Printer Friendly

Cloning of the HSPa8 gene from L1210 murine leukemia cells, expression and purification of the HSC70 protein in Escherichia coli cells using an affinity chromatography technique.

ABSTRACT

Cisplatin (DDP) and methotrexate (MTX) cross resistance occurs in the murine L1210 leukemia cell line. We have found that the HSPa8 gene coding protein, heat shock cognate protein 70 (HSC70) is expressed in both sensitive (L1210/0) and DDP-MTX cross resistant (L1210/DDP) leukemia cells. Previously we also characterized the binding properties of HSC70 to MTX. Thus, HSC70 may be involved in regulating the multidrug resistant mechanism in L1210 cells. In order to further study the protein, we successfully cloned the HSPa8 gene, expressed and purified the recombinant polyhistidine-tagged HSC70 in E.coli BL21 cells with a magnetic histidine purification system. We incorporated a polyhistidine- tag ente either the aminoor carboxyl- terminal of HSC70 by PCR. The PCR product was inserted into a pBAD-TOPO vector and transformed into E.coli cells. Conditions for expression in E.coli cells and purification in E. coli cells using affinity chromatography were optimized to determine the ideal arabinose, imidazole and NaCl concentrations. The purified recombinant HSC70 protein will be used for future studies in order to further characterize the protein.

KEYWORDS: HSC70, HSPa8 gene, protein purification, affinity chromatography

INTRODUCTION

We previously identified that the HSPa8 gene encoding protein HSC70, may be important in regulating the cisplatin (DDP) and methotrexate (MTX) cross-resistant mechanism in murine L1210 leukemia cells [1]. In order to further characterize the protein, we cloned the HSPa8 gene, isolated, and purified the recombinant HSC70 protein from the E. coli cells. We included a polyhistidine-tag onto either the amino- or carboxyl- terminal of the recombinant HSC70 protein. Because histidine strongly binds to divalent metals such as nickel, the polyhistidine tagged recombinant HSC70 can interact with nickel ions, and the protein can be eluted with imidazole which competes with the polyhistidine- tag for binding to the nickel ions [2]. During the process of purification, NaCl is used in the binding and washing buffers to minimize ion exchange interactions and inhibit protein-protein interactions [3]. The purified HSC70 will help us further characterize the role of the protein in DDP-MTX cross resistance.

Materials and Methods

DNA purification: 1 X [10.sup.7] L1210 cells were collected, and washed with 1X PBS three times. DNA was purified following the Promega Wizard plus SV miniprep protocol (Madison, WI).

PCR reaction: PCR reactions were set up so that the six-histidine tag was located on the amino- or carboxyl- terminus of the HSC70 protein. The forward primer for amino- terminal [(His).sub.6] tag was 5'- TGAGAGGAATAATAAATGCATCATCACCATCACCATTCT AAGGGACCTGCAGTTGGC-3', and the reverse primer was 5'-TTAATCCACCTCTTCA ATGGTGGGGCC-3'. The forward primer for carboxyl- terminal [(His).sub.6] tag was 5'-TGAG AGGAATAATAAATGTCTAAGGGACCTGCAGTTGGC-3', and the reverse primer was 5'-TTAATGGTGATGGTGATGATGATCCACCTCTTCAATGGTGGGGCC-3'. For each cycle of the PCR reaction, products were denatured at 95[degrees]C for 10 minutes, annealed at 53 [degrees]C for 1 minute, and extended at 72 [degrees]C for 4 minutes, total 35 cycles. The PCR products were verified by agarose gel electrophoresis.

Transformation of the HSPa8 gene into E. coli cells: The PCR product was inserted into the pBAD-TOPO vector from Invitrogen following the protocol (Carlsbad, CA). Fifty [micro]l of the transformations were spread on the pre-warmed plate and incubated at 37 [degrees]C overnight. Colonies pBAD-TOPO-HSPa8N [His.sub.6] or pBAD-TOPO-HSPa8C [his.sub.6] were picked and PCR reactions were run to detect colonies containing the correct inserts. The DNA from putatively positive clones were further purified and sent to the Molecular Research Core Facility (MRCF) at Idaho State University for sequencing to confirm the positive clones containing correct inserts.

