Printer Friendly

Cloning and Phylogenetic Analysis of an Actin Encoding DNA Fragment from Filamentous Fungus Trichoderma harzianum.

Byline: Ghulam Mustafa and Amer Jamil

Abstract

This study describes the isolation, cloning and phylogenetic studies of a partial sequence of actin gene from the fungus Trichoderma harzianum E-58, which was grown in Vogel's medium at 28oC and pH 5.5, with glucose as a carbon source. For the amplification of b-actin gene, the genomic DNA was subjected to the polymerase chain reaction (PCR) by using sequence specific primers. Through agarose gel electrophoresis the amplified PCR product was purified and ligated into pTZ57R/T vector. The ligation mixture was then transformed into E. coli DH10B and spread on ampicillin containing LB agar plate. Restriction analysis was done to confirm the positive transformants. Further, the gene was sequenced, and on the basis of this partial sequence, a dendrogram was made to assess homology among different fungi. These results will surely help study the regulation of cellulase gene expression in the fungus in future. (c) 2013 Friends Science Publishers

Keywords: Actin gene; Trichoderma harzianum; Cloning; E. coli; Phylogeny

Introduction

Actin is the major cytoskeletal protein and involved in a variety of processes including cellular motility, intracellular transport, cytoskeletal structure, cell-surface mobility, cytokinesis, cytoplasmic streaming, clot retardation, microvillar movement, exocytosis and endocytosis, and probably chromosomal condensation and mitosis (Sheterline et al., 1996). Within eukaryotic cells the actin is one of the most conserved protein and plays key roles in various cellular processes like cell growth regulation and motility of the components in the cells (Neveu et al., 2007). b-actin gene is very important with regard to gene expression. It is used as an internal control in gene expression studies of various organisms including fungi (Rady and Shearer,1997).

Higher eukaryotic organisms express several actin genes however their primary structure is similar. Only a single copy of the actin-encoding gene has been reported in yeast and some fungi but the genomic structure of actin- encoding genes is variable with respect to introns (Takashima et al., 1999).

For more than 50 years fungi have been used for the production of industrial enzymes and microbial biomass proteins (Irshad et al., 2008; Athar et al., 2009; Ahmed et al., 2010; Rajoka et al., 2012). Trichoderma species are reported to produce enzymes involved in the degradation of cellulose, xylan and pectin to fermentable sugars (Ahmed at al., 2009a; Mushtaq et al., 2009).

Cellulases production from Trichoderma harzianum has been improved since the development of recombinant DNA techniques (Jamil et al., 2005) and as promoter regions and intron/exon splicing signals regulate the expression of fungal genes (Ballance, 1986; Diez et al.,2000), we are in search of new promoters in order to use those for the studies of gene expression. The present report describes the isolation of actin gene (partial sequence) from T. harzianum and its cloning in E. coli. In addition, to authenticate the use of actin to study phylogenetic relationships, we have compared the sequence of the gene with those from other fungi.

Materials and Methods

Chemicals

The chemicals were purchased from Sigma Chemical Co., Missouri USA, unless otherwise stated.

Fungal Strain and Culture Conditions

T. harzianum E58 was maintained at 4oC after growing for 7 days in MYG medium (0.2% yeast extract, 2% glucose,0.2% malt extract and 2% agar) at 28oC (Ahmed et al.,2003; Ahmed et al., 2005). The fungus was cultivated in Vogel's medium for 5 days at 28oC with shaking at 120 rpm (Ahmed et al., 2007; Ahmed et al., 2012) with 1% glucose as a carbon source.

Escherichia coli DH10B served as host organism and was grown overnight in Lauria-Bertani (LB) medium containing ampicillin (50 mg/mL) at 37oC. The plasmid pTZ57R/T (Fermentas) containing ampicillin resistance gene and was used for cloning of actin gene.

