Printer Friendly

Colecciones biologicas: una alternativa para los estudios de diversidad genetica.

BIOLOGICAL COLLECTIONS: AN ALTERNATIVE FOR GENETICS DIVERSITY STUDIES

INTRODUCCION

Colombia es reconocida internacionalmente, como un pais megadiverso, el cual alberga el 10 % de la biodiversidad del planeta, representando actualmente, un 20 % del total de aves del mundo, 7 % de mamiferos terrestres y 6 % del total de reptiles (FIERRO, 2012). El Instituto de Investigacion de Recursos Biologicos Alexander von Humboldt (IAvH), reporta que, hasta el 2009, se habian evaluado en Colombia, 47.677 especies de las cuales, el 36 %, se considera en peligro de extincion, segun la Union Internacional para la Conservacion de la Naturaleza (UICN), (SECRETARIA DEL CONVENIO SOBRE LA DIVERSIDAD BIOLOGICA, 2010).

Segun el IAvH (2010), en Colombia, se registran 1.971 especies de plantas y animales amenazadas, que precisan de esfuerzos para la implementacion de estrategias de conservacion y uso sostenible de estos recursos biologicos. Este panorama de impacto, sobre la biodiversidad, se ve influenciado por diferentes acciones antropogenicas, que afectan areas, con elementos bioticos diversos, aun sin descubrir a lo largo del territorio colombiano, con gran numero de especies de fauna y flora, caracterizada por una restringida distribucion geografica, lo cual implica, una alta tasa de endemismos y por consiguiente, una alta vulnerabilidad de estas especies (FIERRO, 2012). No obstante, los estudios sobre biodiversidad (inventarios, monitoreos, estudios de linea base, entre otros), realizados por universidades nacionales, grupos o centros de investigacion, que generalmente, capturan ejemplares, que luego son preservados (voucher specimens), en colecciones cientificas publicas o privadas (PAEZ, 2004; VALLEJO & ACOSTA, 2005; CRISTIN & PERRILLIAT, 2011). Estas colecciones biologicas, han sido de especial relevancia para la profundizacion, de estudios biologicos, ecologicos, sistematicos, que son aprovechados por investigadores nacionales o extranjeros, incluso, para el intercambio de especimenes (MESA, 2005).

Las colecciones biologicas, han sido fundamentales para la conservacion del patrimonio biologico, al promover el conocimiento de la biodiversidad y sus usos, ademas apoyan, el desarrollo de investigaciones, que contribuyen con el inventario nacional de biodiversidad (SIMMONS & MUNOZ-SABA, 2005; DELGADILLO & GONGORA, 2009; CRISTIN & PERRILLIAT, 2011). Tradicionalmente, estas colecciones, se han utilizado como herramientas de docencia, para realizar comparaciones morfologicas/biometricas y/o para identificacion de especies. Son escasas las investigaciones moleculares, que se han adelantado utilizando ejemplares de colecciones biologicas colombianas. La mayoria de estos estudios, se han desarrollado en las areas de: sistematica clasica, ecologia y biogeografia (PAEZ, 2004; MESA, 2005; DELGADILLO & GONGORA, 2009).

Las investigaciones moleculares, registran dificultad para realizar estudios que involucren especimenes de museo, debido al notable deterioro de biomoleculas como el ADN y las proteinas, por efecto de las sustancias fijadoras, como: el formaldehido, parafina, alcohol etilico; utilizadas comunmente, para la preservacion de los ejemplares. Ademas, en algunos casos, se carece de la informacion de campo (geografica y ambiental), en el trabajo curatorial y registro de la informacion detallada (SHEDLOCK et al., 1997; SRINIVASAN et al., 2002; BOSCH et al., 2005; CAUDRON et al., 2007).

La obtencion de muestras de especies silvestres para la realizacion de estudios moleculares, sigue siendo una de las principales limitaciones, para el avance de este tipo de investigacion, debido a que muchas veces, requieren el sacrificio del animal (muestras destructivas); en otras ocasiones, es necesario la captura, para realizar la extraccion de sangre o hacer la biopsia (muestra invasiva); mientras que, en otros casos, se puede obtener el ADN, sin capturar, ni fatigar al animal (plumas sueltas, escamas de muda, heces, entre otras) o recolectando las muestras de tejido muscular, de cadaveres de animales encontrados en el campo (muestra noinvasiva) (TABERLET et al., 1999). Se considera que las muestras de las colecciones biologicas de museos, pertenecen a esta ultima categoria (BOSCH et al., 2005). Por consiguiente, es evidente, que las colecciones biologicas, deben permanecer bajo un enfoque de conservacion preventiva, con un gran potencial para profundizar en el conocimiento de la biodiversidad, incluso, en el nivel molecular (SIMONS & MUNOZ, 2005; DELGADILLO & GONGORA, 2009).