Recombinant HSC70 protein purification: The purification process of the polyhistidine-containing recombinant HSC70 protein was performed by following the Invitrogen protocol (Carlsbad, CA). Three hundred [micro]l of the nickel-chelating ProBond resin from Invitrogen was washed with 1 ml of double distilled water, followed by 1 ml of washing buffer. The washing buffer contains 100 mM HEPES with specific concentrations of imidazole (10, 50 or 100 mM) and NaCl (0, 100, 200 or 500 mM) in order to determine the optimal concentration of imidazole and NaCl for binding and elution. After the resin was washed, 900 [micro]l of the E. coli cell lysate was added to the resin, and was put on a horizontal shaker for 1 hour at room temperature allowing the cell lysate to interact with the beads. The resin was centrifuged at 1000 RPM for 30 seconds, and the supernatant was discarded. The resin was then washed three times with 1 ml washing buffer containing 100 mM HEPES and optimal concentrations of imidazole (10 mM) and NaCl (500 mM). Nine hundred [micro]l of the elution buffer (100 mM HEPES+ 500 mM imidazole) was added to the resin, and was incubated for 1 hour at room temperature with shaking. Finally, the resin was centrifuged at 1000 RPM for 30 seconds, and the purified protein eluted from the resin was recovered from the supernatant. The purified protein was confirmed by western blotting and silver staining.

Results

1. Agarose gel electrophoresis to check and screen the putatively positive clones containing the correct HSPa8 gene with poly-histidine tag after purification of the PCR products. Ten isolates of pBAD-TOPO-HSPa8N [His.sub.6] (named as N1 to N10) and 22 of pBAD-TOPO-HSPa8C [his.sub.6] (named as C21 to C42) were selected. PCR reactions were set up to detect the positive colonies containing the correct HSPa8 gene with poly-histidine tag insert, and the agarose gel electrophoresis was used to visualize the purified PCR products. We found that clones N1 to N9, and C31, 32, 34, 35 and 40 contained inserts. The DNA from these PCR amplification products was purified and sent to MRCF for sequencing to confirm the identity of the clones. We confirmed that N4 and N9, C31 and C35 had the correct inserts and these were used for further protein purification.

[FIGURE 1 OMITTED]

2. Determination of the optimal concentration of arabinose to induce protein expression. After growing the positive colonies into LB media containing 100 [micro]g/ml of ampicillin at 37 [degrees]C overnight, arabinose was added to induce protein expression. In order to determine the optimal concentration of arabinose, different concentrations of arabinose (0.2%, 0.02% and 0.002%) were tested for the protein induction. Silver staining (Figure 2A) and western blotting analysis (Figure 2B) showed that 0.02% of arabinose had optimal effects to induce HSC70 expression in E. coli cells.

[FIGURE 2 OMITTED]

3. Purification of HSC70 with different concentration of imidazole showed that 10 mM of imidazole is the optimal concentration for protein purification. In order to purify the polyhistidine-containing recombinant HSC70 protein, imidazole and NaCl are needed in the process of purification to increase specific and decrease non-specific 10inding of the polyhistine-containing HSC70 protein to the nickel- containing resin. Thus, it is important to determine the optimal concentration of imidazole and NaCl in order to get the best HSC70 purification products. We used different concentration of imidazole (10, 50, or 100 mM) in the process of HSC70 purification. We bound proteins in the presence of 10 mM imidazole (Figure 3A), but could not detect any protein in the elution when 50 mM or 100 mM of imidazole was included in the purification step (Figure 3B and 3C). This showed that 10 mM of imidazole is the optimal concentration for HSC70 purification; and higher concentrations may not allow the protein to bind to the nickel resin.

[FIGURE 3 OMITTED]

4. Purification of HSC70 with different concentration of NaCl showed that 500 mM of NaCl is the optimal concentration for HSC70 purification. We have shown that 10 mM of imidazole in the wash buffer is the optimal concentration for HSC70 purification. However, the HSC70 protein is not thoroughly purified with 10 mM imidazole alone. In order to purify the HSCT0, we used different concentrations of NaCl (0, 100, 200, or 500 mM) in the purification process. We found that 10 mM of imidazole and 500 mM of NaCl in the washing solution are the optimal concentrations for HSC70 purification, and we detected a single clear band in the elution indicating the exclusive presence of HSC70 using the optimal concentration of imidazole and NaC1 (Figure 4A and 4B).

[FIGURE 4 OMITTED]

Discussion: HSC70 is a protein around 70 kDa belonging to the HSP70 family [4]. Exploring the three dimensional structure of the HSC70 protein showed that both the amino- and carboxyl-terminal are exposed on the outer side of the protein and not buried inside the protein [5]. This suggests we can attach the polyhistidine tag onto either end of the protein so the tagged protein can interact and bind with the nickel containing resin. To purify the HSC70 with a polyhistidine tag using the affinity chromatography technique, many factors that can affect the efficiency of the purification process must be considered such as arabinose, imidazole and NaCl concentrations. In our studies, we used different concentration of arabinose to induce protein expression, and found that 0.02% was the optimal concentration to induce the expression of HSC70 in E. coli cells.