Isolation and Manipulation of Nucleic Acids

For DNA isolation, the fungus was grown in Vogel's medium supplemented with 2% glucose. DNA was extracted as described previously (Al-Sammarie and Schmid, 2000; Saadia et al., 2008).

PCR Amplification of Actin Partial Gene Sequence

Using DNA as a template, a partial actin gene was amplified by PCR technique with Taq polymerase (Fermentas). The net sequence of the primers was: Forward 5/- TATCATGATCGGTATGGGTCAGAAGGACTCC Reverse 5/- CATCACAATGTTGCCGTAGAGCTCCTTTCGG

The amplification was carried out under the following conditions: 35 cycles of 1 min at 94oC, 1 min at 42oC and 1 min at 72oC, with a final extension of 10 min at 72oC. The PCR products were separated through electrophoresis on agarose gel and visualized by ethidium bromide staining. The amplicon of expected size was gel purified by DNA extraction kit (Qiagen kit).

Cloning of the Actin Gene

The PCR amplified b-actin partial gene sequence was ligated into the pTZ57R/T plasmid with the help of DNA ligase by using Ins T/A CloneTM PCR product cloning kit. E. coli competent cells were used for the transformation of ligated products. From successful transformations the colonies were picked up and cultured overnight in LB medium and used for miniprep analysis. Plasmid preparations were carried out using the Qiagen Miniprep Kit. Recombinant vectors were double digested with EcoR1 and HindIII under optimal buffering conditions at 37oC for 1 h to confirm the presence of insert.

Sequencing and Phylogeny

After restriction analyses of the clone, a 3.6 kb EcoR1- HindIII fragment suggested that a part of it contained gene encoding an actin. This partial actin gene fragment was sequenced by the dideoxynucleotide method from Centre for Applied Molecular Biology (CAMB), Lahore, Pakistan. The partial nucleotide sequence corresponding to the gene encoding b-actin was deposited in the GenBank and allotted an accession no. HQ222609. The partial b-actin gene sequence was used to study the phylogenetic relationships among different fungi.

Results

Amplification of b-actin Partial Gene Sequence

The fungus was grown in Vogel's medium for 5 days at 28oC with shaking at 120 rpm for the isolation of genomic DNA.

To remove RNA contamination the genomic DNA was treated with RNases and subjected to PCR. Several tries were made with different MgCl2 and primer concentrations. Intense band of b-actin gene was found at 2 mM MgCl2 concentration (Fig. 1).

With the help of DNA extraction kit the amplified DNA was recovered from agarose gel and run again on 1% agarose gel for confirmation (Fig. 2).

Cloning and Restriction Analysis

The gel purified PCR product was ligated into the plasmid pTZ57R/T with the help of DNA ligase by using insT/A CloneTM PCR product cloning kit and transformed into E. coli DH 10B strain. The recombinant plasmids were selected on LB agar containing ampicillin (50 ug/mL).

Colonies of E. coli carrying the recombinant vector were cultured overnight and used for miniprep analysis. Ligation of actin was confirmed through restriction digestion. The recombinant construct was double digested with EcoRI and HindIII resulting in the separation of b-actin gene from the vector (vector size, 2886 bp) as shown in the Fig. 3. Thus restriction digestion confirmed the cloning of actin gene. The partial actin gene was sequenced and deposited to Gene Bank and assigned Gene Bank accession number HQ222609.

In this report the isolation, cloning and phylogenetic relationship of b-actin is described. BLAST (Basic Local Alignment Search Tool) has shown that this partial actin gene has 92% gene sequence similarity with Aspergillus terreus NIH2624 actin (ATEG_06973) partial mRNA and A. flavus NRRL3357 actin Act1, mRNA, 91% gene sequence similarity with T. harzianum partial actin gene and T. reesei (QM9414-Rut C30) gene for actin.

Discussion

The fungus growth conditions were in agreement with earlier work done where it was found that the optimal growth conditions of T. harzianum in Vogel's medium were at 28oC, pH 5.5 and shaking at 120 rpm (Saadia et al., 2008; Ahmed et al., 2009b).

The structural designs of introns are very useful to study phylogenetic relationships. Therefore, different researchers have isolated actin genes from different fungi and studied their intron architectures. But it was unusual not unique, when it was found that Phytophthora actin genes did not contain introns and relatively low sequence conservation was found between P. megasperma actin and the actins of other fungi, and a large evolutionary distance was found between Oomycetes and other fungi (Dudler, 1990).

The actin genes of Dictyostelium (Firtel et al., 1979), Oxytricha (Kaine and Spear, 1982), and Tetrahymena (Cupples and Pearlman, 1986; Hirono et al., 1987) are also without introns. Matheucci et al. (1995) isolated actin gene from T. reesei and found that it has five introns located in identical positions as reputed ancestral

Fig. 3: Digestion of recombinant plasmid by EcoR1 and HindIII. Lane 1: Recombinant plasmid digested by EcoR1 and HindIII. Lane 2: DNA Molecular weight marker, Fermentas

Fig. 4: Phylogenetic tree of fungal actins actin genes of Thermomyces lanuginosus and A. nidulans. Similarly, Diez et al. (2001) isolated actin gene from Penicillium chrysogenum and found that after splicing the predicted protein exposed 90% identity to actins from fungi and grouping of P. chrysogenum was found to be very close to those from the bulk of filamentous fungi.

The phylogenetic analysis of highly conserved b-actin gene from T. harzianum perfectly agrees with taxonomical classification. In future, this knowledge must be very useful in genetic research on fungi, as b-actin gene can be used as a control in expression analysis. Furthermore, the comparisons of actin genes from different fungi are very useful for phylogenetic studies.

Cellulases are industrially important enzymes and have many important and many potential applications, for example, in the production of bio-fuel and bio-energy, in paper and pulp idustry and in textile industry (Ghori et al.,2011; 2012). Another promising area of the cellulases is the bioconversion of renewable cellulosic biomass to sugars for fermentation of bioethanol and other biobased products also on large scale (Cherry and Fidantsef, 2003; Aygan and

Fig. 1: PCR for amplification of b-actin partial gene from Trichoderma harzianum. Lane 1, 2 PCR amplified partial actin gene from T. harzainum Lane 3: Marker (1 kb DNA ladder, Fermentas)

Fig. 2: 1% agarose gel for confirmation of gel purified PCR product. Lane 1, 2, 3 Gel purified actin partial gene (760 bp), Lane 3: Marker (1 kb DNA ladder, Fermentas)

Arikan, 2008). b-actin gene plays a very important role in cellulases expression.

In conclusion, we successfully isolated a PCR fragment of 760 bp partial actin gene from T. harzianum, cloned into pTZ57R/T and transformed into E. coli. On the basis of sequence similarities, a dendrogram was made to assess homology among different fungi (Fig. 4). Among these fungi, A. clavatus, A. terreus and Phaeosphaeria nodorum actins are thought to be evolutionarily the closest to the ancestral actins. T. reesei actin is evolutionarily closer to the ancestral actin among these fungi, but T. harzianum and Cleistogenes songorica are thought to be more diverged forms of ancestral actin. This study will help in future studies on cellulases expression.

Acknowledgements

The work was supported by a grant from Higher Education Commission, Islamabad, Government of Pakistan.

References

Ahmed, S., Qurrat-ul-Ain, N. Aslam, S. Naeem, Sajjad-ur-Rehman and A. Jamil, 2003. Induction of xylanase and cellulase genes from Trichoderma harzianum with different carbon sources. Pak. J. Biol. Sci., 6: 1912-1916

Ahmed, S., N. Aslam, F. Latif, M.I. Rajoka and A. Jamil, 2005. Molecular cloning of cellulase genes from Trichoderma harzianum. In: Frontiers in Natural Product Chemistry, Vol 1, pp: 73-75

Ahmed, S., A. Jabeen and A. Jamil, 2007. Xylanase from Trichoderma harzianum: Enzyme characterization and gene isolation. J. Chem. Soc. Pak., 29: 176-182

Ahmed, S., S. Riaz and A. Jamil, 2009a. Molecular cloning of fungal xylanases: an overview. Appl. Microbiol. Biotechnol., 84: 19-35

Ahmed, S., A. Bashir, H. Saleem, M. Saadia and A. Jamil, 2009b. Production and purification of cellulose-degrading enzymes from a filamentous fungus Trichoderma harzianum. Pak. J. Bot., 41: 1411-1419

Ahmed, S., F. Ahmad and A.S. Hashmi, 2010. Production of Microbial biomass protein by sequential culture fermentation of Arachniotus sp. and Candida utilis. Pak. J. Bot., 42: 1225-1234

Ahmed, S., S.S. Imdad and A. Jamil, 2012. Comparative study for the kinetics of extracellular xylanases from Trichoderma harzianum and Chaetomium thermophilum. Electron. J. Biotechnol., DOI: 10.2225/vol15-issue3-fulltext-2

Al-Sammarie, T.H. and J. Schmid, 2000. A simple method for extraction of fungal genomic DNA. Lett. Appl. Microbiol., 30: 53-56

Athar, M., S. Ahmed and A.S. Hashmi, 2009. Bioconversion of beet pulp to microbial biomass protein by Candida utilis. J. Chem. Soc. Pak., 31: 115-121

Aygan, A. and B. Arikan, 2008. A new halo-alkaliphilic, thermostable endoglucanase from moderately halophilic Bacillus sp.C14 Isolated from Van Soda Lake. Int. J. Agric. Biol., 10: 369-374

Ballance, D.J., 1986. Sequences important for gene expression in filamentous fungi. Yeast., 2: 229-236

Cupples, C.G. and R.E. Pearlman, 1986. Isolation and characterization of actin gene from Tetrahymena thermophila. Proc. Natl. Acad. Sci.USA., 83: 5160-5164

Cherry, J.R. and A.I. Fidantsef, 2003. Directed evolution of industrial enzymes: An update. Curr. Opin. Biotechnol., 14: 438-443

Diez, B., A. Teresa, M. Rodriguez, J. Luis, D. Fuente and J. Barredo, 2001. Structural and Phylogenetic Analysis of the g-Actin Encoding Gene from the Penicillin-Producing Fungus Penicillium chrysogenum. Curr. Microbiol., 42: 117-121

Diez, B., J. Velasco, A.T. Marcos, M. Rodriguez and J.L. Barredo, 2000. The gene encoding gamma-actin from the cephalosporin producer Acremonium chrysogenum. Appl. Microbiol. Biotechnol., 54: 786-791

Dudler, R., 1990. The single-copy actin gene of Phytophthora megasperma encodes a protein considerably diverged from any other known actin. Plant Mol. Biol., 14: 415-422

Firtel, R.A., R. Timm, A. Kimmel and M. McKeown, 1979. Unusual nucleotide sequence at the 5 end of actin genes in Dictyostelium discoideum. Proc. Natl. Acad. Sci. USA., 76: 6202-6210

Ghori, M.I., S. Ahmed, M.A. Malana and A. Jamil, 2011. Corn stover- enhanced cellulase production by Aspergillus niger NRRL 567. Afr. J. Biotechnol., 10: 5878-5886

Ghori, M.I., S. Ahmed, M.A. Malana and A. Jamil, 2012. Kinetics of exoglucanase and endoglucanase produced by Aspergillus niger NRRL 567. Afr. J. Biotechnol., 11: 7227-7231

Hirono, M., H. Endoh, N. Okada, O. Numata and Y. Watanabe, 1987.

Cloning and sequencing of the Tetrahymena actin gene and identification of its gene product. J. Mol. Biol., 194: 181-192

Irshad, M., S. Ahmed, F. Latif and M.I. Rajoka, 2008. Regulation of Endo-b-D- Xylanase and b- Xylosidase synthesis in Humicola lanuginosa.J. Chem. Soc. Pak., 30: 913-918

Jamil, A., S. Naim, S. Ahmed and M. Ashraf. 2005. Production of Industrially important enzymes using molecular approaches; cellulases and xylanases. In: Genetic resources and Biotechnology II, Vol. 2, p: 143-183. Thangadurai, D., T. Pullaiah, Pedro A. Balatti (eds.). Regency publications, New Delhi, India

Kaine, B.P. and B.B. Spear, 1982. Nucleotide sequence of a macronuclear gene for actin in Oxytricha fallax. Nature, 295: 430-432

Matheucci, E.J., F.H. Silva, S.E. Gogarys, C.H.B. Rossini, A. Leite, J.E. Vera, J.C. Urioste, O. Crivellaro and H.E. Dory, 1995. Structure, organization and promoter expression of the actin-encoding gene in Trichoderma reesei. Gene., 161: 103-106

Mushtaq, Z., M. Saadia, R.S. Anjum and A. Jamil, 2009. Cloning of an intronless cre1 gene from Chaetomium thermophilum. A. Microbiol.,59: 785-788

Neveu, B., M. Michaud, F. Belzile and R.R. Belanger, 2007. The Pseudozyma flocculosa actin promoter allows the strong expression of a recombinant protein in the Pseudozyma species. Appl. Microbiol. Biotechnol., 74: 1300-1307

Rady, J. and G. Shearer, 1997. Cloning and analysis of an actin-encoding cDNA from the dimorphic pathogenic fungus Histoplasma capsulatum. J. Med. Vet. Mycol., 35: 159-166

Rajoka, M.I., S. Ahmed, M. Athar, M and A.S. Hashmi, 2012. Production of microbial biomass protein from mixed substrates by sequential culture fermentation of Candida utilis and Brevibacterium lactofermentum. Ann. Microbiol., 62: 1173-1179

Saadia, M., S. Ahmed and A. Jamil, 2008. Isolation and cloning of cre1 gene from a filamentous fungus Trichoderma harzianum. Pak. J. Bot., 40: 421-426

Sheterline, P., J. Clayton, and J.C. Sparrow, 1996. Actin. Prot Profile., 2:27-28

Takashima, S., H. Iikura, A. Nakamura, M. Hidaka, H. Masaki and T.Uozumi, 1999. Comparison of gene structures and enzymatic properties between two endoglucanases from Humicola grisea. J. Biotechnol., 67: 85-97

Department of Chemistry and Biochemistry, University of Agriculture, Faisalabad-38040, Pakistan

For correspondence: amerjamil@yahoo.com

To cite this paper: Mustafa, G. and A. Jamil, 2015. Cloning and phylogenetic analysis of an actin encoding DNA fragment from filamentous fungus Trichoderma harzianum. Int. J. Agric. Biol., 15: 1013-1016
COPYRIGHT 2013 Asianet-Pakistan
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2013 Gale, Cengage Learning. All rights reserved.

Article Details
Printer friendly Cite/link Email Feedback
Author:Mustafa, Ghulam; Jamil, Amer
Publication:International Journal of Agriculture and Biology
Article Type:Report
Geographic Code:9PAKI
Date:Oct 31, 2013
Words:2713
Previous Article:Distribution and Morphological Variation of Fine Root in a Walnut- Soybean Intercropping System in the Loess Plateau of China.
Next Article:Bacillus subtilis PB6 Based-probiotic (CloSTATTM) Improves Intestinal Morphological and Microbiological Status of Broiler Chickens under Clostridium...
Topics:

Terms of use | Privacy policy | Copyright © 2019 Farlex, Inc. | Feedback | For webmasters