Esta investigacion, exploro la viabilidad de utilizar como fuente de extraccion de ADN, especimenes conservados en las colecciones biologicas de tres museos colombianos, que facilite, la obtencion de informacion, en el estudio de la variabilidad genetica de la especie B. schlegelii. Este tipo de analisis, puede ser un elemento fundamental para adelantar estudios: filogeneticos, biogeograficos, ecologicos y toxicologicos, con especimenes depositados en museos. Para el caso B. schlegelii, el estudio tiene una importancia destacada, debido a que la especie, presenta, ademas de discrepancias taxonomicas, una variacion en la composicion del veneno, sumado a que los accidentes por esta especie, ocupan el primer lugar en las zonas cafeteras y en el norte de Antioquia (QUINTANA et al., 2000; CASTOE & PARKINSON, 2006; ARIKAN et al., 2008). De esta forma, con la caracterizacion molecular de las diferentes poblaciones de B. schlegelii, es posible asociar la composicion del veneno, ademas de realizar investigaciones toxicologicas y bioquimicas (ALAPE-GIRON et al., 2008).

MATERIALES Y METODOS

Se revisaron las colecciones biologicas de tres museos colombianos (Anexo 1), durante los meses de septiembre, octubre y noviembre, de 2010: Serpentario y Coleccion Biologica de la Universidad del Cauca (MHNUC-Se), Coleccion Biologica del Colegio San Jose del Instituto Tecnologico Metropolitano (CSJ-H) y Museo de Historia Natural de la Universidad de Caldas (MHN-UC). Se analizaron 60 individuos (18 del MHNUC-Se, 38 de la CSJ-H y 4 de MHN-UC), de la especie B. schlegelii, fijados en formaldehido al 10 % y posteriormente, en alcohol etilico, al 75 % (MESA, 2005; SIMMONS & MUNOZ-SABA, 2005), de cada especimen, se obtuvieron fragmentos de escamas ventrales (2 [cm.sup.2] de muestra, equivalentes aproximadamente, a seis escamas de un organismo adulto). Cada muestra, se rotulo y almaceno, en tubos Eppendorf de 1,5 mL, con etanol al 70 %, segun lo recomendado por SALOMAO et al. (1999) y CAMPBELL-STATON (2008).

Las muestras se limpiaron con una solucion tampon fosfato salina (conocida por sus siglas en ingles como PBS; pH = 7,2), que remueve o elimina el fijador y disminuye la probabilidad de inhibir la reaccion de PCR, segun el protocolo comercial de QIAGEN (2006). La extraccion del ADN, se realizo por los metodos Fenol-CloroformoAlcohol-Isoamilico (KOCHER et al., 1989, BELLO et al., 2001) y el DNeasy blood and tissue kit de Qiagen (VIDAL et al., 2007), macerando una o dos escamas, de cada organismo (25 mg de muestra).

La cantidad y calidad de ADN, se determino mediante un espectrofotometro, marca NanoVue, utilizando la razon de absorbancia de 260/280 nm, donde valores entre 1,6 y 1,9 se consideran indicadores de buena calidad del ADN y muestras con valores < 1,6 pueden indicar la presencia de proteinas u otros elementos absorbentes de UV en la muestra, tales como compuestos organicos, entre ellos el fenol. Los valores > 1,9 indican la presencia de ARN (AMARU et al., 2006; LOPERA-BARRERO et al., 2008).

La amplificacion por PCR para el estudio de regiones correspondientes a los genes mitocondriales 12S, 16S y COI (Citocromo Oxidasa I), se evaluaron con los iniciadores 12Sai-12Sbi; 16Sa-16Sb (SIMON et al., 1994; OGDEN & WHITING, 2005; SHEKHAR et al., 2005), LCO1490-HCO2198 (FOLMER et al., 1994). Ademas, se disenaron dos parejas de iniciadores (18Sf-18Sr y 28Sf-28Sr), para los genes 18S y 28S del ADN ribosomal (Tabla 1), utilizando las secuencias del GenBank EF125058, de la especie Cerastes cerastes y M59413, de la especie Heterodon platirhinos. El diseno de iniciadores, se realizo con el programa Primer-BLAST.

La mezcla de reaccion para PCR, se llevo a cabo en 20 [micron]L, que contenian de 2 a 4 [micron]L de ADN, 0,8 mM de la mezcla de dNTP's, 1 unidad de Taq polimerasa, 1,5 mM de MgCl2, 0,4 [micron]M, de cada iniciador y 2 [micron]L del buffer 10X para PCR. La amplificacion, se realizo en un termociclador (Bio-Rad PTC-100), con el siguiente perfil termico: desnaturalizacion inicial de 95[grados]C x 5 min, seguido de 30 ciclos de desnaturalizacion, a 94[grados]C x 30 s, anillamiento a 50[grados]C x 30 s, extension a, 72[grados]C x 1 min y una elongacion final de 72[grados]C por 5 minutos. Los amplicones, se visualizaron, en geles de poliacrilamida al 6 %, coloreados con nitrato de plata (SANGUINETTI et al., 1994; GARCIA, 2000).

Conociendo las limitaciones y dificultades, que pueden presentarse en la amplificacion de ADN procedente de muestras obtenidas, de las colecciones biologicas (TABERLET et al., 1999; BOSCH et al., 2005), los iniciadores de PCR, se evaluaron utilizando como controles positivos, el ADN obtenido de escamas y mudas (almacenadas posteriormente, en alcohol al 70 %, sin pasar por un proceso de fijacion con formol) de tres organismos vivos de B. schlegelii y otro del genero Clelia. Para la prueba piloto, sobre tejido fijado en formol, se utilizo un ejemplar del genero Bothrops, que fue fijado por el metodo tradicional con formalina (formol o formaldehido) al 10 % y preservado en alcohol al 70 %, segun los protocolos para la preservacion y el manejo de las colecciones biologicas colombianas (MESA, 2005; SIMMONS & MUNOZ-SABA, 2005). Los productos de amplificacion por PCR, fueron visualizados en geles de poliacrilamida al 6 %, coloreados con nitrato de plata (SANGUINETTI et al., 1994; GARCIA, 2000).

RESULTADOS

Si se tiene en cuenta la evaluacion de ADN planteada por AMARU et al. (2006) y LOPERA-BARRERO et al. (2008), con el protocolo de extraccion tradicional con FenolCloroformo-Alcohol-Isoamilico, se logro extraer ADN de buena calidad, 11 de 60 muestras estudiadas (18,33 %), las concentraciones variaron entre 31 y 130,5 ng/ [micron]L. Con el kit comercial Qiagen DNeasy blood and tissue, se logro extraer ADN de buena calidad a partir de 54 muestras (90 %), con concentraciones, que oscilaron entre 103 y 160,5 ng/[micron]L. El ADN procedente de muestras de organismos vivos, fue de buena calidad (a excepcion de la muestra de Bothrops asper), independientemente, del metodo de extraccion utilizado y con un rango de variacion en la concentracion del ADN entre 110 y 125,5 ng/[micron]L.

Las amplificaciones del ADN por PCR, mostraron iniciadores muy sensibles para ser utilizados en estas muestras (Figura 1 y Tabla 2) y otros, se ven limitados para utilizarlos en la amplificacion de ADN procedente de colecciones biologicas. La evaluacion de los dos metodos de extraccion, mostraron diferencias en la eficiencia de extraccion del ADN a favor del kit comercial de Qiagen, lo cual se ve reflejado tambien, en la eficiencia de la amplificacion por PCR (Tablas 2 y 3).

[FIGURA 1 OMITIR]

DISCUSION

El porcentaje de eficiencia en la extraccion de ADN, a partir de muestras de especimenes de Bothriechis schlegelii, depositados en colecciones biologicas, fue superior ([aproximadamente igual a] 72 % mas efectivo) con el kit comercial DNeasy blood and tissue, frente al metodo tradicional Fenol-Cloroformo-Alcohol-Isoamilico. Los resultados, apoyan la hipotesis que, es posible extraer ADN, eficientemente, a partir de muestras depositadas, en museos o en colecciones biologicas, con aplicacion en estudios moleculares, que impliquen la amplificacion posterior por PCR, de genes mitocondriales y nucleares, permitiendo obtener un elevado numero de copias de una region concreta de este acido nucleico; incluso, partiendo de una minima cantidad inicial, ha facilitado extraordinariamente, el estudio con muestras que contienen poco ADN. Estos resultados, son concomitantes, con lo reportado por JIMENEZ et al. (2007), quienes extrajeron ADN, de material biologico parafinado en muestras patologicas, como: tumor congenito de pulmon, tumor de base del higado, osteosarcomas, entre otros.

La cantidad y calidad del ADN obtenido de los ejemplares de museo, fue suficiente para optimizar reacciones de PCR (Tabla 2). En este sentido, CAMPBELL-STATON (2008), obtuvieron resultados similares, a partir de muestras de ADN procedente de piel de reptil, con concentraciones de ADN, dentro del rango de 4,2 a 95,9 ng/ [micron]L. Asi mismo, SHEDLOCK et al. (1997), obtuvieron mas de un 82 %, de exito, al amplificar fragmentos de ADN mitocondrial de tamanos inferiores a 500 pb, a partir de muestras de tejido fijados en formol y posteriormente, preservados en alcohol, las cuales fueron extraidas, con el metodo clasico Fenol-Cloroformo-Alcohol-Isoamilico, con algunas modificaciones.

Se ha reportado, que las muestras procedentes de organismos fijados en formol, conservan la arquitectura del tejido y que, aunque es posible extraer ADN, su calidad se ve disminuida por la solucion fijadora, debido a que esta, produce entrecruzamiento (cross-linkage), entre los acidos nucleicos e hidroliza los puentes fosfodiester del ADN (DOUGLAS & ROGERS, 1998; GARCIA et al, 2006; JIMENEZ et al., 2007). SRINIVASAN et al. (2002) y VILLALOBOS (2006), indican que el tiempo de almacenamiento (a menor tiempo, menor ruptura del ADN), tamano del tejido y el pH del fijador utilizado para la conservacion de especimenes de museo, son cruciales para la obtencion de un ADN de buena calidad. FRANK et al. (1996), reportan que el control del pH, no era una practica comun en decadas pasadas, por tanto, puede que el fijador, afecte en mayor medida las muestras mas antiguas. Por otra parte, BEN-EZRA et al. (1991), registran que los tejidos fijados en formalina, permiten recuperar ADN de baja calidad, lo que hace dificil la amplificacion por PCR. NOGUCHI et al. (1997) y JIMENEZ et al. (2007), publicaron que la amplificacion por PCR de ADN aislado de muestras parafinadas y en formalina, es inconsistente, debido a la baja cantidad, ausencia o degradacion, casi completa del ADN causada por la formalina o la presencia de inhibidores de extraccion, incluso por el PCR, aunque esto, tambien se ve influenciado por las diferencias del metodo de extraccion.

En el presente estudio, la amplificacion por PCR, mostro variacion en el rango de eficiencia: entre 6,7 % y 100 %. Estas diferencias se pueden asociar con: 1) numero de repeticiones mayores de los genes mitocondriales por celula, con respeto al genoma nuclear, fenomeno reportado por DIAZ & BRADY (1997) y COOMBS et al. (1999). 2) tamano del fragmento de ADN amplificado, observado por GARCIA et al. (2006) y VILLALOBOS (2006), quienes reportaron amplificaciones exitosas con tamanos < 500 pb, independientemente, de las soluciones fijadoras utilizadas (incluida la formalina acida). Asimismo, FRANK et al. (1996), GIANNELLA et al. (1997) y NARDELLI et al. (2011), reportaron amplificaciones < 420 pb. GARCIA et al. (2006), argumentan, que el rompimiento del ADN, generalmente, en fragmentos cortos por el formaldehido, puede generar problemas en la obtencion de material genetico de buena calidad, necesario para la amplificacion por PCR, por lo cual, sugieren la utilizacion de iniciadores que generen amplicones cuyos pesos esperados sean bajos. 3) el estado de preservacion y almacenamiento de las muestras, tal como lo afirman FRANK et al. (1996), BERNSTEIN et al. (2002), JIMENEZ (2005) y MESA (2005), quienes lo atribuyen al efecto de las caracteristicas y propiedades de la solucion fijadora en la calidad del ADN obtenido. BEN-EZRA et al. (1991), mencionan que la magnitud del dano del ADN, es mayor con el paso de los anos de preservacion, todo lo cual, pone en evidencia, el alto riesgo de fragmentacion del ADN, con el paso del tiempo, cambios de temperatura y la solucion fijadora utilizada.

MESA (2005), indica que en Colombia, son pocas las colecciones biologicas que consideran la conservacion de tejidos, de tal forma que, se maximice la factibilidad y que puedan ser utilizados mas adelante para analisis moleculares. En este estudio, se hizo evidente, la posibilidad de amplificacion de ADN por PCR, independientemente, del tiempo de preservacion, de ejemplares de colecciones biologicas, conservadas en formol (en algunos casos con mas de 70 anos de preservacion).

En conclusion, este estudio sugiere la viabilidad, de utilizar muestras de material biologico procedente de especimenes de museo o colecciones biologicas, como una alternativa para los analisis de biodiversidad, basados en pruebas moleculares y de diversidad genetica, sin tener que realizar, esfuerzos de muestreo que implique mayor costo, riesgo y esfuerzo de colecta, ni tampoco, el sacrificio de animales silvestres, especialmente, especies en peligro de extincion o bajo alguna categoria de amenaza.

AGRADECIMIENTOS

Vicerrectoria de Investigaciones y Posgrados de la Universidad de Caldas por la financiacion de este proyecto. Fundacion Alejandro Angel Escobar, por el auxilio, a traves del fondo de apoyo a la investigacion, Beca Colombia Biodiversa convocatoria 2010. Serpentario y Coleccion Biologica de la Universidad del Cauca. Museo de Historia Natural de la Universidad de Caldas. Coleccion Biologica del Colegio San Jose del Instituto Tecnologico Metropolitano de Medellin (ITM-San Jose). Centro de Investigacion y Asesoria Ofidica "Ophidia" de Manizales, Caldas.

BIBLIOGRAFIA

ALAPE-GIRON, A., SANZ, L., ESCOLANO, J., FLORES-DIAZ, M., MADRIGAL, M., SASA, M., CALVETE, J. J., 2008.--Snake venomics of the lancehead pit viper Bothrops asper. geographic, individual, and ontogenetic variations. J. Proteome Res., 7 (8): 3556-71.

AMARU, R., MIGUEZ, H., PENALOZA, R., TORRES, G., SILVESTRE, J., CUEVAS, H., 2006.--DNA-UMSAgen, extraccion de DNA genomico para diagnostico molecular: metodo rapido y economico. Cuadernos, 2: 11-15.

ARIKAN, H., GOCMEN, B., KUMLUTAC, Y., ALPAGUT-KESKIN, N., ILGAZ, C., YILDIZ, M., 2008.--Electrophoretic characterisation of the venom samples obtained from various Anatolian snakes (Serpentes: Colubridae, Viperidae, Elapidae). J. Zoology, 4 (1): 16-28.

BELLO, N., FRANCINO, O., SANCHEZ, A., 2001.--Isolation of genomic DNA from feathers. J. Veterinary Diagnostic Investigation, 13: 162-164.

BEN-EZRA, J., JOHNSON, D. A., ROSSI, J., COOK, N., WU, A., 1991.--Effect of fixation on the amplification of nucleic acids from paraffin-embedded material by the polymerase chain reaction. J. Histochem Cytochem, 39: 351-4.

BERNSTEIN, J., THOMPSON, W., CASEY, G., DICIOCCIO, R., WHITTEMORE, A., DIEP, A., THAKORE, S., VAZIRI, S., XUE, S., HAILE, R., 2002.--Comparison of techniques for the successful detection of BRCA1 mutations in fixed paraffin-embedded tissue. Cancer Epidem., Biomarkers Prevention, 11: 809-814.

BOSCH, M., MARMI, M., FERRANDO, A., LOPEZ-GIRALDEZ, F., ANDRES, O., GARCIA-FRANQUESA, E., PONSA, M., KELLERMANN, T., BRUNO GUALLAR, B., BISBAL, F., DOMINGO-ROURA, X., 2005.--Genotipar sin capturar. Galemys, 17: 81-102.

CAMPBELL-STATON, S., 2008.--Un modificado sistema de purificacion de ADN genomico, protocolo para purificar el ADN genomico de piel de reptil. [En linea]. Disponible en: http://www.promega.com/ enotes/applications/ap0089.htm.

CASTOE, T. A. & PARKINSON, C. L., 2006.--Bayesian mixed models and the phylogeny of Pit vipers (Viperidae: Serpentes). Mol., Phylogenet. Evol., 39: 91-110.

CAUDRON, A. K., NEGRO, S. S., MULLER, C. G., BOREN, L. J., GEMMELL, N. J., 2007.--Hair sampling and genotyping from hair follicles: a minimally-invasive alternative for genetics studies in small, mobile pinnipeds and other mammals. Mar. Mamm. Sci., 23: 184-192.

COOMBS, N., GOUGH, A., PRIMROSE, J., 1999.--Optimization of DNA and RNA extraction form archival formalin-fixed tissue. Nucleic Acids Res., 27 (16): 12-14.

CRISTIN, A. & PERRILLIAT, M. C., 2011.--Las colecciones cientificas y la proteccion del patrimonio paleontologico. Bol. Soc. Geol. Mex., 63 (3): 421-427.

DELGADILLO, I. & GONGORA, F., 2009.--Estrategias didacticas en la ensenanza-aprendizaje de la biologia. Bio-grafia: Escritos sobre la Biologia y su Ensenanza, 2 (3): 148-157.

DIAZ, S. & BRADY, S., 1997.--DNA extraction from formalin-fixed, paraffin embedded tissues: protein digestion as a limiting step for retrieval of high quality DNA. Diagnostic Mol. Pathol., 6: 342-346.

DOUGLAS, M. P. & ROGERS, S. O., 1998.--DNA damage caused by common cytological fixatives. Mut. Res., 401: 77-88.

FIERRO, M. J., 2012.--Politicas mineras en Colombia. Digiprint Editores, E. U.

FOLMER, O., BLACK, M., HOEH, W., LUTZ, R., VRIJENHOEK, R., 1994.--DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol., 5: 294-299.

FRANK, T., SVOBODA, S., HSI, E., 1996.--Comparison of methods for extracting DNA from formalin-fixed paraffin sections for nonisotopic PCR. Diagnostic Mol. Pathol., 3: 220-224.

GARCIA, M. P., BENAVENTE, M. F., MELO, A. A., ROA, E. I., ROA, S. J. C., 2006.--Efecto de la fijacion en la calidad del ADN: estudio controlado con cinco fijadores. Esp. Patol, 3: 175-179.

GARCIA, P. H. M., 2000.--Electroforesis en geles de poliacrilamida: fundamentos, actualidad e importancia. Univ. Diag., 1 (2): 31-41.

GIANNELLA, C., ZITO, F. A., COLONNA, F., PARADISO, A., MARZULLO, F., ALAIBAC, M., 1997.--Comparison of formalin, ethanol, and histochoice fixation on the PCR amplification from paraffin-embedded breast cancer tissue. Eur. J. Clin. Chem. Clin. Biochem., 35: 633-5.

INSTITUTO DE INVESTIGACION DE RECURSOS BIOLOGICOS ALEXANDER VON HUMBOLDT, 2010.Amenazas sobre la biodiversidad. [En linea]. Disponible en: http://www.humboldt.org.co/iavh/ component/k2/item/131-amenazas-sobre-la-biodiversidad.

JIMENEZ, A. G., VILLALOBOS, Q. M. J., JIMENEZ, M. E., PLATERO, P. W., 2007.--Determinacion de la efectividad de cinco protocolos de extraccion de ADN a partir de material parafinado para estudios moleculares. Rev. Med. Univ. Costa Rica., 1 (1): 10-19.

JIMENEZ, G., 2005.--Diagnostico molecular de los linfomas no Hodgkin. Centro de Investigacion en Hematologia y Trastornos Afines. Universidad de Costa Rica, Vicerrectoria de Investigacion. Unidad de Genetica y Biologia Molecular.

KOCHER, T. D., THOMAS, W. K., MEYER, A., EDWARDS, S. V., PAABO, S., VILLABLANCA, F. X., WILSON, A. C., 1989.--Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Nati. Acad. Sci. USA, 86: 6196-6200.

LOPERA-BARRERO, N. M., POVH, J. A., RIBEIRO, R. P., GOMES, P. C., JACOMETO, C. B., DA SILVA, L. T., 2008.Comparacion de protocolos de extraccion de ADN con muestras de aleta y larva de peces: extraccion modificada con cloruro de sodio. Cien. Inv. Agr., 35 (1): 77-86.

MESA, R. D. P., 2005.--Protocolos para la preservacion y manejo de colecciones biologicas. Bol. Cient. Mus. Hist. Nat. U. de Caldas, 10: 117-148.

NARDELLI, M., TUNEZ, J. I., CENTRON, D., 2011.--Tecnicas de muestreo no invasivas aplicadas al estudio genetico de mamiferos. Interciencia, 36: 404-411.

NOGUCHI, M., SHUICHIROH, F., TAKEUCHI, T., HIROHASHI, S., 1997.--Modified formalin and methanol fixation methods for molecular biological and morphological analyses. Pathol. Internat., 47: 685-691.

OGDEN, T. H. & WHITING, M. F., 2005.--Phylogeny of Ephemeroptera (mayflies) based on molecular evidence. Mol. Phylogenet. Evol., 37: 625-643.

PAEZ, V., 2004.--El valor de las colecciones biologicas. Actualidades Biologicas, 26 (81): 2 pp.

QIAGEN., 2006.--DNeasy blood and tissue handbook. [En linea]. Disponible en: www.qiagen.com.

QUINTANA, J. C., OTERO, R., NUNEZ, V., TORO, F., 2000.--Estudio de la variabilidad en el veneno de dos poblaciones de Bothriechis schlegelii del suroeste y norte de Antioquia y correlacion morfometrica. Iatreia, 13 (2): 107-107.

SALOMAO, M. G., WUSTER, W., THORPE, R. S. 1999.--ADNmt phylogeny of neotropical pit vipers of the genus Bothrops (Squamata: Serpentes: Viperidae). Kaupia Darmstadt. Beit. Naturgeschichte, 8: 127-134.

SANGUINETTI, C. J., DIAS, N., SIMPSON, A. J., 1994.--Rapid silver staning and recovery of PCR products separate on polyacrylamide gels. BioTechniques, 17: 914-921.

SECRETARIA DEL CONVENIO SOBRE LA DIVERSIDAD BIOLOGICA., 2010.--Perspectiva mundial sobre la diversidad biologica 3. Progress Press Ltd.

SHEDLOCK, A. M., MARGO, M. G., PIETSCH, T. W., BENTZEN, P., 1997.--Enhanced DNA extraction and PCR amplification of mitochondrial genes from formalin-fixed museum specimens. BioThecniques, 22: 394-400.

SHEKHAR, M. S., GOPIKRISHNA, G., AZAD, I. S., 2005.--PCR-RFLP analysis of 12s and 16s mitochondrial rRNA genes from brackishwater, finfish and shellfish species. Asian Fisheries Sc., 18: 39-48.

SIMON, C., FRATI, F., BECKENBACH, A., CRESPI, B., LIU, H., FLOOK, P., 1994.--Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals Entomolog. Soc. America, 87: 651-701.

SIMMONS, J. & MUNOZ-SABA, Y., 2005.--Tipos de Colecciones: 31-43 (en) SIMMONS, J. & MUNOZ, Y (ed.) Cuidado, manejo y conservacion de las colecciones biologicas. Universidad Nacional de Colombia, Bogota.

SRINIVASAN, M., SEDMAK, D., JEWELL, S., 2002.--Effect of fixatives and tissue processing on the content and integrity nucleic acids. Am. J. Pathol., 161: 1961-1971.

TABERLET, P., WAITES, L. P., LUIKART, G., 1999.--Noninvasive genetic sampling: look before you leap. Trends Ecol. Evol., 14: 323-327.

VALLEJO, M. Y. & ACOSTA, A., 2005.--Aplicacion de indicadores de conocimiento sobre biodiversidad para el diagnostico y comparacion de colecciones biologicas. Nova Publ. Cient., 3 (4): 48-57.

VIDAL, N. DELMAS, A-S., PATRICK, D., CRUAUD, C., COULOUX, A. S., HEDGES, B. S., 2007.--The phylogeny and classification of caenophidian snakes inferred from seven nuclear protein-coding genes. C. R. Biologies, 330: 182-187.

VILLALOBOS, Q. M.J., 2006.--Implementacion de un Protocolo de Extraccion de ADN a Partir de Biopsias Humanas y Determinacion de su Calidad para PCR: Tesis, Instituto Tecnologico de Costa Rica, Escuela de Biologia Ingenieria en Biotecnologia.
Anexo 1. Ejemplares de Bothriechis schlegelii
(fijados en formol al 10 % y posteriormente,
en alcohol etilico al 75 %), de tres museos
colombianos.

Codigo de Coleccion   Procedencia             Colector

MHNUC-Se-000371       Cauca, Totoro           *

MHNUC-Se-000132       Cauca, Piendamo         Santiago Ayerbe MD.

                      Cauca, Cajibio,
                      Corregimiento La

MHNUC-Se-000442       Capilla, Vereda La      Andres Cortes
                      Union, Vertiente
                      Oriental de la
                      Cordillera
                      Occidental

MHNUC-Se-000038       Cauca, Popayan, Km      Santiago Ayerbe MD.
                      2, via
                      Popayan-Totoro

                      Cauca, El Tambo, Via
                      Popayan-Lopez

MHNUC-Se-000372       de Micay, Vertiente     Fernando Campo
                      Pacifica de la
                      Cordillera
                      Occidental, Km 81

MHNUC-Se-000384       Cauca, Popayan, de      Francisco Jose Lopez
                      la Panamericana via
                      a la Hacienda
                      Calibio

MHNUC-Se-000129       Cauca, El Tambo,        Santiago Ayerbe MD.
                      Vereda La Playa,
                      Vertiente Pacifica
                      de la Cordillera
                      Occidental

MHNUC-Se-000127       Cauca, Popayan, La      Santiago Ayerbe MD.
                      Cabuyera

MHNUC-Se-000133       Cauca, Popayan, Rio     Santiago Ayerbe MD.
                      Palace

MHNUC-Se-000130       Cauca, El Tambo,        Santiago Ayerbe MD.
                      Vereda La Playa,
                      Vertiente Pacifica
                      de la Cordillera
                      Occidental

MHNUC-Se-000131       Cauca, El Tambo, La     Santiago Ayerbe MD.
                      Playa, Vertiente
                      Pacifica de la
                      Cordillera
                      Occidental

MHNUC-Se-000015       Cauca, El Tambo,        Santiago Ayerbe MD.
                      Hacienda Las Torres,
                      Rio San Joaquin,
                      Vertiente Pacifica
                      de la Cordillera
                      Occidental

MHNUC-Se-000134       Cauca, Totoro,          Santiago Ayerbe MD.
                      Novirao

MHNUC-Se-000128       *                       *

                      Cauca, El Tambo,
                      Hacienda La

MHNUC-Se-000037       Primavera, Rio San      *
                      Joaquin, Vertiente
                      Pacifica de la
                      Cordillera
                      Occidental

MHNUC-Se-000117       Cordoba, Alto           Kjell von Sneidern
                      Quimari

MHNUC-Se-000216       Cauca, Popayan,         Santiago Ayerbe MD.
                      Julumito

MHNUC-Se-NR           Risaralda, Pereira      Edwin Royer
                      Finca El Cedral
                      (Finca de Carton de
                      Colombia)

CSJ-H-4761            Antioquia, Sonson       *

CSJ-H-4759            Choco                   *

CSJ-H-4758            Antioquia, Santo        *
                      Domingo

CSJ-H-4757            Antioquia, La Ceja      *

CSJ-H-4760            Antioquia, Andes        *

CSJ-H-4771            *                       *

CSJ-H-4769            Antioquia, Medellin,    *
                      El Poblado

CSJ-H-4768            Antioquia, San Pedro    *

CSJ-H-4767            Antioquia, San Pedro    *

CSJ-H-4766            Antioquia, San Pedro    *

CSJ-H-4764            Antioquia, San Pedro    *

CSJ-H-4762            Antioquia, San Pedro    *

CSJ-H-4765            Antioquia, San Pedro    *

CSJ-H-4778            Antioquia, San Pedro    *

CSJ-H-4777            Antioquia, Andes        *

CSJ-H-4776            Antioquia, Medellin,    *
                      Los Caunces

CSJ-H-4808            Antioquia, San Pedro    *

CSJ-H-4775            Antioquia, San Pedro    *

CSJ-H-4774            Antioquia, Medellin,    *
                      Santa Elena

CSJ-H-4773            Antioquia, Medellin,    *
                      Santa Elena

CSJ-H-4772            Antioquia, La Ceja      *

CSJ-H-4784            Risaralda, Santa        *
                      Rosa de Cabal

CSJ-H-4770            Antioquia, San Carlos   *

CSJ-H-4782            Antioquia, San Pedro    *

CSJ-H-4783            Antioquia, Yolombo,     *
                      La Cancana

CSJ-H-4755            Antioquia, Amalfi,      *
                      Rio Riachon

CSJ-H-4754            Antioquia, Santa        *
                      Rosa de Osos

CSJ-H-4750            Antioquia, La Ceja      *

CSJ-H-4749            Antioquia, Belmira      *

CSJ-H-4807            Antioquia, San          *
                      Pedro, La Lana

CSJ-H-4752            Antioquia, Sopetran     *

CSJ-H-4753            Antioquia, Santa        *
                      Rosa de Osos, San
                      Isidro

CSJ-H-4751            Antioquia, Andes        *

CSJ-H-4747            Antioquia, Sonson       *

CSJ-H-4748            Antioquia, La Ceja      *

CSJ-H-4780            Antioquia, San Pedro    *

CSJ-H-4779            Antioquia, Medellin,    *
                      Santa Elena

CSJ-H-4781            Antioquia, San Pedro    *

MHN-UC-0082           Caldas, Manizales,      Gina Maria Duque
                      Barrio Centenario

MHN-UC-0057           Caldas, Manizales       *

MHN-UC-R-0001         Caldas, Samana,         Jose Vicente Rueda
                      Selva de Florencia

MHN-UC-0081           Caldas, Manizales       Jesus Velez Estrada

Codigo de Coleccion   Ano de Colecta

MHNUC-Se-000371       1960

MHNUC-Se-000132       1991

MHNUC-Se-000442       2004

MHNUC-Se-000038       *

MHNUC-Se-000372       *

MHNUC-Se-000384       2001

MHNUC-Se-000129       1994

MHNUC-Se-000127       1993

MHNUC-Se-000133       1985

MHNUC-Se-000130       *

MHNUC-Se-000131       1998

MHNUC-Se-000015       *

MHNUC-Se-000134       1995

MHNUC-Se-000128       *

MHNUC-Se-000037       *

MHNUC-Se-000117       1949

MHNUC-Se-000216       2000

MHNUC-Se-NR           2010

CSJ-H-4761            1986

CSJ-H-4759            1941

CSJ-H-4758            1989

CSJ-H-4757            *

CSJ-H-4760            1951

CSJ-H-4771            *

CSJ-H-4769            1969

CSJ-H-4768            1937

CSJ-H-4767            1933

CSJ-H-4766            1965

CSJ-H-4764            1965

CSJ-H-4762            1960

CSJ-H-4765            *

CSJ-H-4778            *

CSJ-H-4777            *

CSJ-H-4776            1956

CSJ-H-4808            *

CSJ-H-4775            *

CSJ-H-4774            1964

CSJ-H-4773            *

CSJ-H-4772            1957

CSJ-H-4784            1972

CSJ-H-4770

CSJ-H-4782            1985

CSJ-H-4783            1988

CSJ-H-4755            1988

CSJ-H-4754            1966

CSJ-H-4750

CSJ-H-4749            1964

CSJ-H-4807            1994

CSJ-H-4752            1999

CSJ-H-4753            1998

CSJ-H-4751            *

CSJ-H-4747            *

CSJ-H-4748            *

CSJ-H-4780            1984

CSJ-H-4779            1960

CSJ-H-4781            1965

MHN-UC-0082           2002

MHN-UC-0057           *

MHN-UC-R-0001         1992

MHN-UC-0081           1985

* No se tiene informacion.


Paula A. Ossa L. (1), Javier Mauricio Giraldo M. (1), German Ariel Lopez G. (1), Lucimar G. Dias (1), Fredy A. Rivera P. (1)

* FR: 24-V-2012. FA: 24-VIII-2012.

(1) Grupo de investigacion: Genetica, Biodiversidad y Fitomejoramiento: GEBIOME, Departamento de Ciencias Biologicas, Facultad de Ciencias exactas y Naturales, universidad de Caldas, Manizales, Caldas, Colombia. e-mail: paulaandrea_ossa@hotmail.com, plamao43@hotmail.com, german.lopez@ucaldas.edu.co, lucimar. dias@ucaldas.edu.co, fredy.rivera@ucaldas.edu.co.
Tabla 1.

Iniciadores utilizados para la caracterizacion molecular
de Bothriechis schlegelii.

Gen      Iniciadores   Secuencia de los iniciadores (5'-3')

18Sr     18Sforward    ACAAACGTTTACATGGATAACCGTGGT
         18Sreverse    CGCGCCTGCTGCCTTCCTTA
28Sr     28Sforward    CGGTAACGCGACCGATCCCG
         28Sreverse    CCTCTCTCGGGGCGAACCCA
COImt    LCO1490       GGTCAACAAATCATAAAGATATTGG
         HCO2198       TAAACTTCAGGGTGACCAAAAAATCA
16S mt   16Sa          GCCTGTTTATCAAAAACAT
         16Sb          CTCCGGTTTGAACTCAGATCA
12S mt   12Sai         AACTACGATTAGATACCCTATTAT
         12Sbi         AAGAGCGACGGGCGATGTGT

Tabla 2. Comparacion de metodos de extraccion de ADN de
Bothriechis schlegelii de tres colecciones biologicas
colombianas a traves de amplificacion por PCR.

Iniciador   METODO DE EXTRACCION DE ADN

               Fenol-Cloroformo-      DNeasy blood and
              Alcohol Isoamilico       tissue Kit

            A    NA      % de      A    NA      % de
                      eficiencia             eficiencia

16Sa-16Sb   25   35      41,7      22   38      36,7
12Sa-12Sb   0    60       0        4    56      6,7
28Sf-28Sr   24   36       40       60   0       100
18Sf-18Sr   27   33       45       54   6        90

A: Amplifico, NA: No amplifico.

Tabla 3. Peso molecular aproximado en pares de bases (pb)
de las muestras amplificadas con los diferentes marcadores
moleculares.

Gen         Iniciador      Bothriechis   Clelia   Bothrops
                           schlegelii    clelia    asper

16Smt       16Sa-16Sb          600        600       600
12S mt     12Sai-12Sbi         380        380       380
COI mt   LCO1490-HCO2198       890        890        --
28r         28Sf-28Sr          115        115       115
18r         18Sf-18Sr          300        300       300
COPYRIGHT 2012 Universidad de Caldas
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2012 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Ossa L., Paula A.; Giraldo M., Javier Mauricio; Lopez G., German Ariel; Dias, Lucimar G.; Rivera P.,
Publication:Boletin Cientifico Centro De Museos De Historia Natural
Date:Jan 1, 2012
Words:5146
Previous Article:Evaluacion del impacto de actividades antropicas en el almacenamiento de carbono en biomasa vegetal en ecosistemas de alta montana de Colombia.
Next Article:Monografia de protocolos para obtener poblaciones monosexo de tilapia nilotica (Oreochromis niloticus; TREW. 1983).
Topics:

Terms of use | Privacy policy | Copyright © 2021 Farlex, Inc. | Feedback | For webmasters