The affinity chromatography purification process includes three major steps: protein binding, washing and elution in which imidazole and NaCl play important roles [6]. The histidine has a high affinity for nickel, thus in the binding step, the polyhistidine tagged recombinant HSC70 can interact and bind with the resin which contains hickel. The washing steps are necessary in order to wash of the unbound proteins so that only the polyhistidine tagged HSC70 will be present on the resin. The HSC70 protein was eluted with 500 mM concentration of imidazole which competes for the binding for the polyhistidine- tag to the nickel ions [7].

Imidazole and NaCl can enhance the specificity of binding of the protein with nickel resin and decrease the unspecific binding, and improve the binding and washing efficiency [8]. In our studies, we used different concentrations of imidazole and NaCl which may affect the purification and determined their optimal concentration. We found that 10 mM of imidazole and 500 mM of NaCl are the optimal concentrations in the binding and washing steps in the HSC70 purification process.

In order to test and confirm the purification products, we used both silver staining and western blotting. Only when using 10 mM of imidazole and 500 mM of NaCl in the washing steps, was there only one band detected in the elution sample by silver staining suggesting only the 70 kDa protein was present. Western blotting further confirmed the presence of HSC70 in the elution sample.

In summary, we successfully cloned the HSPa8 gene and purified the recombinant HSC70 protein in E. coli cells employing the affinity chromatography technique. The purified recombinant HSC70 protein will be used for future studies such as determination of the association of the purified HSC70 with MTX in order to further characterize the protein.

Acknowledgements: This study was supported by NIH Grant P20RR16454 from the INBRE program of the National Center for Research Resources.

References

[1.] Bhushan, A., M.P. Hacker, and T.R. Tritton, Collateral Methotrexate Resistance in Cisplatin-selected Murine Leukemia Cells. Brazilian Journal Medical and Biological Research, 1999.32: p. 827-833.

[2.] Arnold, F.H., Metal-Affinity Separations: A New Dimension in Protein Processing. Nature Biotechnology, 1991.9: p. 151-156.

[3.] Purification of Polyhistidine-Tagged Recombinant Proteins With /MAC HyperCel[TM] Resin Using AcroPrep[TM] 96-well Filter Plates or Nanosep[R] Centrifugal Devices. 2010 [cited 2010 November 18]; Available from: http:// www.pall.com/laboratory_47838.asp.

[4.] Arispe, N. and A.D. Maio, ATP and ADP Modulate a Cation Channel Formed by Hsc70 in Acidic Phospholipid Membranes. The Journal of Biological Chemistry, 2000. 275(40): p. 30839-30843.=

[5.] Flaherty, K.M., C. DeLuca-Flaherty, and D.B. McKay, Three-Dimensional Structure of the ATPase Fragment of a 70K Heat-Shock Cognate Protein. Nature, 1990. 346: p. 623-628.

[6.] Bornhorst, J.A. and J.J. Falke, Purification of Proteins Using Polyhistidine Affinity Tags. Methods in Enzymology, 2000.326: p. 245-254.

[7.] Terpe, K., Overview of Tag Protein Fusions: from Molecular and Biochemical Fundamentals to Commercial Systems Applied Microbiology and Biotechnology, 2003.60: p. 523-533.

[8.] Piatibratov, M., et al., Expression and Fast-Flow Purification of a Polyhistidine-Tagged Myoglobin-Like Aerotaxis Transducer Biochimica et Biophysica Acta (BBA)-General Subjects, 2000. 1524(2-3): p. 149-154.

Tuoen Liu (1), Zechary Rios (1), Peter P. Sheridan (2, 3), Alok Bhushan (1,3), James C.K. Lai (1, 3), and Christopher K. Daniels * (1,3)

(1) Department of Biomedical and Pharmaceutical Sciences, College of Pharmacy, (2) Department of Biological Sciences and (3) The ISU Biomedical Research Institute, Idaho State University, Pocatello, Idaho 83209

* Corresponding author: Christopher K. Daniels, Ph.D., Department of Biomedical and Pharmaceutical Sciences, College of Pharmacy. Idaho State University, 970 South 5th Avenue, Campus Box 8334. Phone: (208) 282-3324, Fax: (208) 282-3601, E-mail: cdaniels@pharmacy.isu.edu
COPYRIGHT 2011 Idaho Academy of Science
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2011 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Liu, Tuoen; Rios, Zechary; Sheridan, Peter P.; Bhushan, Alok; Lai, James C.K.; Daniels, Christopher
Publication:Journal of the Idaho Academy of Science
Article Type:Report
Geographic Code:1USA
Date:Dec 1, 2011
Words:2119
Previous Article:Is there an ideal place to collect a bacteriological sample in a non-wadable lotic system?
Next Article:Establishment of postmortem interval using insect succession.
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters