Kumamoto, CA, 2007. Biofilm formation by fluconazole-resistant Candida albicans strains is inhibited by fluconazole. J. Antimicrob. Chemother. 59, 441-450.

Bu jdakova, H., Paulovicova. E., Paulovicova, L. Simova. Z., 2010. Participation of the Candida albicans surface antigen in adhesion, the first phase of biofilm development. FEMS. Yeast Res. 59, 485-492.

Calderone, RA, Fonzi, WA, 2001. Virulence factors of Candida albicans. Trends Microbiol. 9, 327-335.

Chandra, J., Kuhn, D.M., Mukherjee, P.K., Hoyer, LL, McCormick.T., Channoum, M.A., 2001. Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance. J. Bacteriol. 183, 5385-5394.

Chandra, J., Mukherjee, P.K., Ghannoum, MA, 2008. In vitro growth and analysis of Candida biofilms. Nat. Protoc. 3, 1909-1924.

Davis, S.R., 2005. An overview of the antifungal properties of allicin and its breakdown products - the possibility of a safe and effective antifungal prophylactic. Mycoses 48, 95-100.

Finkel.J.S., Mitchell, A.P., 2010. Genetic control of Candida albicans biofilm development. Nat. Rev. Microbiol. 9, 109-118.

Ghannoum, M., 1988. Studies on theanticandidal mode of action of Allium sativum (Garlic). J. Gen. Microbiol. 134, 2917-2924.

Ghannoum, M., 1990. Inhibition of Candida adhesion to buccal epithelial cells by an aqueous extract of Allium sativum (garlic). J. Appl. Microbiol. 68, 163-169.

Harris, J.C., Cottrell, S.L. Plummet. S., Lloyd, D., 2001. Antimicrobial properties of Allium sativum (garlic). Appl. Microbiol. Biotechnol. 57, 282-286.

Khodavandi, A., Alizadeh, F., Aala, F., Sekawi, Z., Chong, P.P., 2010. In vitro investigation of antifungal activity of allicin alone and in combination with azoles against Candida species. Mycopathologia 169, 287-295.

Khodavandi, A., Alizadeh. F.. Harmal. N.S., Sidik, S.M., Othman. F., Sekawi, Z., Farbood-niaye Jahromi. M.A., Ng, K-P., Chong, P.P., 2011. Comparison between efficacy of allicin and fluconazole against Candida albicans in vitro and in a systemic candidiasis mouse model. FEMS Microbiol. Lett. 315, 87-93.

Kinneberg, K.M., Bendel, C.M.Jechorek, R.P., Cebelinski, EA, Gale. CA, Berman.J.G., Erlandsen. S.L. Hostetter. M.K., Wells, C.L., 1999. Effect of 1NT1 gene on Candida albicans murine intestinal colonization. J. Surg. Res. 87, 245-251.

Klis, F.M., Sosinska, G.J., de Groot, P.W.J., Brul. S., 2009. Covalently linked cell wall proteins of Candida albicans and their role in fitness and virulence. FEMS Yeast Res. 9, 1013-1028.

Lemar, K.M., Turner, M.P., Lloyd, D., 2002. Garlic (Allium sativum) as an anti-Cmidida agent: a comparison of the efficacy of fresh garlic and freeze-dried extracts. J. Appl. Microbiol. 93, 398-405.

Lemar, K.M., Passa. O., Aon, M.A., Cortassa. S., Muller, C.T., Plummer, S., O'Rourke, B., Lloyd, D., 2005. Allyl alcohol and garlic (Allium sativum) extract produce oxidative stress in Candida albicans. Microbiol. 151, 3257-3265.

Lemar, K.M., Aon, MA. Cortassa. S., O'Rourke. B., Muller, C.T., Lloyd, D., 2007. Diallyl disulphide depletes glutathione in Candida albicans: oxidative stress-mediated cell death studied by two-photon microscopy. Yeast 24, 695-706.

Lim, Y.H., Li, D.H., 2002. Multiplex polymerase chain reaction assay for simultaneous detection of Candida albicans and Candida dubliniensis. J. Microbiol. 40. 146-150.

Lim, CSX. Wong, W.F., Rosli. R., Ng. K.P., Seow, HE, Chong, P.P., 2009. 2-Dodecanol (decyl methyl carbinol) inhibits hyphal formation and SIR2 expression in C albicans, J. Basic Microbiol. 49, 579-583.

Lopez-RibotJ.L, 2005. Candida albicans biofllms: more than filameniation. Curr. Biol. 15, 453-455.

Low. C.F., Chong. P.P., Yong, P.V.C., Lim. C.S.Y., Ahmad. Z., Othman. F., 2008. Inhibition of hyphae formation and SSR2 expression in Candida albicans treated with fresh Allium sativum (garlic) extract. J. Appl. Microbiol. 105, 2169-2177.

Miron, T., Bercovici. T., Rabinkov, A., Wilchek. M., Mirelman, D., 2004. [3H]Allicin: preparation and applications. Anal. Biochem. 331, 364-369.

Nobile, C.J., Mitchell, A.P., 2006. Genetics and genomics of Candida albicans biofilm formation. Cell. Microbiol. 8. 1382-1391.

Nobile. C.J., Nett, J.E., Andes, D.R., Mitchell. A.P., 2006. Function of Candida albicans adhesin Hwpl in biofilm formation. Eukaryot. Cell 5, 1604-1610.

Nobile, C.J., Schneider. HA, Nett.J.E., Sheppard, D.C., Filler, S.G., Andes, D.R., Mitchell. A.P., 2008. Complementary adhesin function in C albicans biofilm formation. Curr. Biol. 18. 1017-1024.

Peelers, E., Neiis. HJ., Coenye, T., 2008. Comparison of multiple methods for quantification of microbial biofllms grown in microliter plates. J. Microbiol. Methods 72, 157-165.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29. e45.

Pierce, C.C., Uppuluri. P., Tristan. A.R., Wormley Jr., F.L. Mowat, E., Ramage. G., Lopez-Ribot, J.L., 2008. A simple and reproducible 96-well plate-based method for the formation of fungal biofilms and its application to antifungal susceptibility testing. Nat. Proioc. 3, 1494-1500.

Seneviratne. CJ., Jin. L., Samaranayake, LP., 2008. Biofilm lifestyle of Candida: a mini review. Oral bis. 14. 582-590.

Shuford.JA, Steckelberg.J.M., Patcl. R., 2005. Effects of fresh garlic extract on Can-dida albicans biofilms. Antimicrob. Agents Chemother. 49,473.

Staab.J.F., Bradway. S.D., Fidel. P.L., Sundstrom, P., 1999. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwpl. Science 283, 1535-1538.

Thein, Z.M., Samaranayake, Y.H., Samaranayake, L.P., 2007. In vitro biofilm formation of Candida albicans and non-albicans Candida species under dynamic and anaerobic conditions. Arch. Oral Biol. 52, 761-767.

Uppuluri, P., Chaturvedi, AX, Lopez-Ribot, J.L, 2009. Design of a simple model of Candida albicans biofilms formed under conditions of flow: development, architecture, and drug resistance. Mycopathologia 168. 101-109.

Yamada, Y., Azuma. K., 1977. Evaluation of the in vitro antifungal activity of allicin. Antimicrob. Agents Chemother. 11. 743-749.

Yan-Liang. Y., 2003. Virulence factors of Candida species. J. Microbiol. Immunol. Infect. 36. 223-228.

Alireza Khodavandi (a), Nabil S. Harmal (b), (c), Fahimeh Alizadeh (d), Olivia J. Scully (b), Shiran M. Sidik (e), Fauziah Othman (f), Zamberi Sekawi (g), Kee Peng Ng (h), Pei Pei Chong (b), (i), *

(a) Department of Paramedical Sciences, Gachsaran Branch, Islamic Azad University, Gachsaran, Iran

(b) Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor, Malaysia

(c) Department of Microbiology, Faculty of Medicine and Health Sciences, Sana'a University, Sana'a, Yemen

(d) Department of Paramedical Sciences, Yasuj Branch, Islamic Azad University, Yasuj, Iran

(e) Department of Pathology, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor, Malaysia

(f) Department of Human Anatomy, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor. Malaysia

(g) Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, University of Putra Malaysia 43400 Serdang, Selangor, Malaysia

(h) Department of Medical Microbiology, University Malaya Medical Center. 59100 Kuala Lumpur. Malaysia

(i) Institute of Bioscience, University of Putra Malaysia 43400 Serdang, Selangor, Malaysia

* Corresponding author at: Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor. Malaysia. Tel.: +60 89472302; fax: +60 89436178. E-mail address: cpp@medic.upm.edu.my (P.P. Chong).
COPYRIGHT 2011 Urban & Fischer Verlag
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Khodavandi, Alireza; Harmal, Nabil S.; Alizadeh, Fahimeh; Scully, Olivia J.; Sidik, Shiran M.; Othma
Publication:Phytomedicine: International Journal of Phytotherapy & Phytopharmacology
Article Type:Report
Geographic Code:9MALA
Date:Dec 15, 2011
Words:5566
Previous Article:In vitro antifungal, anti-elastase and anti-keratinase activity of essential oils of Cinnamomum-, Syzygium- and Cymbopogon-species against...
Next Article:Bioactive compounds from natural resources against skin aging.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters